Мелатонин улучшает астроглиоз и микроглиоз в мышечной модели купризоны.

Introduction

Multiple sclerosis (MS) is defined as a chronic demyelinating autoimmune disease of the central nervous system (CNS). During this neurodegenerative disorder, aberrant immune responses in the CNS lead to damage to the axon-oligodendrocyte-myelin unit [ 1 ]. These events finally lead to several disorders and clinical specifications, including fatigue, paralysis, sensory impairments, limb weakness, and cognitive disorders [ 2 ]. In the homeostasis of CNS, astrocytes contribute to neuronal cells' proper metabolism and function [ 3 ]. Astrogliosis refers to a range of potential modifications in the astrocytes that may include the frequency of these cells as well as reversible molecular and functional alterations that are happening during CNS injuries [ 4 ]. Because of dysregulated blood– brain barrier (BBB) function, inflammatory responses, and demyelination, astrocytes are modified to a reactive form in the MS lesions. Such phenotypically reactive astrocytes are involved in the production of mediators that suppress the immune responses, promote the repair of BBB, and finally confer a neuroprotective characteristic in the CNS. On the other side, such reactive astrocytes are able to generate inflammatory mediators, which could enhance the recruitment of immune cells and promote the inflammatory responses in MS [ 5 , 6 ]. Astrocytes have the ability to form scars that prevent the reconstruction of axons [ 7 ].

Microglia are glial cells that are involved in regulating the immune response of the CNS through phagocytic activity, antigen presentation, and the secretion of immune-regulating mediators, such as cytokines, chemokines, and growth factors [ 8 ]. Microgliosis refers to a rise in the amount of microglia in the CNS, which can exacerbate the disease course in neurodegenerative disorders by secreting inflammatory mediators [ 9 ].

Melatonin, also known as N-acetyl-5-methoxytryptamine, is a hormone that is predominantly released by the pineal gland and is involved in the modulation of circadian rhythm [ 10 ]. Melatonin confers neuroprotective properties by regulating many biological processes in the CNS, including influencing oxidative stress, neuron apoptosis, neural cell inflammation, and mitochondrial regulation, in addition to its well-known role in regulating the sleep-wake cycle [ 11 , 12 ]. Melatonin is a lipophilic compound with permeability potential through cell membranes, allowing it to quickly pass through the BBB [ 13 ]. Several studies have indicated that melatonin has a neuroprotective characteristic. Melatonin has been found to have an anti-apoptotic role in a variety of neurodegenerative diseases, including Huntington's disease (HD), Alzheimer's disease (AD), and stroke [ 14 ]. Additionally, melatonin has been shown minimize the production and release of inflammatory mediators in the CNS and blood and limit chronic and acute inflammation [ 15 ]. In a model of stroke, melatonin promoted the development of oligodendrocytes as well as myelination of fibers through reducing the inflammation level in the white matter [ 16 ]. Moreover, it has been shown that melatonin improves paralysis and decreases the recruitment and accumulation of inflammatory immune cells in the experimental autoimmune encephalomyelitis (EAE) mouse model, the animal model of MS [ 17 ]. Studies have also suggested that the positive effects of some medications used in MS therapy could be attributed to an elevated level of melatonin in the serum of patients administered with such drugs [ 18 ].

Musashi1 (Msi1) is a conserved RNA binding protein (RBP) that modulates the stem cell markers expression through regulation of mRNA translation/stability. Msi1 attends in the balance between self-renewal and differentiation. Musashi1 contributes to the activation of Notch1 signaling [ 19 ]. It is noteworthy that the Jagged–Notch–Hes signaling is considered as one of the fundamentally essential regulators in dynamic changes in the cellular function and structure of the nervous system; including neural stem cell (NSC) proliferation, stem cell activity, survival, self-renewal, cell fate selection and lineage-specific transformation and differentiation, death (neuronal or glial) [ 20 , 21 ]. It should be noted that different Notch ligands and receptors may exhibit distinct actions [ 22 ]. Notch regulates synaptic plasticity, neurogenesis, migrating neurons, axon and dendrite growth, and eventually neuronal death. Multiple cell types (neurons, glial cells, vascular cells, and lymphocytes) participate in various aspects of Notch signalling in CNS injury and disease.

