Synergistic Effects of Olfactory Ecto-Mesenchymal Stem Cell Supernatant and Ellagic Acid on Demyelination and Glial Modulation in a Chronic Multiple Sclerosis Model.

Introduction

Multiple sclerosis (MS) is a chronic inflammatory, autoimmune, demyelinating disease of the central nervous system (CNS). In this disease, the body’s immune system identifies and attacks myelin antigens in the CNS (Fymat 2023 ). The prevalence of MS in women is 2 to 3 times higher than in men, and it often occurs between the ages of 20 and 40 (Walton et al. 2020 ).

The main clinical symptoms of the disease include motor paralysis and sensory loss, particularly visual and cognitive impairment (Seifi et al. 2022 ). The causes of MS are still unknown and unclear, but it seems that two factors, genetic and environmental, play an important role in the development of this disease (Zarghami et al. 2021 ). To date, there is no definitive treatment for MS, and only some medications are available to improve symptoms and slow the progression of the disease. The two main goals in treating MS are to prevent the disease from progressing and to repair the damage caused by the disease through methods such as cell therapy. Among the cell types, stem cells are particularly important, stimulating myelination and reducing axonal damage (Li et al. 2024 ).

The pathology of MS is defined by a series of histologic changes in the CNS, including early demyelinating plaques, oligodendrocyte depletion, and axonal degeneration accompanied by the formation of astrocytic scars in the white and gray matter of the brain and spinal cord and the activation of microglial cells (Mey et al. 2023 ). Research shows that the loss of axons, neurons, and synaptic dysfunction with neuroinflammation are important factors in permanent neurological disability in MS patients. Demyelinated axons tend to be destroyed due to lack of trophic support from the myelin sheath and oligodendrocytes (Tsouki and Williams 2021 ). Thus, they need a trophic source for repair and regeneration, which recently stem cell therapy has received attention in many studies.

Olfactory ecto-mesenchymal stem cells (EMSC) are a population of stem cells derived from the lamina propria of the nasal mucosa (Wang et al. 2022 ). The importance of mesenchymal stem cells is due to their multipotency to differentiate into other lineage cells, secretion of neurotrophic factors, and immune modulation (Tahmasebi and Barati 2022 ). EMSC supernatant can stimulate oligodendrocyte differentiation, remeylination and axonal repair with trophic factors including vascular endothelial growth factor (VEGF), insulin growth factor 1 (IGF-1), matrix metalloproteinase (MMP), and brain-derived neurotrophic factor (BDNF) (Gugliandolo et al. 2020 ).

On the other hand, one of the pathological hallmarks of MS is the activation of microglia and astrocytes. Astrocytes are the most abundant glial cells of the nervous system, providing trophic protection to neurons in a healthy CNS, promoting synapse formation and function, and performing other activities necessary to maintain homeostasis (Giovannoni and Quintana 2020 ). Astrocytes become reactive under stress conditions and are divided into two types including A1 reactive astrocyte (neurotoxic) and A2 reactive astrocyte (neuroprotective). Under pathological conditions, A1 can intensify pathological symptoms such as demyelination and axonal damage by secreting pro-inflammatory factors (Yu et al. 2021 ).

Microglia, as resident macrophages of the CNS, are the first line of the innate immune system in the brain (Noorzehi et al. 2018 ). Microglia are derived from erythromyeloid precursors in the yolk sac in a colony stimulating factor 1 receptor (CSF1R)-dependent manner (Prinz et al. 2021 ). Microglia phagocytose misfolded proteins, cellular debris and dying cells. In addition, microglia could control and protect neuronal functions through microglia-neuron and microglia-astrocyte crosstalk. Microglia regulate the microenvironment and maintain homeostasis in healthy and pathological conditions (Ni et al. 2024 ). In neurological disorders, these cells have been activated and respond to environmental signals by secreting inflammatory factors such as TNF-α, IL-1β, and IL-6. In addition, reactive microglia have different morphological, molecular and functional characteristics in different neurodegenerative diseases. The activated microglia are classified into two opposite phenotypes including M1 pro-inflammatory or detrimental microglia and M2 anti-inflammatory or beneficial microglia (Fan et al. 2020 ).

According to the studies, M1 phenotype of microglia and A1 phenotype of astrocytes have been observed in chronic neurodegenerative diseases such as MS (Kwon and Koh 2020 ). Therefore, modulating the activity of these cells and shifting their phenotype to a protective phenotype may help to protect, repair and ameliorate the neurological diseases. Oxidative stress and inflammation together play an important role in glial activation and neuronal loss during the neurodegeneration process (Teleanu et al. 2022 ). Today, the use of plant extracts and active ingredients is a promising treatment method to reduce inflammation in neurodegeneration and neuroinflammatory diseases. Among the phytochemicals, polyphenols such as ellagic acid (EA), curcumin, silymarin, rosmarinic acid, resveratrol, epigallocatechin gallate, and green tea leaves have gained prominence in preclinical disease studies due to their anti-inflammatory and neuroprotective properties (Sun and Shahrajabian 2023 ).

