Иммуномодулирующий потенциал токсоплазмы гонди лизата в C57BL/6 модели мыши аутоиммунного энцефаломиелита.

Introduction

Multiple sclerosis (MS) is a chronic autoimmune disorder that leads to the degradation of myelin within the central nervous system (CNS). It predominantly impacts individuals aged 20–50 and occurs at nearly twice the rate in women compared to men (Internati et al. 2014 ; Motavallihaghi et al. 2023 ). Globally, an estimated 2.1 million people are affected by this condition, which presents in four major forms: relapsing–remitting (RRMS), progressive-relapsing (PRMS), primary progressive (PPMS), and secondary progressive (SPMS). Common symptoms include sensory loss, motor dysfunction, visual disturbances, and cognitive impairments (Lassmann 2018 ; Haki et al. 2024 ).

The disease targets oligodendrocytes and myelin-producing cells in the CNS, with auto-reactive CD4 + T-cells playing a crucial role in the autoimmune process. Although the exact cause of MS is unknown, genetic and environmental factors are known to influence its development (Das Sarma 2010 ). The disease involves the breakdown of the myelin sheath, which disrupts nerve signal transmission. External pathogens can breach the blood–brain barrier (BBB), leading to increased inflammation and disease progression (Kamimura et al. 2013 ). In MS, damage occurs to the myelin sheath, which is essential for transmitting nerve signals along nerve fibers. Minor damage to the myelin may cause slight disruptions in neural transmission. However, severe damage can completely block these signals, leading to a wide range of symptoms (Saadatnia et al. 2012 ).

There is a hypothesis that early exposure to certain infections may offer some protection against MS. The rising MS rates in developed countries could be linked to reduced infections due to improved sanitation and antibiotic use (Libbey et al. 2014 ; Cicero et al. 2021 ). Conversely, infections with specific parasites, such as Enterobius vermicularis , Ascaris lumbricoides , Strongyloides stercolaris , and Schistosoma mansoni, might mitigate MS symptoms by promoting an anti-inflammatory immune response (La Flamme et al. 2004 ; Libbey et al. 2014 ).

There is substantial evidence suggesting that parasites play a modulatory role by influencing regulatory T lymphocytes and shaping cytokine production profiles. TGF-β is a pleiotropic cytokine that, depending on the surrounding cytokine environment, can either promote the differentiation of Th17 cells (particularly in the presence of IL-6) or support regulatory T cell development. This dual role is crucial in modulating immune responses during inflammation and tolerance (Mirshafiey and Mohsenzadegan 2009 , Hajizadeh et al. 2024 ). Toxoplasmosis, caused by the protozoan parasite T. gondii, is a common infection that usually remains asymptomatic in healthy individuals but can lead to severe complications in immunocompromised or immunosuppressed patients (Safarpour et al. 2020 , Mamizadeh et al. 2025 ). Toxoplasma gondii modulates immune responses and may contribute to neuropsychiatric manifestations in autoimmune diseases like MS, though further studies are needed to elucidate this relationship (Cicero et al. 2021 ; Moradi et al. 2025 ). Some studies indicate an inverse relationship between T. gondii infection and MS, reporting lower infection rates among MS patients (Henriquez et al. 2009 ; Koskderelioglu et al. 2017 ). Higher levels of anti- Toxoplasma IgG antibodies in MS patients are linked to reduced disability and fewer relapses, though the impact of chronic T. gondii infection on MS remains debated (Saberi et al. 2018 ). Given the evidence that certain parasitic infections may influence autoimmune responses and potentially modulate disease severity in MS, we hypothesized that antigens derived from T. gondii might exert similar immunomodulatory effects. T. gondii has been reported to shift immune responses toward anti-inflammatory pathways, potentially reducing the severity of neuroinflammation. In this study, we aimed to investigate the immunoregulatory potential of T. gondii lysate antigens (TLA) using a C57BL/6 mouse model of experimental autoimmune encephalomyelitis (EAE). Specifically, we sought to assess whether TLA administration could alter the expression of key inflammatory and regulatory cytokines, reduce CNS pathology, and alleviate clinical symptoms of EAE.

Materials and methods

Animals and T. gondii strain

Female C57BL/6 mice (9–10 weeks old) were sourced from the Pasteur Institute of Iran for the current experiment and housed under standard conditions. All animal experiments were performed in compliance with the protocols approved by the Ethics Committee of Tabriz University of Medical Sciences (Ethics Committee Approval No. IR.TBZMED.REC.1400.153). The RH strain of T. gondii was maintained at the Parasitology Department of Tabriz University of Medical Sciences.