There is available evidence regarding the involvement of the Notch pathway in neuronal development and remyelination. NSCs can be a potential source of oligodendrocytes, and the Notch activation maintains the pool of neural stem cells (NSC) in their undifferentiated state allowing the formation of oligodendrocytes progenitor cells. In demyelinated lesions, downregulation of Notch causes to decrease in the OPC migration and population which is accompanied by astrocyte activation. Whereas, the Notch expression is being upregulated in the remyelinating process and subsequently enhanced Schwann cell precursor OPCs differentiation, Schwann cell formation, and improvement of remyelination capacity [ 23 , 24 ]. Notch signaling may be one mechanism that keeps microglial cells in the CNS in a state of rest. One function of Notch signaling during inflammatory events in the CNS should be to stop an excessive inflammatory mediator's activation [ 25 ]. Zhang et al. [ 26 ] highlighted the role for Notch during TLR-mediated inflammation in macrophages, over-expression of NICD1 or NICD2 (NOTCH receptor domains) decreased TLR-mediated production of IL-6 and TNF, production of anti-inflammatory cytokine IL-10 was increased.

In the current research, we aimed at evaluating the impact of melatonin on astrogliosis and microgliosis in the cuprizone-demyelinating mouse model of MS. Furthermore, the effect of melatonin on the mRNA expression of Musashi-1, Hes-1, and Notch-1 genes was determined.

Materials and methods

Mice and study design

Thirty adult male C57BL/6 mice (age 8-week-old) were obtained from the Pasteur Institute of Iran (Tehran, Iran), maintained under controlled conditions 23 ± 2 °C, 40–70 % humidity, and 12 h/12 h light/dark cycle, with ad libitum access to food and water. Male animals were used to avoid any effect of fluctuating hormones. After an acclimatization period (i) 10 mice received a normal diet (ctrl group) and were intra-peritoneally (IP) injected with 0.5 ml normal saline, (ii) 10 mice received the normal chow diet mixed with 0.2 % cuprizone and were IP-injected with 0.5 ml normal saline for six weeks (cuprizone group; CPZ group), and (iii) 10 mice exposed to cuprizone were simultaneously treated by daily (every day 8:00 a.m.-10:00 a.m.) 100 mg/kg/day melatonin intra-peritoneal injections for six weeks (cuprizone + melatonin group; CPZ + MLT group). All interventions were conducted in line with the legal protocol of the Tehran University of Medical Sciences Ethics Committee. This study was approved by the Institutional Animal Care and Use Committee (IACUC) and Ethics Committees of Tehran University of Medical Science (TUMS), Tehran, Iran (IR.TUMS.MEDICINE.REC.1398.595). For the care and use of animals, all relevant international, national, and institutional guidelines were followed.

Tissue collection

Animals were anesthetized by an intraperitoneal injection of 100 mg/kg Ketamine and 7 mg/kg Xylazine. The level of anesthesia was monitored by pedal reflex (firm toe pinch). Blood from the anesthetized mice was collected by cardiac puncture. Animals were euthanized via transcardial perfusion of normal saline. Brain tissues from three different groups were dissected and post-fixed in 4percent PFA then paraffin-embedding was conducted. For all images, the Coronal sections of body of the corpus callosum were provided. Furthermore, for real-time PCR the corpus callosum of each brain was rapidly isolated, frozen in liquid nitrogen, and preserved at − 80 °C for further evaluation. Six mice for real time PCR analysis and tissue sections from 4 to 10 mice per group were analyzed for IHC and LFB staining.

Luxol fast blue staining

Myelin levels were evaluated using Luxol fast blue staining, based on our prior findings [ 27 ].After deparaffinization and rehydration, 5 μm slides were placed in an LFB solution (0.01) at 56 °C for overnight. In LFB staining, myelinated areas appear in blue color, whereas the demyelinated areas emerge in white. Slides displaying the stained midline of body of the corpus callosum were scanned with a light microscope (OlympusCX310, Japan) To quantify the myelinated regions, blue color intensity was measured a densitometric scanning procedure (Image J software, USA). The proportion of the myelinated region was calculated by dividing the LFB-stained region by the overall chosen area multiplied by 100.

Immunohistochemistry

To evaluate glial cells immunohistochemistry was conducted using primary antibodies of anti-glial fibrillary acidic protein (anti-GFAP) antibody ((1:500, Abcam, UK) for detection of astrocytes, anti-mouse Iba-1 antibody (1:400; Wako, Richmond, USA) to detect microglia, anti-Olig2 antibody (1:300; Millipore sigma, USA) for detection of the precursors of oligodendrocytes, and anti-APC antibody (1:300, Santa Cruz Biotechnology) for detection of mature oligodendrocytes.