Ellagic acid, hexahydroxydiphenic acid 2,6,2′,6′-dilactone, a polyphenolic compound, metabolite of ellagitannin (hydrolyzable tannins containing EA as typical aglycone), due to its physiological activities and pharmacology has received much attention (Sallam et al. 2021 ). Polyphenols with antioxidant activity act as potential agents to reduce the risk of oxidants and free radicals. Structurally, ellagic acid has four hydroxyl groups responsible for its antioxidant properties (Rudrapal et al. 2022 ). EA restores antioxidant enzymes, prevents glutathione reduction, inhibits lipid peroxidation, and attenuates pro-inflammatory cytokines. Evidence shows that EA has many therapeutic benefits such as anti-inflammatory, neuroprotective, hepatoprotective, anti-diabetic, anti-cancer, and amelioration of cardiovascular diseases (Gupta et al. 2021 ). EA is used to eliminate free radicals, similar to antioxidant vitamins such as vitamins C and E. In addition to its antioxidant function, EA has potent anti-inflammatory activities by inhibiting pro-inflammatory cytokines (Martemucci et al. 2022 ).

On the one hand, we need to provide cytokines for neuron maintenance, oligodendrocyte differentiation, and remyelination. Therefore, transplanted cells, by differentiating into different types of neural tissue cells and using trophic factors derived from stem cells, cause the reconstruction of the functional network and act as a source of neurotrophic factors to support other cells remaining in the tissue (Kalafatakis and Karagogeos 2021 ). Cell transplantation has created a potential opportunity to treat diseases, including demyelinating diseases such as multiple sclerosis. On the other hand, regulating the phenotype of astrocytes and microglia by reducing oxidative stress and inflammatory factors through antioxidant administration can be considered an important therapeutic approach in neurodegenerative diseases (Simpson and Oliver 2020 ).

In this study, the combined effect of cell supernatant obtained from olfactory ecto-mesenchymal stem cells as a trophic source and EA as an antioxidant on the neurotoxic phenotype of astrocytes, microglia, and secreted inflammatory factors as well as the amount of remyelination in a chronic demyelinating model with cuprizone was investigated.

Materials and Methods

Animal and Study Design

All ethical considerations were approved by Saveh University of Medical Sciences regarding laboratory animals were observed. In this study, fifty adult male mice C57BL/6 (8 weeks old) were purchased and kept in the animal house under normal conditions with 12 h light and 12 h dark, and food and water were provided to them. The humidity was around 40–60%, and the temperature of the environment was normal 16–21 °C. The mice were randomly divided into the following 5 groups (10 mice in each group): Control group (Ctrl) with 1 ml/kg animal body weight solvent (DMSO and PBS at a ratio of 1:9), Chronic demyelination group with 0.2% cuprizone diet for 12 weeks (CPZ), ellagic acid group (EA) include demyelination with cuprizone plus intraperitoneal injection of 80 mg/k ellagic acid for two weeks, EMSC-CM group received intraventricular injection of cell supernatant of olfactory ecto-mesenchymal stem cells after demyelination with cuprizone, CM + EA received ellagic acid and EMSC condition medium after cuprizone. We conducted this study based on Chart 1 .

Experimental design in this study

Induction of Cuprizone Demyelination Model

Induction of a chronic demyelination model of multiple sclerosis was performed using cuprizone. C57BL/6 male mice were given a diet containing 0.2% cuprizone for 12 weeks (Tahmasebi et al. 2021 ). At the end of this period, corpus callosum (CC) tissue sections were prepared for evaluation of demyelination.

Isolation and Culture of EMSCs

For isolation and culture of EMSCs, mice were deeply anesthetized with a mixture of 100 mg/kg ketamine + 10 mg/kg xylazine, and olfactory ecto-mesenchymal stem cells (OE-MSCs) were obtained from the mucosa of the nasal cavity of mice. The tissue sample of olfactory epithelium was removed, cut into small pieces, and cultured in flasks containing Dulbecco’s modified Eagle’s medium (DMEM) under standard laboratory conditions. All ethical principles that should be followed in animal research were followed during the work. Then, after changing the culture medium, the cells that were not attached to the dish were removed and the remaining cells at the bottom of the dish were trypsinized and the culture was continued until the third passage.

EMSCs Supernatant Preparation

After the third passage, when the mesenchymal stem cells reach a density of 60–70%, the cells are washed three times with PBS and centrifuged to completely remove FBS. Then, the cells are poured into the flask, and the FBS-free culture medium is added to their container. After 24 h, the cell supernatant or culture medium secreted by the mesenchymal stem cells is collected. Then, the condition medium of OE-MSCs is filtered through a 0.22 micron filter, and about 3 µl of it is injected into the right lateral ventricle of the cuprizone mouse model through a stereotaxic device (Tahmasebi et al. 2024 ).