Preparation of Toxoplasma lysate antigens (TLA)

TLA was prepared following previously described methods, with minor adjustments (Ahmadpour et al. 2017 ). Parasites were collected from the intraperitoneal fluid and washed with phosphate-buffered saline (PBS; pH 7.4). Briefly, the fluid was centrifuged at 500 ×  g for 15 min, and tachyzoites were lysed through a series of freeze–thaw cycles followed by sonication (20 s at 4 °C). The lysate was then centrifuged at 10,000 ×  g for 30 min at 4 °C, after which the supernatant was collected and filtered through 0.2 μm polycarbonate filters. The protein concentration of the TLA was determined using the Bradford assay (Kruger 2009 ) and preserved at − 20 °C until further use.

Experimental autoimmune encephalomyelitis (EAE) induction

For the induction of EAE in the animal model, 200 μg of myelin oligodendrocyte glycoprotein peptide (MOG 35–55; SICBD) was dissolved in 50 μL of phosphate-buffered saline (PBS). This solution was then emulsified with an equal volume of complete Freund's adjuvant (CFA; Sigma Co, USA), which contained 500 μg of heat-killed Mycobacterium tuberculosis . The resulting MOG 35-55/CFA emulsion was administered subcutaneously (SC) into both hind flanks of the animals, with each injection containing 200 μL of the emulsion, to initiate the development of EAE. To further enhance EAE induction, mice received intraperitoneal injections of 300 ng pertussis toxin in 100 μL PBS at the time of primary TLA inoculation, with a repeat dose administered 48 h later (Hajizadeh et al. 2021 ).

Experimental groups and treatment conditions

Eighteen mice were randomly allocated into three groups: the healthy control group (HC) which received 100 μL of sterilized normal saline; the EAE-infected mice as positive control (EAE), and the EAE + TLA group, which received 100 μg/mL TLA via intraperitoneal inoculation on days 2, 4, and 6 relative to EAE initiation (administered both pre- and post-EAE triggering). The inoculation timeline is illustrated in Fig.  1 . Daily clinical scores were recorded as follows: 0 for healthy; 1 for loss of tail tone; 2 for hind limb weakness; 3 for hind limb paralysis; 4 for hind limb and forelimb paralysis; and 5 for moribund or deceased mice (Hajizadeh et al. 2024 ). Fig. 1 Scheme of the experimental design

Scheme of the experimental design

Isolation of splenocytes

On day 21 post- inoculation, the mice were euthanized with an i.p. injection ketamine (50 mg/kg) and xylazine (5 mg/kg). Splenocytes were then collected and processed for molecular and serological studies using sterile RPMI-1640 medium. To remove large clumps, the cell suspension was filtered and then washed with sterile RPMI medium (Sounbuli et al. 2023 ).

Quantitative real-time PCR assay

Total RNA was isolated from splenocytes using TRIzol® reagent (GeneAll, Korea). The quality of the extracted RNA was verified by gel electrophoresis, while its concentration and purity were determined using a NanoDrop spectrophotometer (ND1000 Technologies, Wilmington, DE) (Zeng et al. 2024 ). cDNA synthesis was carried out following the manufacturer’s protocol (Thermo Fisher Scientific, USA). The expression levels of key immune-related genes and transcription factors in the splenocytes were analyzed, including IFN-γ and T-bet (Th1 markers); IL-4 and GATA3 (Th2 markers); IL-17 and RORγT (Th17 markers); FOXP3 and TGF-β (Treg markers); as well as IL-1β and TNF-α (innate immunity markers). Real-time PCR reactions were conducted in a final volume of 20 μL, consisting of 1 μL cDNA, 10 μL of 2X SYBR-Green master mix (Biofact, Korea), and 2 μL each of forward and reverse primers. The total volume was adjusted to 20 μL with distilled water. Succinate dehydrogenase complex subunit A (SDHA) and β-actin were used as housekeeping genes. The 2 − ΔΔCt method was then used to calculate relative gene expression (Table 1 ). Table 1 Sequences of oligonucleotide primers for PCR Gene Primer Sequence (5′→3′) Product length Tm IFN-γ Forward GAGGAACTGGCAAAAGGATG 148 58 Reverse GAAGAAGGTAGTAATCAGGTGTG T-bet Forward ACCAGAACGCAGAGATCACT 207 58 Reverse GAAGGTCGGGGTAGAAACG IL-4 Forward CTCACAGCAACGAAGAACACC 201 58 Reverse TGTGGACTTGGACTCATTCAT GATA3 Forward TTGCTACTCAGGTGATCGGA 228 58 Reverse TCTTTGCGGGATAGTTTAGC IL-17 Forward AGCTTCATCTGTGTCTCTG 247 56 Reverse TCTATCAGGGTCTTCATTGC RORγT Forward GCTACCAGAGGAAGTCAATGTG 239 60 Reverse CTCCACACCACCGTATTTGC FOXP3 Forward GTGTCCGACAAGATCTGGTAG 153 58 Reverse GGCACACTCCAACACATAATAG TGF-β Forward AACTATTGCTTCAGCTCCACAGA 194 60 Reverse TTGTGTTGGTTGTAGAGGGCA IL-1β Forward ACCTGTTCTTTGAAGTTGACGG 100 60 Reverse TGCGAGATTTGAAGCTGGATG TNF-α Forward CGGTGCCTATGTCTCAGCC 150 60 Reverse GAGGGTCTGGGCCATAGAAC SDHA Forward TAACTACAAGGGACAGGTGCT 141 58 Reverse ACTACAAGGTCCAAGAGAGAAT β-actin Forward TGACAGGATGCAGAAGGAGA 104 60 Reverse TAGAGCCACCAATC CACACA