Corpus callosum sections were heated in antigen repaired buffer (sodium citrate, 0.05 % Tween 20) and quenched in 3 % H 2 O 2 . The slides were incubated in blocking solution (0.1 % Triton X-100, 1 % BSA in 0.1 M PBS) for 60 min and then in primary antibodies at 4 °C overnight in a humidity chamber. After washing with PBS, HRP goat anti-rat IgG secondary antibody (AP136P, Sigma, Germany) was used on the slides for 1 h at room temperature. Sections were incubated with DAB as a chromogen, followed by counterstaining with hematoxylin. Sections were mounted, dehydrated, and cover slipped. Slides displaying the stained midline of body of the corpus callosum were scanned with a light microscope (OlympusCX310, Japan) for quantification of the positive markers.

Quantitative Real-time gene expression

In order to evaluate mRNA expression levels of Musashi-1, Hes-1, and Notch-1, first Corpus Callosum or pineal bodies were removed from the brain tissues. Then, the pineal bodies were washed with PBS and were flash-frozen in liquid nitrogen and stored at −80 °C for gene analysis. Total RNA from corpus callosum tissues was extracted using QIAGEN RN easy Kit (Qiagen, Tokyo, Japan). Then, complementary DNA (cDNA) was synthesized using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, USA). Quantitative Real-time PCR was carried out using RealQ plus 2 × Master Mix Green (Amplicon, Denmark). To normalize the expression level of the target genes, the expression level of β-Actin (housekeeping gene) was measured. The relative amounts of target genes expression (Musashi-1, Hes-1, and Notch-1) were measured using the comparative C T approach (2 −ΔΔCT ) as described previously by Schmittgen and Livak [ 28 ]. In this report, we used the following primer sequences: Musashi-1, F: 5′- TGACCCCAAGGTGGCCTTTC -3′ and R: 5′- CGAGTGACCATCTTAGGCTG -3'; Hes-1, F: 5′- CAGGCTGGAGAGGCTGCCAAGGTT -3′ and R: 5′- CGAGGTCCCACTGTTGCTGGTGTA -3'; Notch-1, F: 5′- AGATGCTCAGGGTGTCTTCCA -3′ and R: 5′- CCGACTTGCCTAGGTCATCCAC -3'; β-Actin, F: 5′-GGCACCACACCTTCTACAATG-3′ and R: 5′- GGGGTGTTGAAGGTCTCAAAC -3′

Statistical analysis

The statistical analyses were performed with SPSS software v.24 (IBM SPSS Statistics) and graph plotting was carried out by GraphPad Prism v.7 software (GraphPad Software, La Jolla California USA). In order to determine the differences between groups, the one-way analysis of variance (ANOVA) was used and followed by Tukey post hoc tests. The data representation was conducted as mean ± sem) and P values < 0.05 were considered statistically significant levels.

Results

Melatonin Treatment Attenuated the Myelin Degeneration in the corpus callosum of CPZ mice

Myelin level in the corpus callosum of mice in the various groups were assessed by LFB staining. The level of demyelination was observed to be increased significantly in the cuprizone group compared to the control group ( P  < 0.001). Moreover, the level of demyelination was declined sharply in the mice receiving cuprizone and melatonin (CPZ + MLT) in comparison to the cuprizone group ( Fig. 1 ) (P < 0.01), demonstrating melatonin delayed the demyelination by inhibiting inflammation.

Melatonin Treatment Attenuated the Myelin Degeneration in the Corpus Callosum of CPZ Mice Upper panel: Corpus callosum was stained with Luxol fast blue (LFB) showed melatonin decreased demyelination in the corpus callosum of cuprizone-induced MS (A (Ctrl group), B (CPZ group), C (CPZ + MLT group)). LFB staining is shown in the Ctrl, CPZ, and CPZ + MLT groups. The quantitative analysis of LFB in the corpus callosum is represented in a graph (D). Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 4). Data are represented as mean ± standard error of the mean (SEM). ∗p < 0.05, ∗∗p < 0.01; and ∗∗∗p < 0.001.