Intraventricular Injection of EMSCs Supernatant

After 12 weeks of demyelination model induction, EMSCs supernatant was injected intraventricularly. First, the mice were anesthetized with 100 mg/kg ketamine + 10 mg/kg xylazine. The mice were placed in a stereotaxic apparatus, and the injection was performed according to the Paxinos atlas with the following coordinates: − 0.5 mm anteroposterior, + 1.1 mm mediolateral, and 2 mm dorsoventral from the brain surface. Mesenchymal stem cells were injected using a 5-µl Hamilton syringe. A volume of 3 µl cell supernatant (Tahmasebi et al. 2024 ) was injected into the lateral (right) ventricle within 4 min. After injection, the incision was sutured, and sterile PBS (30 ml/kg body weight) was injected subcutaneously to compensate for water loss. Mice were kept warm until complete recovery, and animals were monitored daily for at least one week.

Administration of Ellagic Acid

In this study, ellagic acid (Sigma-Aldrich, St. Louis, MO) was first purchased and then mixed with solvent at a ratio of 0.1 g/ml. The solvent consisted of DMSO and PBS in a ratio of 1:9. Ellagic acid was administered intraperitoneally at 80 mg/kilogram of animal body weight daily (Sanadgol et al. 2017 ). Injection began at the end of cuprizone administration, simultaneously with the start of cell supernatant transplantation, and continued for 14 days until the end of the study.

Rotarod Test

The rotarod behavioral test was performed to evaluate motor coordination and balance in animals. This experiment was performed using an accelerated rotarod apparatus. A mouse was placed on a rotating cylinder with a diameter of 3 cm. All mice in the study groups were evaluated with this device three times a day for three consecutive days. One day before the start of the experiment, each of the mice was trained on the cylinder for 3 min, and the speed was gradually increased from 4–35 rpm. Training improved the animals’ ability and prevented frequent and accidental falls. After 24 h, each mouse was placed on the desired cylinder at the same speed. The time the animal was balanced on the rotating cylinder was recorded as latency to fall with a unit of seconds.

Sacrifice and Tissue Preparation

Finally, two weeks after surgery, animals were deeply anesthetized with ketamine/xylazine (10/1). They were perfused transcardially with a solution of 0.9% NaCl followed by 4% paraformaldehyde (PFA; Sigma-Aldrich). After removal of the brains, they were floated in 4% PFA for 3 h, and tissue processing was performed (for immunofluorescence (IF) study and specific tissue staining). For molecular assessment by qRT-PCR, several brain tissues were dissected and their CC were frozen in liquid nitrogen and finally kept at – 80 °C.

Assessment of Demyelination by LFB Staining

Luxol fast blue (LFB) staining was used to evaluate the demyelinated regions and the remyelination process in the CC in the experimental groups. At the end of the present study, to confirm the demyelination model, we performed perfusion with 4% paraformaldehyde through the heart and removed the brains of three animals. The paraffin sections were placed in xylene and hydrated in 100 and 95% ethanol, respectively. The sections were then placed in 0.1% LFB diluted in 95% ethanol with 2.5 mL of 10% acetic acid at 50 ºC for 24 h, followed by differentiation of the sections in 0.05% lithium carbonate. Tissue sections were then prepared and examined using Luxol fast blue and light microscopy. Images were captured using a camera on the light microscope (Olympus), and the percentage of myelinated area was calculated using 10 random sections per mouse. All data obtained from the above methods were quantified and presented using ImageJ software.

Evaluation of Glial Population by Immunofluorescence Method

The immunofluorescence method was used to check the number of glial cells (microglia, oligodendrocytes and astrocytes). Brain tissue was postfixed in 4% PFA overnight, then dehydrated and embedded in paraffin. Coronal sections for antigen retrieval were immersed in citrate buffer and permeabilized with 20% Tween for 30 min. The 0.1% bovine serum albumin (BSA) in 0.1% Triton was used to block non-specific markers for 1 h, followed by incubation of the slides overnight at 4 °C with primary antibodies, including anti-GFAP, anti-Iba-1, and anti-Olig2, to evaluate astrocytes, microglia/macrophages, and oligodendrocytes, respectively. Secondary antibodies (Vector Labs, CA) and 4′,6-diamidino-2-phenylindole (DAPI) and Hoechst for nuclear staining were added at room temperature for 60 min. A fluorescence microscope (Olympus BX51TRF; Olympus, Tokyo, Japan) equipped with a digital camera (Olympus) was used for slide evaluation. Positive cells were calculated using ImageJ software.