Table 1 Sequences of oligonucleotide primers for PCR Gene Primer Sequence (5′→3′) Product length Tm IFN-γ Forward GAGGAACTGGCAAAAGGATG 148 58 Reverse GAAGAAGGTAGTAATCAGGTGTG T-bet Forward ACCAGAACGCAGAGATCACT 207 58 Reverse GAAGGTCGGGGTAGAAACG IL-4 Forward CTCACAGCAACGAAGAACACC 201 58 Reverse TGTGGACTTGGACTCATTCAT GATA3 Forward TTGCTACTCAGGTGATCGGA 228 58 Reverse TCTTTGCGGGATAGTTTAGC IL-17 Forward AGCTTCATCTGTGTCTCTG 247 56 Reverse TCTATCAGGGTCTTCATTGC RORγT Forward GCTACCAGAGGAAGTCAATGTG 239 60 Reverse CTCCACACCACCGTATTTGC FOXP3 Forward GTGTCCGACAAGATCTGGTAG 153 58 Reverse GGCACACTCCAACACATAATAG TGF-β Forward AACTATTGCTTCAGCTCCACAGA 194 60 Reverse TTGTGTTGGTTGTAGAGGGCA IL-1β Forward ACCTGTTCTTTGAAGTTGACGG 100 60 Reverse TGCGAGATTTGAAGCTGGATG TNF-α Forward CGGTGCCTATGTCTCAGCC 150 60 Reverse GAGGGTCTGGGCCATAGAAC SDHA Forward TAACTACAAGGGACAGGTGCT 141 58 Reverse ACTACAAGGTCCAAGAGAGAAT β-actin Forward TGACAGGATGCAGAAGGAGA 104 60 Reverse TAGAGCCACCAATC CACACA

Sequences of oligonucleotide primers for PCR

Enzyme-linked immunosorbent assay (ELISA)

Splenocytes isolated from the mice were cultured in 24-well plates, and the supernatants were collected after 72 h. The concentrations of IFN-γ and IL-4 cytokines were measured using ELISA kits (Mabtech, Sweden) according to the manufacturer’s instructions. Optical density (OD) was then recorded at 450 nm (Xu et al. 2024 ).

Tissue preparation and pathological examination

At the end of the experiment, on day 21 post- On day 21 post-inoculation, the mice were euthanized with an i.p. injection ketamine (50 mg/kg) and xylazine (5 mg/kg), a pathological examination of the spinal cords was also conducted on the animal models. Each animal was perfused with 4% paraformaldehyde to preserve the tissues for sectioning. The lumbar segment of the spinal cord was harvested, embedded in paraffin, and sectioned. The sections were stained with Hematoxylin–Eosin (H&E) and Luxol Fast Blue (LFB) for detailed analysis (Hajizadeh et al. 2021 ).

Statistical analysis

All statistical analyses were performed using GraphPad Prism version 6.0 (GraphPad Software, San Diego, CA, USA). Quantitative data are presented as mean ± standard deviation (SD). Between-group comparisons were made using one-way ANOVA followed by Tukey’s post hoc test. For correlation analysis, Pearson's or Spearman's correlation coefficients were calculated depending on data distribution. Correlations were explored between clinical scores, cytokine levels, gene expression, and histological findings. P values < 0.05 were considered statistically significant.