Melatonin treatment reduced precursors of oligodendrocyte cell in the corpus callosum of CPZ mice

The anti- Oligo2 antibody was used to determine the precursors of oligodendrocytes in the brain cuts. Fig. 2 shows the number of oligodendrocyte precursors in the brain samples of mice. It was detected that oligodendrocyte precursor count was higher in the cuprizone receiving mice in comparison with mice fed the normal chow diet (P < 0.01). Furthermore, the number of the oligodendrocyte precursors was lower in the mice treated with cuprizone and melatonin simultaneously compared to the mice treated with cuprizone only (P < 0.05). Therefore, results suggest that melatonin could cause a decrease in Olig2 expression in the CPZ + MLT group.

Melatonin Reduced precursors of oligodendrocyte Cell in the Corpus Callosum Immunohistochemical assessment of the corpus callosum for anti olig2 antibody as a marker for OPCs (A (Ctrl group), B (CPZ group), C (CPZ + MLT group)). The number of Olig2+ cells was significantly decreased in the CPZ + MLT group compared with the CPZ group. Quantitative analysis of Olig2 positive cells in the corpus callosum is depicted in graph (D). Oligodendrocyte progenitor cells (OPCs), Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 4). Data are represented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01; and ∗∗∗p < 0.001.

Melatonin Enhanced Mature Oligodendrocyte in the corpus callosum of CPZ mice

To evaluate the mature oligodendrocytes population in the CC of mice, anti-APC (adenomatous polyposis coli) staining was done in each of the groups ( Fig. 3 ). Quantitative analysis of IHC captures revealed an apparent (p < 0.001) decrease in the number of mature oligodendrocytes in the CPZ mice as compared with the control group ( Fig. 3 ). While a considerably increased presence of these cells was found in response to the melatonin therapy implying mature oligodendrocytes increasing may stimulate damage recovery.

Melatonin enhanced matured oligodendrocytes in the corpus callosum. Immunohistochemical assessment of the corpus callosum for Anti-APC Antibody (APC) as a marker for matured oligodendrocytes (A (Ctrl group), B (CPZ group), C (CPZ + MLT group)). The number of APC-positive cells was significantly increased in the CPZ + MLT group compared with the CPZ group. The graph depicts the quantitative analysis for APC positive cells in the corpus callosum(D). Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 4). Data are represented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01; and ∗∗∗p < 0.001.

Melatonin Reduced astrogliosis in the corpus callosum of CPZ mice

To evaluate the possible effect of CPZ feeding as well as melatonin consumption on the astrocytes modification, the anti-GFAP antibody was used to detect the astrogliosis status in the corpus callosum cuts of the different groups. It was found that astrocytes count was higher in the cuprizone receiving mice in comparison to the control mice ( P  < 0.01) ( Fig. 4 ). Furthermore, treatment with melatonin effectively led to a decrease in the number of astrocytes population in the CC as compared to the cuprizone group ( P  < 0.01).

Melatonin reduced astrogliosis in corpus callosum. Immunohistochemical assessment of the corpus callosum for GFAP as a marker for astrocytes (A (Ctrl group), B (CPZ group), C (CPZ + MLT group)). The number of GFAP + cells was significantly decreased in the CPZ + MLT group compared with the CPZ group. The graph depicts the quantitative analysis for GFAP positive cells in the corpus callosum (D). Glial fibrillary acidic protein (GFAP), Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 4). Data are represented as mean ± SEM. ∗ p  < 0.05, ∗∗ p  < 0.01; and ∗∗∗ p  < 0.001.

Melatonin Reduced the Microglia in the corpus callosum of CPZ mice

To analyze the efficacy of melatonin on the number of microglia cells, we assayed the Iba-1 levels in the corpus callosum cuts. As illustrated in Fig. 5 increased count of microglia was detected following CPZ feeding (P < 0.001). In addition, data indicated that melatonin administration was able to reverse the effects of CPZ on microgliosis. A smaller number of microglia was observed in the mice treated with melatonin. ( P  < 0.05).

Melatonin reduced microgliosis in corpus callosum. Immunohistochemical assessment of the corpus callosum for Iba-1 as a marker for microglia (A (Ctrl group), B (CPZ group), C (CPZ + MLT group)). The number of Iba-1+ cells was significantly decreased in the CPZ + MLT group compared with the CPZ group. The graph depicts the quantitative analysis for Iba-1 positive cells in the corpus callosum(D). Ionized calcium-binding adapter molecule (Iba-1), Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 4). Data are represented as mean ± SEM ∗ p  < 0.05, ∗∗ p  < 0.01; and ∗∗∗ p  < 0.001.