Evaluation of Gene Expression Levels by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

At the end of this study, qRT-PCR technique was used to evaluate the expression level of TGF-β, BDNF, C3, GBP2, iNOS, TNF-α, and IL-6 genes. First, total messenger RNA (mRNA) was extracted from the CC according to the Trizol protocol (Invitrogen, CA), and nearly 5 μg of total RNA was used for complementary DNA (cDNA) synthesis according to the protocol provided by the manufacturer. Amplification was performed using RealQ plus 2 × Master Mix Green (Applied Biosystems, CA), and assays were performed in triplicate for each sample and the mean was calculated, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference gene. The data were analyzed using the 2 −ΔΔCT formula, and the results were normalized relative to the control, which had a value of 1. In this study, specific primers were designed for qRT-PCR, as summarized in Table  1 . Table 1 The list of genes and their specific primers for qRT-PCR Gene abbreviation Gene full name Sequence TGF-β Transforming growth factor-β F:CCCAGCATCTGCAAAGCTC R:GTCAATGTACAGCTGCCGCA BDNF Brain-derived neurotrophic factor F:CATCCGAGGACAAGGTGGCTTG R:GCCGAACTTTCTGGTCCTCATC C3 Complement 3 F:GTGGAAATCCGAGCCGTTCTCT R:GATGGTTACGGTCTGCTGGTGA GBP2 Guanylate Binding Protein 2 F:GTTCCTACATCCTCAGCCATTCC R:CCACTGCTGATGGCATTGACGT iNOS inducible nitric oxide synthase F:GACATTACGACCCCTCCCAC R:GCACATGCAAGGAAGGGAAC TNF-α Tumor necrosis factor alpha F:TGTAGCCCACGTCGTAGCAA R:AGGTACAACCCATCGGCTGG IL-6 Interleukin 6 F:AGACAGCCACTCACCTCTTCAG R:TTCTGCCAGTGCCTCTTTGCTG

Table 1 The list of genes and their specific primers for qRT-PCR Gene abbreviation Gene full name Sequence TGF-β Transforming growth factor-β F:CCCAGCATCTGCAAAGCTC R:GTCAATGTACAGCTGCCGCA BDNF Brain-derived neurotrophic factor F:CATCCGAGGACAAGGTGGCTTG R:GCCGAACTTTCTGGTCCTCATC C3 Complement 3 F:GTGGAAATCCGAGCCGTTCTCT R:GATGGTTACGGTCTGCTGGTGA GBP2 Guanylate Binding Protein 2 F:GTTCCTACATCCTCAGCCATTCC R:CCACTGCTGATGGCATTGACGT iNOS inducible nitric oxide synthase F:GACATTACGACCCCTCCCAC R:GCACATGCAAGGAAGGGAAC TNF-α Tumor necrosis factor alpha F:TGTAGCCCACGTCGTAGCAA R:AGGTACAACCCATCGGCTGG IL-6 Interleukin 6 F:AGACAGCCACTCACCTCTTCAG R:TTCTGCCAGTGCCTCTTTGCTG

The list of genes and their specific primers for qRT-PCR

F:CCCAGCATCTGCAAAGCTC

R:GTCAATGTACAGCTGCCGCA

F:CATCCGAGGACAAGGTGGCTTG

R:GCCGAACTTTCTGGTCCTCATC

F:GTGGAAATCCGAGCCGTTCTCT

R:GATGGTTACGGTCTGCTGGTGA

F:GTTCCTACATCCTCAGCCATTCC

R:CCACTGCTGATGGCATTGACGT

F:GACATTACGACCCCTCCCAC

R:GCACATGCAAGGAAGGGAAC

F:TGTAGCCCACGTCGTAGCAA

R:AGGTACAACCCATCGGCTGG

F:AGACAGCCACTCACCTCTTCAG

R:TTCTGCCAGTGCCTCTTTGCTG

Statistical Analysis of Data

SPSS software (Statistical Package for the Social Sciences, version 24, USA) was used for data analysis, and one-way analysis of variance (ANOVA) and Tukey’s statistical post-test were used to compare the results in all groups. Data were presented as mean ± standard error of the mean (mean ± SEM). Graph Pad Prism (version 7, USA) was used to draw graphs. Significance is indicated by ∗ p < 0.05, ∗  ∗ p < 0.01, and ∗  ∗  ∗ p < 0.001.

Results

Effect of EMSCs Supernatant and Ellagic Acid Administration on TGF-β and BDNF Genes by qRT-PCR Method

The TGF-β and BDNF genes are trophic factors which are secreted by stem cells and observed in some antioxidant components. In this study, the expression levels of BDNF and TGF-β genes as trophic factors secreted by EMSCs were evaluated by qRT-PCR analysis.