Results

Clinical score and body weight

As shown in Fig.  2 , the data reveal a significant weight loss in the untreated EAE group compared to the other groups ( P  < 0.0001). Interestingly, the weight of mice in the EAE + TLA group was nearly identical to that of the healthy control group. Additionally, the clinical scores in the EAE + TLA group were significantly lower than those in the untreated EAE group, indicating a marked reduction in symptoms in the TLA-treated group ( P  < 0.01). Fig. 2 Evaluation of the effect of TLA treat body weight and clinical score of EAE-induced mice (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001)

Evaluation of the effect of TLA treat body weight and clinical score of EAE-induced mice (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001)

Results of cytokine gene expression based on RT-PCR

Analysis of mRNA expression revealed variations in key inflammatory markers. IFN-γ mRNA levels were significantly elevated in the EAE-induced group compared to the healthy control (HC) group ( P  < 0.01). However, no significant difference in IFN-γ expression was observed between the EAE + TLA and HC groups. Additionally, T-bet gene expression showed no significant differences across any of the groups. Regarding IL-4, a significant difference was observed between the TLA-treated and healthy control groups compared to the EAE group, indicating that TLA treatment upregulated IL-4 expression ( P  < 0.01). Moreover, GATA3 mRNA levels were significantly higher in the EAE + TLA group compared to the untreated EAE group ( P  < 0.001), indicating that TLA may help modulate inflammatory responses by promoting a Th2-associated pathway.

TLA’s effect on EAE was also demonstrated in IL-17 and RORγT mRNA expression levels, which in the EAE + TLA group were similar to those in the HC group and significantly lower than in the untreated EAE group ( P  < 0.01). Additionally, FOXP3 mRNA levels were significantly higher in the EAE + TLA group compared to the EAE group, where expression was lower than in both the HC and EAE + TLA groups ( P  < 0.0001), indicating a restoration of regulatory T cell function with TLA treatment. For TGF-β mRNA expression, there was a significant decrease in the EAE group compared to the other groups ( P  < 0.01). In contrast, IL-1β expression showed no significant difference between the EAE and EAE + TLA groups. Notably, TNF-α expression was significantly higher in the EAE + TLA group compared to the EAE group ( P  < 0.01) (Fig.  3 ). Fig. 3 Gene expression level of IFN-γ and T-bet (Th1 markers); IL-4 and GATA3 (Th2 markers); IL-17 and RORγT (Th17 markers); FOXP3 and TGF-β (Treg markers); IL-1β and TNF-α (innate immunity markers) in three experimental groups (Healthy control, EAE and EAE + TLA). Results are expressed as mean and SD (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

Gene expression level of IFN-γ and T-bet (Th1 markers); IL-4 and GATA3 (Th2 markers); IL-17 and RORγT (Th17 markers); FOXP3 and TGF-β (Treg markers); IL-1β and TNF-α (innate immunity markers) in three experimental groups (Healthy control, EAE and EAE + TLA). Results are expressed as mean and SD (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

Evaluation of cytokines based on ELISA

The concentrations of IL-4 and IFN-γ cytokines in the supernatant of cultured splenocytes were measured using ELISA. The results showed a decrease in IL-4 levels in the EAE group, with no significant differences between the HC and EAE + TLA groups ( P  > 0.05). In contrast, IFN-γ levels were elevated in the EAE group, while both the EAE + TLA and HC groups exhibited significantly lower IFN-γ levels compared to the EAE group ( P  < 0.001) (Fig.  4 ). Fig. 4 Serum level of IL-4 and IFN-γ based on ELISA. Results are expressed as mean and SD (* p  < 0.05, ** p  < 0.01). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

Serum level of IL-4 and IFN-γ based on ELISA. Results are expressed as mean and SD (* p  < 0.05, ** p  < 0.01). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

Histological assay

To assess inflammation, H&E staining was performed on spinal cord sections from the experimental animals (Fig.  5 ). Inflammatory cell infiltrates were predominantly observed around the central canal and marginal zones in the EAE group. Quantitative analysis using one-way ANOVA revealed a significant reduction in inflammatory cell infiltration in the TLA-treated EAE group compared to the untreated EAE group ( p  < 0.01), as shown in Fig.  5 A. Fig. 5 LFB (top wright) and H&E (top left) staining of lumbar spinal cord cross-sections. H&E-stained spinal cord sections showed that EAE + TLA exhibited reduced inflammation compared to EAE. LFB staining of spinal cord sections from both the EAE and EAE + TLA groups revealed signs of demyelination, indicated by white areas in the nerve tissue. A One way ANOVA comparison test showed the immune cell infiltration areas in TLA treat mice were lower than EAE group (** p  < 0.01). B One way ANOVA comparison test showed, the demyelination areas in TLA treat mice were lower than EAE group (*** p  < 0.001). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