Effect of melatonin treatment on Musashi-1, Hes-1, Notch-1 and GAPDH transcript levels

To determine whether the anti-demyelinating properties of melatonin are mediated through its anti-inflammatory effects. In the current study, we surveyed the expression of Musashi-1, Hes-1, and Notch-1 genes in the corpus callosum tissues of SCD, CPZ, and CPZ + MLT groups. As shown in Fig. 6 , CPZ significantly down-regulated the expression of these anti-inflammatory genes compared to the SCD group, whereas administration of melatonin increased the expression of these genes ( Fig. 6 ).

Melatonin effect on Musashi-1, Hes-1, Notch-1 and GAPDH Transcript Levels Quantitative real-time PCR was conducted to determine the mRNA expression level of Musashi-1 (A), Hes-1 (B), and, Notch-1 (C) genes in the corpus callosum isolated from mice. Control (Ctrl) group, cuprizone alone (CPZ) group, and cuprizone mixed with melatonin (CPZ + MLT) group. (N number = 6). Data are represented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01; and ∗∗∗p < 0.001.

Discussion

A large body of evidence shows that melatonin is a drug with multiple therapeutic applications, including anti-nociceptive, antidepressant, anxiolytic, anti-inflammatory, and antioxidant activity regulated by multiple cascades [ 29 ]. We in the present study focused on the astrogliosis, microgliosis, and immune responses in the brains of mice with cuprizone-induced MS, which are targeted by melatonin to prevent MS development and progression.

There is evidence that cuprizone is a neurotoxic agent that causes degenerative changes in oligodendrocytes, extended loss of oligodendrocytes, disruption in neuronal signaling, axonal function, and deep demyelination (90 percent) after 4 weeks of exposure. Oral cuprizone is widely used in the C57bl/6 mice as a favorable animal model mimicking demyelinating aspects of MS [ 30 , 31 ].

In the present study, we found that melatonin has a protective role against CPZ-induced demyelination in mice through improving remyelination capacity and the number of mature oligodendrocytes in the CC while decreasing astrogliosis and microgliosis.

In the present study, reduced mature oligodendrocytes following cuprizone feeding were evidently enhanced in melatonin–treated mice. Myelin debris in the CNS by cuprizone restricts the maturation of oligodendrocytes and the differentiation of OPCs into myelin-producing oligodendrocytes. However, melatonin significantly increased the expression level of this protein and promoted the mature oligodendrocytes density. This beneficial effect of melatonin was accompanied by enhanced oligodendroglia maturation had already been suggested in a model of neonatal stroke [ 13 ]. It is of note that in our study, enhancement of the number of mature oligodendrocytes following melatonin administration was documented by an increase in the remyelination potential and microscopically higher remyelination areas according to the luxol fast blue (LFB) staining parameters. Our data suggested melatonin treatment led to, myelin formation and axonal generation being nearly restored to normal. Melatonin attenuated the destruction of myelin sheaths that are the main hallmarks of MS.

Because of the high metabolic demands of oligodendrocytes, they are vulnerable and easily damaged under the CPZ challenge. In fact, cuprizone can disrupt the electron transport chain, which leads to the death of oligodendrocytes, which is followed by severe demyelination [ 32 ]. Vakilzadeh et al. reported in the cuprizone-induced model of MS, melatonin administration decreased the oligodendrocyte apoptosis by reducing the caspase-3 and Bax (pro-apoptotic protein), as well as by improving the Bcl-2 (anti-apoptotic protein) levels [ 33 ]. Ghareghani et al. represented that melatonin therapy elevated the expression of MBP, MOG, and MOBP, myelin-associated proteins that stimulate oligodendrogenesis and remyelination in EAE-induced mice [ 34 ]. Another study suggested that melatonin through the enhancement of BDNF (brain-derived neurotrophic factor) secretion and activation of the BDNF receptor, which is a major inducer of oligodendrocyte myelination, increased remyelination [ [35] , [36] , [37] ]. In a study by Wen et al., melatonin and N-acetyl serotonin administration was followed by a significant enhancement in mature oligodendrocytes and remyelination in the spinal cord of EAE mice. Increasing the number of oligodendrocytes targeted by melatonin has been shown to enhance neuronal signaling, axonal activity, and physical impairment [ 38 ].