The results showed that these genes have no significant difference (P ≥ 0.05) in the Ctrl, CPZ and EA groups, while the significant (P ≤ 0.001) upregulation of BDNF and TGF-β genes was observed in the groups receiving cell supernatant derived from EMSCs compared with other groups (Fig.  1 ). Fig. 1 To investigate the effect of EMSCs supernatant and EA injection on BDNF and TGF-β gene expression in CC of cuprizone chronic demyelination model by qRT-PCR method. The graphs show the expression of BDNF and TGF-β genes as trophic factors were upregulated in EMSCs supernatant groups. GAPDH gene was used as an internal control for normalization. Data are expressed as mean ± SEM. Significance is indicated by ***P < 0.001

To investigate the effect of EMSCs supernatant and EA injection on BDNF and TGF-β gene expression in CC of cuprizone chronic demyelination model by qRT-PCR method. The graphs show the expression of BDNF and TGF-β genes as trophic factors were upregulated in EMSCs supernatant groups. GAPDH gene was used as an internal control for normalization. Data are expressed as mean ± SEM. Significance is indicated by ***P < 0.001

These data demonstrate that EMSCs supernatant increases the secretion of trophic factors including BDNF and TGF-β in neurodegenerative diseases.

Effect of EMSC Supernatant and Ellagic Acid Administration on Glial Cell Population by Immunofluorescence Method

To evaluate the effect of EMSCs supernatant and ellagic acid administration on the oligodendrocyte population in CC of experimental groups, the expression of Olig2 protein was examined by immunofluorescence technique.

The results of the immunofluorescence method showed that the induction of chronic demyelination by CPZ significantly (P ≤ 0.001) reduced the number of oligodendrocytes as myelin-forming cells compared with the control group. The number of olig2-positive cells (oligodendrocytes) was significantly (P ≤ 0.05) increased in the EMSCs supernatant plus ellagic acid administration group compared with the CPZ, EA, and EMSC-CM groups (Fig.  2 A, B ). Fig. 2 Investigation of the effect of EMSCs supernatant and EA administration on oligodendrocyte population in CC of cuprizone chronic demyelination model by immunofluorescence method. (A) The images show the coronal sections at × 10 magnification of the CC including oligodendrocytes (Olig2 marker in green) and nuclei (DAPI in blue). The arrows in the images indicate the overlap of nucleus and oligodendrocytes. (B) Quantitative analysis of IF images showed that the number of Olig2-positive cells decreased in the cuprizone group and increased in the CM + EA group. Values are expressed as mean ± SEM. ***P < 0.001 and *P < 0.05

Investigation of the effect of EMSCs supernatant and EA administration on oligodendrocyte population in CC of cuprizone chronic demyelination model by immunofluorescence method. (A) The images show the coronal sections at × 10 magnification of the CC including oligodendrocytes (Olig2 marker in green) and nuclei (DAPI in blue). The arrows in the images indicate the overlap of nucleus and oligodendrocytes. (B) Quantitative analysis of IF images showed that the number of Olig2-positive cells decreased in the cuprizone group and increased in the CM + EA group. Values are expressed as mean ± SEM. ***P < 0.001 and *P < 0.05

In general, the results show that the injection of EMSCs supernatant together with ellagic acid administration is more effective in increasing the number of oligodendrocytes than either of them alone.

In this study, the astrocyte population in the CC region of five experimental groups was examined using GFAP antibody by immunofluorescence method. The images show that the chronic demyelination model induction could increase GFAP protein as a specific marker of astrocytes, which confirmed astrocytosis in MS model.

The quantitative analysis of IF images showed that GFAP + cells significantly (P ≤ 0.001) increased in CPZ group vs. Ctrl. While astrocyte population significantly (P ≤ 0.05) decreased in CPZ, EA, and EMSC-CM groups compared to CPZ (Fig.  3 A, B ). Fig. 3 Investigation of the effect of EMSCs supernatant and EA administration on the number of astrocytes in the CC of the cuprizone demyelination model by immunofluorescence method. A Images show coronal sections at × 20 magnification of CC including astrocyte cells (GFAP marker in green) and nucleus (Hoechst in orange). B Quantitative analysis of IF images showed that the number of GFAP-positive cells increased in the cuprizone group and decreased in the CM + EA group. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

Investigation of the effect of EMSCs supernatant and EA administration on the number of astrocytes in the CC of the cuprizone demyelination model by immunofluorescence method. A Images show coronal sections at × 20 magnification of CC including astrocyte cells (GFAP marker in green) and nucleus (Hoechst in orange). B Quantitative analysis of IF images showed that the number of GFAP-positive cells increased in the cuprizone group and decreased in the CM + EA group. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

The results indicate that the combination of EMSCs supernatant and EA administration can inhibit astrocytosis in CC after cuprizone model induction.

In the present study, the effect of EMSCs supernatant and EA administration on the microglial population in the CC area of the studied groups was evaluated using Iba-1 antibody and immunofluorescence method.