LFB (top wright) and H&E (top left) staining of lumbar spinal cord cross-sections. H&E-stained spinal cord sections showed that EAE + TLA exhibited reduced inflammation compared to EAE. LFB staining of spinal cord sections from both the EAE and EAE + TLA groups revealed signs of demyelination, indicated by white areas in the nerve tissue. A One way ANOVA comparison test showed the immune cell infiltration areas in TLA treat mice were lower than EAE group (** p  < 0.01). B One way ANOVA comparison test showed, the demyelination areas in TLA treat mice were lower than EAE group (*** p  < 0.001). Comparison with healthy control (HC) is marked with (#) and comparison between groups with an (*)

To evaluate demyelination, LFB staining was applied to lumbar spinal cord sections across the study groups (Fig.  5 ). The EAE group exhibited prominent demyelinated areas, while the TLA-treated group showed a marked decrease in the extent of demyelination. One-way ANOVA confirmed a statistically significant improvement in myelin preservation in the TLA-treated group compared to the EAE group ( p  < 0.001), as illustrated in Fig.  5 B. All histological analyses were independently repeated three times to ensure reproducibility and reliability of the findings.

In the EAE group, mice exhibited significantly increased clinical scores, demyelination, cellular infiltration, and IFN-γ levels, alongside markedly decreased IL-4 levels and body weight compared to HC mice (all p  < 0.001). Administration of TLA led to significant improvements in EAE mice, characterized by increased body weight and IL-4 levels, and decreased clinical scores, demyelination, cellular infiltration, and IFN-γ expression ( p  = 0.002–0.007). Spearman correlation analysis indicated that higher body weight and IL-4 levels were associated with better disease outcomes, whereas increased demyelination, cellular infiltration, and IFN-γ levels correlated with greater disease severity. Together, these findings suggest that TLA administration provides protection in EAE by modulating inflammatory responses and reducing demyelination (Table  2 ). Table 2 Spearman correlation analysis of immunological and clinical parameters across experimental groups Variable p value (HC vs. EAE) p value (HC vs. EAE + TLA) p value (EAE vs. EAE + TLA) Spearman r Spearman p Clinical score < 0.001 0.002 0.005 − 0.72 0.0003 Weight < 0.001 0.004 0.006 0.72 0.0003 Demyelination < 0.001 0.001 0.007 − 0.68 0.0005 Cell filtration < 0.001 0.001 0.002 − 0.70 0.0004 IFN-γ < 0.001 0.003 0.004 − 0.65 0.0007 IL-4 < 0.001 0.05 0.005 0.60 0.0015

Table 2 Spearman correlation analysis of immunological and clinical parameters across experimental groups Variable p value (HC vs. EAE) p value (HC vs. EAE + TLA) p value (EAE vs. EAE + TLA) Spearman r Spearman p Clinical score < 0.001 0.002 0.005 − 0.72 0.0003 Weight < 0.001 0.004 0.006 0.72 0.0003 Demyelination < 0.001 0.001 0.007 − 0.68 0.0005 Cell filtration < 0.001 0.001 0.002 − 0.70 0.0004 IFN-γ < 0.001 0.003 0.004 − 0.65 0.0007 IL-4 < 0.001 0.05 0.005 0.60 0.0015

Spearman correlation analysis of immunological and clinical parameters across experimental groups

Discussion

Parasites are thought to play an important role in modulating the host immune system, a hypothesis supported by numerous studies. Most studies have focused on the effects of helminth antigens in modulating the immune system (Stiemsma et al. 2015 , Ravidà et al. 2016 ). The results of the present study demonstrated that administration of TLA had a significant therapeutic impact on EAE, a well-established model for multiple sclerosis. Administration of TLA effectively reduced the severity of clinical symptoms, demyelination, and cellular infiltration while restoring the anti-inflammatory cytokine IL-4 levels and body weight, compared to the untreated EAE group. Correlation analysis further supported these findings, revealing a strong positive association between body weight and reduced disease severity, and a negative correlation between IFN-γ levels and disease outcomes.