Our findings revealed that oligodendrocyte progenitor cells (OPC) were rapidly activated in the CPZ fed mice. CPZ led to the attraction and proliferation of oligodendrocytes precursor cells (OPCs) to demyelinating regions maybe via neurotrophic factor secretion by astrocytes. Robust OPC proliferation after CPZ intoxication is a compensatory repairing process in the CNS for maintaining a remyelination process in order to protect damaged axons from more disruptive injuries, but it is not effective enough to fully renew the demyelinating events. While melatonin intervention can promote remyelination by increasing oligodendrocyte progenitor cell (OPC) differentiation and decreasing oligodendrocyte apoptosis. We found significant increases in OPC in the body segment of the corpus callosum. In a study by Toomy et al., 0.2 % cuprizone was delivered in both powdered and pelleted form and outcomes were analyzed after 3 weeks of cuprizone administration. Within the caudal corpus callosum, the number of OPCs significantly increased with both CPZ pellets and CPZ powder. However, in the rostral region of CC there was no significant increase in the density of OPCs between both groups. This may be related to the proximity of the medial rostral to the subventricular zone. Neural progenitor cells in the subventricular zone migrate to the proximal rostral corpus callosum, where they are able to attenuate the inflammatory response and NPCs differentiate into mature oligodendrocytes [ 39 ].

Inflammation and glial activation are involved in the pathogenesis of MS disease. Astrocytes and microglia (glial cells) mediate neuroinflammation [ 40 ]. Many studies have shown that microglia cells help clear apoptotic cells and debris, release neurotrophic factors and regenerate neural circuits as well as suppress or promote demyelination in demyelinating diseases. When microglia are activated, they produce a multitude of pro-inflammatory cytokines, that are toxic to the CNS and lead to oligodendrocyte apoptosis and decrease OPC differentiation [ 41 ].

We explored whether changes in microglia, the nervous system's key immune cells, are involved in this process. Microglia changes could have an effect on the homeostasis and function of other cells, such as neurons. Investigation of microgliosis status in the corpus callosum by IHC staining, clearly detected a decrease in Iba1 levels as a specific marker of the microglia cells in the CC of melatonin receiving group, indicating that treatment with melatonin prevented microgliosis in CC. Ali et al. indicated that melatonin could reduce the d ‐galactose‐induced neuroinflammation via inhibition of microgliosis and astrocytosis, and downregulating other inflammatory mediators [ 42 ].

On one hand, astrocytes produce several neurotransmitters and increase the BBB permeability [ 43 ]. Indeed, La-aminoadipate-induced astrocyte deletion can considerably increase myelin regeneration capacity in the MS mouse model [ 44 ]. Fibronectin and hyaluronic acid are parts of ECM formed by reactive astrocytes in demyelinated areas, and they are liable for OPC proliferation but impede oligodendrocyte differentiation, associated with impaired myelin production [ 45 , 46 ].

In this study, GFAP was used to determine the number of astrocytes. Consistent with previous studies [ 42 ], we found that astrocyte number decreased in melatonin-receiving mice. Investigations have attested that this medication decreased astrogliosis, reduced synaptic dysfunction, and ameliorated the learning and memory in the AD rat model after administration of Amyloid-beta (Aβ)1–42 [ 47 , 48 ]. In this regard, Hu et al. reported that melatonin treatment mitigated astrogliosis and microgliosis in hypoxic-ischemic and inflammatory (HII) in neonatal rats model [ 48 ]. Their results indicate that melatonin could inhibit the BBB degradation by limiting the neuroinflammation mediated by the TLR4/NF-κB signaling pathway [ 48 ]. Also, Beni et al. and Arioz et al. demonstrated the suppressive effect of melatonin on inflammation-mediated NF-kB suppression in microglial cells [ 49 , 50 ].