Quantitative analysis of the obtained images showed that the cuprizone chronic demyelination model induced a sharp increase (P ≤ 0.001 vs. Ctrl) in the number of microglia (microgliosis). These results indicate that Iba-1 positive cells were significantly (P ≤ 0.01) decreased in the group receiving the combination of EMSCs supernatant and EA compared to the CPZ group (Fig.  4 A, B ). Fig. 4 Investigation of the effect of EMSCs supernatant and EA administration on the number of microglia in the CC of the cuprizone demyelination model using immunofluorescence method. A The images show coronal sections at × 20 magnification of CC including microglial cells (Iba-1 marker in green) and nuclei (DAPI in blue). The arrows in the images indicate the overlap of the nucleus with the cells. B Quantitative analysis of IF images showed that the number of Iba-1-positive cells was more in the cuprizone group and less in the CM + EA group than in the CPZ group. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

Investigation of the effect of EMSCs supernatant and EA administration on the number of microglia in the CC of the cuprizone demyelination model using immunofluorescence method. A The images show coronal sections at × 20 magnification of CC including microglial cells (Iba-1 marker in green) and nuclei (DAPI in blue). The arrows in the images indicate the overlap of the nucleus with the cells. B Quantitative analysis of IF images showed that the number of Iba-1-positive cells was more in the cuprizone group and less in the CM + EA group than in the CPZ group. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

In conclusion, co-administration of EMSCs supernatant and ellagic acid can reduce the microglial population in a demyelination model similar to MS.

Effect of EMSCs Supernatant and Ellagic Acid Combination on Specific Genes A1 and M1 in CC of Cuprizone Model Mice by qRT-PCR Method

In the present study, the expression levels of specific genes of A1 neurotoxic astrocytes (C3 and GBP2) and M1 microglial phenotype (iNOS, TNF-α and IL-6) in CC of experimental groups were evaluated by qRT-PCR method.

The results obtained by qRT-PCR showed that induction of chronic demyelination by CPZ significantly (P ≤ 0.001 vs. control) increased the expression level of C3, GBP2, iNOS, TNF-α, and IL-6 genes compared with the control group, indicating activation of astrocytes (A1) and microglia (M1) in the CC region. The results showed that in the group treated with cell supernatant + ellagic acid administration, there was a significant decrease in the expression level of C3, GBP2 as A1 markers and, iNOS, TNF-α, and IL-6 as specific genes of M1 microglia compared to the CPZ group (Fig.  5 ). Fig. 5 To investigate the effect of EMSCs supernatant and EA injection on the expression of C3, GBP2, iNOS, TNF-α, and IL-6 genes in CC of cuprizone chronic demyelination model by qRT-PCR method. We used specific primers for ( A ) C3 and GBP2 as A1 genes, ( B ) iNOS, TNF-α and IL-6 as M1 genes. The results showed an upregulation in the expression of A1 and M1 genes in untreated CPZ mice, while treatment with EMSCs supernatant and EA combination resulted in a significant reduction of neurotoxic microglia and astrocytes. GAPDH was used as an internal control for normalization. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

To investigate the effect of EMSCs supernatant and EA injection on the expression of C3, GBP2, iNOS, TNF-α, and IL-6 genes in CC of cuprizone chronic demyelination model by qRT-PCR method. We used specific primers for ( A ) C3 and GBP2 as A1 genes, ( B ) iNOS, TNF-α and IL-6 as M1 genes. The results showed an upregulation in the expression of A1 and M1 genes in untreated CPZ mice, while treatment with EMSCs supernatant and EA combination resulted in a significant reduction of neurotoxic microglia and astrocytes. GAPDH was used as an internal control for normalization. Values are expressed as mean ± SEM. ***P < 0.001, **P < 0.01, and *P < 0.05

Finally, the results of molecular section showed that administration of EMSC supernatant containing trophic factors and ellagic acid as antioxidant can modulate glial phenotype and shift to neuroprotective types.

Effect of EMSC Supernatant and Ellagic Acid Combination on the Number of Myelinated Fibers in CC of Cuprizone Model Mice using LFB Staining

To determine the amount of demyelination and remyelination in the CC of different groups, LFB staining was performed. This specific staining is used to examine myelin, and the myelinated and demyelinated areas are observed in blue and white, respectively.

As shown in the LFB images, administration of cuprizone in the diet of mice for 12 weeks resulted in more severe demyelination in the CC in the CPZ group (white areas) than in the control group. In the EMSCs supernatant and ellagic acid group, the blue color density (myelinated area) increased compared to the CPZ group (Fig.  6 ). Fig. 6 To investigate the effect of EMSCs supernatant and EA administration on ameliorating myelin damage in CC of chronic demyelination model with cuprizone using LFB staining. Myelin sheath staining using LFB has shown that demyelinated region (white color) increased in the brain of CPZ group, while they decreased after EMSCs supernatant and EA administration. The LFB images show that there is less myelin in CC of CPZ group, while myelinated fibers area increased in CM + EA group (× 40 magnification)

To investigate the effect of EMSCs supernatant and EA administration on ameliorating myelin damage in CC of chronic demyelination model with cuprizone using LFB staining. Myelin sheath staining using LFB has shown that demyelinated region (white color) increased in the brain of CPZ group, while they decreased after EMSCs supernatant and EA administration. The LFB images show that there is less myelin in CC of CPZ group, while myelinated fibers area increased in CM + EA group (× 40 magnification)

The results show that the administration of cuprizone for 12 weeks causes chronic demyelination in the CC area, and the administration of EMSCs supernatant and ellagic acid causes remyelination in this area after demyelination.