These findings highlight the immunomodulatory potential of TLA in alleviating neuroinflammation and demyelination. Previous studies have reported that certain parasitic antigens can modulate host immune responses, promoting regulatory and anti-inflammatory pathways, thus attenuating autoimmune diseases (Wilson et al. 2005 ; Correale and Farez 2011 ). T. gondii antigens, in particular, have been shown to induce a Th2-biased response, increase IL-4 production, and suppress pro-inflammatory cytokines such as IFN-γ, all of which are beneficial in controlling neuroinflammation (Jones and Fernyhough 2007 ). Our findings demonstrated increased expression levels of IL-4, GATA3, FOXP3, and TGF-β in the TLA-treated group compared to the EAE group (Fig.  3 ). The increase in Th2 cytokines (IL-4 and GATA3) was associated with downregulation of Th1 and Th17 responses, as evidenced by reduced IFN-γ and IL-17 expression levels. Notably, TNF-α expression did not significantly differ between TLA-treated and untreated EAE mice ( P  > 0.05), suggesting its modulation may be independent of the Th2-skewing effects observed with TLA treatment.

The IL-4-dependent signaling pathway is associated with increased differentiation of activated macrophages and decreased activation of other CD4 + subtypes, including Th-1 cells and Th-17 cells (Mosser and Edwards 2008 ; Peón and Terrazas 2016 ). Inflammatory cytokines released from macrophages, microglia, and T cells have been associated with more neuropsychiatric damage and MS. In addition, TNF-α-neutralizing antibodies have been shown to prevent the onset of MS and suppress the development and progression of MS symptoms (Ruddle et al. 1990 ; Inoue et al. 1996 ). On the other hand, the increase in FOXP3 and TGF-β indicates the activation of regulatory cytokines. Overall, these findings confirm the modulation of MS by toxoplasmosis. These findings align with those of previous studies, which reported that in EAE-induced mice, the expression levels of IL-4 and GATA3 were elevated, whereas IL-17 and TNF-α were downregulated (Hajizadeh et al. 2021 , Hajizadeh et al. 2024 ). This study demonstrated the suppression of inflammatory responses in EAE-induced mice and a shift in the immune system towards Th2 responses (Hajizadeh et al. 2021 ).

Histological analysis demonstrated a marked reduction in inflammatory cell infiltration in the TLA-treated groups compared to the EAE group, indicating decreased immune cell migration into the central nervous system (Fig.  5 ). This reduction correlated with improved clinical outcomes (Fig.  2 ), suggesting that attenuated neuroinflammation may contribute to the protective effects of TLA against EAE progression. Consistent with previous findings, regions exhibiting more extensive lesions and greater myelin loss showed a higher density of macrophages and lymphocytes (Lassmann 2018 ). Other studies have also shown that infiltration of inflammatory cells, including macrophages and neutrophils, causes the activation of microglia and severe destruction of nerve cells by demyelination, which ultimately leading to MS and the development of symptoms. Likewise, a study reported that myelin-rich macrophages accumulate around demyelinated areas and play a significant role in the development of disease symptoms (Popescu et al. 2013 ). These reactive cells can mediate both damage and repair through the release of cytokines, free radicals, and other factors (Lloyd and Miron 2019 ). In general, the findings of this study showed that Toxoplasma lysate antigens can regulate the gene expression of inflammatory cytokines, highlighting one of the immunomodulatory effects of these components in the EAE model. Additionally, the reduced IL-17 levels, along with decreased cell infiltration and lower presence of neutrophils and macrophages in damaged nerve tissues within the TLA-treated groups, suggest that TLA could serve as a potential inhibitor of nerve tissue degradation in multiple sclerosis patients.

The current study investigated the potential of T. gondii lysate antigens as an immunotherapeutic intervention for experimental autoimmune encephalomyelitis in C57BL/6 mice. The results demonstrated that TLA treatment significantly reduced clinical scores and demyelinated plaques in EAE group and decreased the infiltration of inflammatory cells around the central nervous system. Histological analyses revealed reduced inflammation and demyelination in the TLA-treated group compared to EAE group. Additionally, TLA treatment led to an upregulation of IL-4, GATA3, FOXP3, TGF-β, TNF-α, and, IL-1β, while downregulating IFN-γ, RORγT, and IL-17 expression. These findings indicate that TLA treatment modulates gene expression to suppress inflammatory responses and shift the immune system toward a Th2 response in EAE infected mice. Overall, the study provides promising evidence for the potential of TLA as an immunotherapeutic approach for multiple sclerosis, suggesting that further clinical trials are warranted.