Studies have shown that reducing inflammation could be effective in preventing demyelinating diseases. In this context, melatonin has been proposed to attenuate inflammation in various disorders. In the present study, we found that melatonin's ability to maintain oligodendrocytes, restrain microgliosis, and astrogliosis is highly dependent on its normal immunomodulatory activity. Previous reports have represented that melatonin is involved in the development of anti-inflammatory characteristics during the inflammatory diseases, including myocardial infraction (MI), through increasing the expression of Musashi-1, Hes-1, and, Notch-1 [ 51 ]. Various studies declare that the increased expression of Musashi-1, Hes-1, and, Notch-1 genes has been associated with a decreased number of microglia and astrocytes and decreased level of inflammation [ [51] , [52] , [53] ]. Kim et al. reported, (6 mg/L in water) melatonin for 6 weeks reduces cuprizone's effects on hippocampus neurogenesis (NeuN and MBP,BDNF protein expression). Melatonin increased glucose utilization, remyelination, the quantity of DCX-positive neuroblasts and Ki67-positive proliferative cells in the hippocampus [ 54 ]. Based on Escribano findings 1mg/kg Melatonin administration for 51 days alleviated oxidative stress, inflammatory estate, dysbiosis, and in the clinical sign of the MS disease in EAE animal model. Melatonin improved glutathione redox state [ 55 ]. Similarly, in another research by Abo Taleb melatonin ip administeration for 9 weeks at a dose of 80 mg/kg daily (12 noon) to SWR/J male and female mice during the demyelination stage by cuprizone, exhibited neuroprotective role by accelerating antioxidant enzymes activity and decreasing levels of IL-1 and TNF in brainstem [ 56 ]. Alghamdi results indicated that (80 mg/kg) Melatonin administration to SWR/J male mice daily(11 a.m.) for 5 weeks through up-regulating the cAMP-response element-binding protein(Creb), synapse-associated synaptophysin (syp)and postsynaptic density protein 95 (Psd95) genes in the prefrontal cortex ameliorated cuprizone-induced memory defects [ 57 ]. In Kashani investigation (5 mg/kg) Melatonin was ip injected into cuprizone-treated mice daily (at 12:00 noon) for 5 weeks reversed the adverse effects of cuprizone in the CC myelination by reducing oxidative stress, recovering the respiratory enzymes, fusion, and fission processes, and intra-axonal accumulation of mitochondria [ 58 ]. According to research by Vakilzadeh et al. [ 33 ], for the final 7 days of the 5 weeks cuprizone feeding, melatonin (50 and 100 mg/kg) ip injections were given at midday. Seven days melatonin therapy decreased the apoptotic enzymes Caspase-3, Bax, and increased the Bcl-2 levels, which lowered the amount of apoptotic cells and alleviated cuprizone-induced impairments in motor behavior. Additionally, melatonin markedly increased the NF- κB activation. On the other hand, melatonin had no impact on myelin protein synthesis [ 33 ].

Chen et al. findings represented, 200 mg/kg melatonin subcutaneously injection on days 9, 11, and 13 after EAE induction enhanced interleukin-10 expression and restricted the infiltration of inflammatory Th17 cells into the CNS and by suppressing chemotaxis, inhibited inflammation in situ and reduced the severity of clinical signs [ 59 ]. In previous study by Ghareghani [ 34 ] melatonin treatment for 13 consecutive days after starting of clinical symptom of EAE (score ≥3) improved the severity of the disease. By reducing inflammatory estate, and modulating cerebral energy metabolism and upregulation of HMGCR, MBP, MOG, and MOBP, melatonin ameliorated the severity of clinical signs of EAE [ 34 ] However, in their recent research (2023) in murine cuprizone model they shown that by constant light that increased the cortisol (anti-inflammator) level, remylination occurred [ 60 ].

There is available evidence regarding the involvement of the Notch- Hes pathway in neuronal development and remyelination. neural stem cell (NSCs) can be a potential source of glia and neural cells, and the Notch activation maintains the pool of neural stem cells (NSC) in their undifferentiated state allowing the formation of oligodendrocytes progenitor cells. In demyelinated lesions, downregulation of Notch causes to decrease in the OPC migration and population which is accompanied by astrocyte activation. Whereas, the Notch expression is being upregulated in the remyelinating process and subsequently enhanced Schwann cell precursor OPCs differentiation, Schwann cell formation, and improvement of remyelination capacity [ 23 , 24 ]. Notch signaling may be one mechanism that keeps microglial cells in the CNS in a state of rest. One function of Notch signaling during inflammatory events in the CNS should be to stop an excessive inflammatory mediator's activation [ 25 ]. During TLR-mediated inflammation in macrophages, over-expression of NICD1 or NICD2 (NOTCH receptor domains) decreased TLR-mediated production of IL-6 and TNF, production of anti-inflammatory cytokine IL-10 was increased. Based on neuropathological findings, Zhang and colleagues [ 26 ] showed that 500 mg/kg melatonin i.p. injection for 16 continuous days between 13:30 and 16:00 h to rats provided protection against soluble Abeta1-42-mediated learning and memory failure, neuroplasticity impairment, and astrogliosis through the stimulation of the Musashi1/Notch1/Hes1 signaling pathway. The results of Zhang et al. study revealed that the activation of Musashi1/Notch1/Hes1signaling pathway by melatonin modulated the progression of AD [ 26 ].