Effect of EMSCs Supernatant and Ellagic Acid Combination on Ameliorating Behavioral Deficits in CC of Cuprizone Model Mice using Rotarod Test

The rotarod test is one of the important behavioral tests for evaluating locomotor deficits. Therefore, in the present study, we used the rotarod test to evaluate the effect of EMSCs supernatant and ellagic acid combination on the improvement of behavioral deficits. For the analysis of the rotarod results, the time spent on the drum without falling was considered as the latency to fall (seconds).

The results obtained in this section showed that administration of cuprizone diet for 12 weeks resulted in significant (P ≤ 0.001) impairment of motor coordination and balance. The present results showed that two weeks after cell and antioxidant combination therapy, the behavioral deficits were significantly improved (P ≤ 0.05) compared to CPZ mice (Fig.  7 ). Fig. 7 To evaluate the effects of EMSCs supernatant and EA injection on behavioral deficits in the cuprizone model using the rotarod test. Cuprizone administration impaired motor functions and balance, while EMSCs supernatant and EA combination caused improvement of these deficits. Values are expressed as mean ± SEM. ***P < .001 and *P < .05

To evaluate the effects of EMSCs supernatant and EA injection on behavioral deficits in the cuprizone model using the rotarod test. Cuprizone administration impaired motor functions and balance, while EMSCs supernatant and EA combination caused improvement of these deficits. Values are expressed as mean ± SEM. ***P < .001 and *P < .05

These results confirm that synergistic treatment of ecto-mesenchymal stem cells and ellagic acid can improve behavioral performance by enhancing remyelination, modulating glial cells, and reducing inflammatory factors.

Discussion

MS is a neurodegenerative disease that has undergone many attempts at treatment, but there is no definitive cure. The current treatments can only slow the progression of the disease, they cannot treat symptoms such as myelin loss, oligodendrocyte damage, and axonal destruction. Therefore, cell therapy and antioxidant supplementation may be more effective treatments for these patients. Mesenchymal stem cells have been suggested to have regenerative effects, and also antioxidant components may reduce disease progression in demyelinating diseases such as MS (10). After myelin injury, the repair process may begin in a healthy CNS by receiving signals from the injury site (McNamara et al. 2023 ). This regenerative function is deficient in chronic MS. This is because the progenitor cells in the damaged areas are either destroyed or remain quiescent and are unable to differentiate into mature oligodendrocytes. This inability to repair damaged myelin is a major barrier to the treatment of patients with MS, resulting in sensory and motor dysfunction (Dimou and Götz 2014 ). Current treatments for MS, including immunomodulatory drugs, only reduce inflammation in the nervous system and have no effect on the remyelination process. Therefore, new methods such as cell therapy and antioxidant administration are preferred to enhance myelination and nerve repair. Therefore, in the present study, we investigated the effect of simultaneous intraventricular transplantation of supernatant-derived EMSCs and ellagic acid on A1 astrocytes, M1 microglia, oligodendrocyte population, and remyelination rate in chronic cuprizone model.

At the beginning of this study, we used oral administration of cuprizone for 12 weeks to induce the chronic demyelination model. Animal models are a valuable tool for evaluating the cellular and molecular mechanisms involved in the process of myelin loss and remyelination. In the process of cuprizone-induced demyelination, myelin is destroyed by oligodendrocyte toxicity (Tahmasebi et al. 2021 ). We then used intraventricular injection of EMSCs supernatant because it does not have many of the limitations of cell injection, such as limited cell number and labeling. In parallel to this study, Tahmasebi et al. ( 2024 ) demonstrated that MSCs supernatant can reduce inflammation and increase oligodendrocyte number and remyelination (Tahmasebi et al. 2024 ).

Cuprizone toxicity is associated with oligodendrocyte death, myelin loss, and disruption of oligodendrocyte precursor maturation (Jhelum et al. 2020 ). We demonstrated that the expression of Olig2 as an oligodendrocyte marker was decreased in the corpus callosum of cuprizone model mice and increased in the CM + EA group. This shows that the presence of neurotrophic factors and antioxidants increases oligodendrocyte differentiation and migration of OPCs to damaged areas. Similar to our study, there is a report (2021) that showed Edaravone effects on the differentiation of human adipose-derived stem cells into oligodendrocyte MS model. They demonstrated that the combination of edaravone and hADSCs decreased demyelination and increased oligodendrogenesis in the cuprizone rat models (Bakhtiari et al. 2021 ).

The activation of astrocytes and microglia and CNS damage occur in the cuprizone model, which may promote inflammation and demyelination similar to MS disease (Sen et al. 2022 ). In this study, the astrocyte population was evaluated by using GFAP antibody and A1 astrocytes by C3 and GBP2 genes in cuprizone model. The results showed that cuprizone treatment caused astrocytosis and especially A1 phenotype. Combination therapy with EMSCs and ellagic acid reduced the number of astrocytes (GFAP-positive cells) and activated neurotoxic A1 astrocytes (downregulation of C3 and GBP2 genes). Similar to our results, Esser et al. showed that active astrogliosis was significantly observed in the hippocampus, corpus callosum, and cortex of cuprizone mice (Esser et al. 2018 ). In active injury, astrocytes hypertrophy, so that the cell body expands and the density of the processes decreases, and a glial wound is formed. Mesenchymal stem cells have immunomodulatory effects and secrete trophic factors on glial cells that indirectly mediate neuroprotection (Uccelli et al. 2011 ).

As mentioned above, one of the most common symptoms in neurodegenerative diseases such as MS and also in cuprizone models is microgliosis and microglial activation (Praet et al. 2014 ). Previous studies have clearly demonstrated that M1 neurotoxic microglia promote inflammation in chronic neurodegenerative diseases by secreting pro-inflammatory factors (Rashid et al. 2018 ).

In this study, microglial cells were evaluated by Iba-1 antibody and M1 microglia by iNOS, TNF-α, and IL-6 genes. The results showed that cuprizone treatment caused microgliosis (increase of Iba-1 positive cells) and upregulation of iNOS, TNF-α, and IL-6 genes for M1 microglia. Our study showed that EMSCs transplantation and ellagic acid administration decreased microgliosis and also shifted microglia to neuroprotective phenotype. Similar to the results of our study, Voß and his colleagues demonstrated that astrocytosis and microgliosis in the cuprizone model were accompanied by the expression of inflammatory cytokines such as inflammatory molecules like IL-1β, TNF -α, interferon gamma, and nitric oxide (Voß et al. 2012 ).

Therefore, the results confirmed that combination therapy including antioxidant administration with EMSCs transplantation can reduce inflammation and oxidative stress by switching microglia and astrocytes phenotype from neurotoxic to neuroprotective type.

Liu and his colleagues showed that microglial cells produce several cytotoxic agents such as ROS, which directly or indirectly participate in the damage to oligodendrocytes and myelin destruction. First, it has been reported that ROS can directly induce oligodendrocyte apoptosis and lead to myelin loss in MS. Second, ROS directly affect the fatty and protein compounds of myelin through peroxidation and cause myelin destruction through matrix metalloproteinase production. Third, oligodendrocyte progenitor cells are more sensitive to oxidative stress than mature oligodendrocytes, and therefore remyelination and CNS repair do not occur (Liu et al. 2015 ).

The degree of remyelination was evaluated using LFB as a specific stain for myelin. The present study using LFB staining proved that cuprizone model leads to demyelination in CC area. LFB images showed that EMSCs and ellagic acid treatment can improve remyelination and axonal repair, which is accompanied by inhibiting neuroinflammation by changing M1 and A1 phenotype. In line with these data, there are several reports expressing the beneficial effects of neurotrophic and antioxidant therapy in remyelination and reduction of axonal damage (Franklin et al. 2012 ). These results show that supernatant and antioxidant injections reduce inflammation and oxidative stress in the microenvironment and secretion of trophic factors cause repair of myelin and preserve the structure of the axon (Stadelmann et al. 2019 ). Similar to the results of our study, Hofer and colleagues in 2016 proved in their study that stem cells can stimulate nearby progenitor cells, which can differentiate into OPCs and the newly generated cells into remyelination (Hofer and Tuan 2016 ).

Conclusion

In conclusion, the results of this study showed that intraventricular injection of EMSCs supernatant containing trophic factors together with ellagic acid with antioxidant components can improve chronic demyelination in neurodegenerative diseases such as MS. On the one hand, factors secreted by EMSCs can change the phenotype of astrocytes and microglia to neuroprotective types (reducing neurotoxic cells such as M1 microglia and A1 astrocytes) in the damaged area and also increase oligodendrocytes and remyelination after demyelination. On the other hand, the use of antioxidants can reduce oxidative stress and inflammatory factors such as TNF-α and IL-6 due to gliosis, which can reduce disease progression and demyelination. Also, synergistic effects of olfactory ecto-mesenchymal stem cell supernatant and ellagic acid improve balance and behavioral deficits in a chronic multiple sclerosis model. Therefore, the injection of EMSCs supernatant can be considered as a suitable method to enhance remyelination and reduce inflammation by modulating the phenotype of microglia and astrocytes in diseases such as MS.