It is now widely accepted that administering CPZ (0/2 %) to mice for six weeks induces acute demyelination, which can be spontaneously repaired following an adequate recovery period and cessation of CPZ. Fan et al. (2018) demonstrated that the inhibition of the Notch1 gene using small interfering RNA (siRNA) post-CPZ withdrawal may significantly enhance myelin regeneration. However, our study focused on the prophylactic effects of melatonin was co-treated with CPZ. Our observations indicated that transcription of the Notch gene significantly decreased during the demyelination phase, whereas, melatonin administration markedly increased its mRNA levels. We hope that this should be considered in future research to accomplish further analysis regarding Notch1 gene function in this model, particularly during the demyelinating state [ 61 ].

As noted in a review of the literature on the therapeutic prospects of melatonin in neurological diseases, indicated cytoprotective melatonin doses is in the 40–100 mg/day range. Investigations utilizing 2–5 mg melatonin per day are unsuitable to give proper comparison to data on neurodegeneration protection based on animal studies. Melatonin is extremely non-toxic and has a very high level of safety. For ip melatonin injection, the lethal dose 50 (LD50) was 1131 mg/kg for mice and 1168 mg/kg for rats [ 62 ]. The route of administration was chosen because melatonin is well absorbed after IP injection.

In the present study, we found that increased demyelination area following CPZ feeding in CC is correlated with the downregulation of the Notch-1 and its downstream genes Musashi-1 and Hes-1. Importantly, melatonin treatment significantly enhanced the expression of Notch-1 and its downstream genes Musashi-1 and Hes-1 in CC tissue. These findings suggest that melatonin therapy led to less demyelination and subsequently lower inflammation in CC tissue. There is evidence that the activation of Notch1 signaling may restore neurogenesis and cognitive functioning in AD animal models [ 47 ]. Overall, the Data emphasize the efficacy of melatonin in counteracting the pathophysiological processes induced by CPZ, by restoring oligodendrocyte generation, remyelination, decreasing astrogliosis and microgliosis. and exerting anti-inflammatory function.

Conclusion

Melatonin's neuroprotective effects following CPZ administration can be mediated through controlling a variety of functions, as well as its function in bolstering anti-inflammatory defenses in an MS animal model. More studies are required to identify additional molecular mechanisms behind melatonin's effectiveness in MS management.

CRediT authorship contribution statement

Mehdi Alidadi: Conducted research, analyzed data or performed statistical analysis. Negar Omidi: Conducted research. Mahdad Abdi: Conducted research. Maryam Mohammadi: Conducted research. Maryam Shabani: performed statistical analysis, had primary responsibility for final content. Iraj Ragerdi Kashani: Designed research, had primary responsibility for final content. All authors read and approved the final manuscript. Iraj Ragerdi Kashani and Maryam Shabani contributed equally to this study.

Statement of ethics

The experimental protocol in this study was approved by the Institutional Animal Care and Use Committee (IACUC) of Tehran University of Medical Sciences. Tehran, Iran (IR.TUMS.MEDICINE.REC.1398.595). All experiments were performed in accordance with the European Communities Council Directive (86/609/EEC) and the guidelines of the Iranian Agriculture Ministry.

Funding sources

This study was supported by a grant (number 98–01‐30‐595) to Iraj Ragerdi Kashani from the Tehran University of Medical Sciences and Health Services, Tehran, Iran.

Declaration of competing interest

The authors have no conflicts of interest to declare.

Acknowledgments

This study was supported by a grant (number 98-01-30-41556) received from the Tehran University of Medical Sciences and Health Services, Tehran, Iran.

Contributor Information

Mehdi Alidadi, Email: alidadimehdi71@gmail.com.

Negar Omidi, Email: Negar.omidi@gmail.com.

Mahdad Abdi, Email: mehrdad.tb65@gmail.com.

Maryam Mohammadi, Email: maryam.medsc@gmail.com.

Maryam Shabani, Email: shabanimaryam@yahoo.com.

Iraj Ragerdi Kashani, Email: ragerdi@tums.ac.ir.

Data availability

Data will be made available on request.

References

Associated Data

Data Availability Statement

Data will be made available on request.