Скачать полный оригинал PDF с иллюстрациями
47
Cell. Mol. Biol. (ISSN: 1165-158X)
1. Introduction
Recent investigations have shown that various neuro -
degenerative conditions, such as Alzheimer’s disease, Par-
kinson’s disease, amyotrophic lateral sclerosis, and mul -
tiple sclerosis, could be due to oxidative damage driven
by reactive oxygen species (ROS)[ 1, 2]. ROS can cause
severe harm to essential biological molecules, including
DNA, fats, and proteins [ 3]. Neurodegenerative disorders
are long-term illnesses marked by gradual loss of neuron
function and cell death[ 4, 5]. Selegiline (L-deprenyl) is
a blocker of monoamine oxidase type B (MAO-B) ori -
ginally used to treat Parkinson's disease [ 6]. Monoamine
oxidase is a mitochondrial enzyme that speeds up the oxi-
dative breakdown of monoamines like dopamine, norepi -
nephrine, and serotonin. This process yields hydrogen pe-
roxide, a major source of cellular reactive oxygen species
(ROS). Thus, by adjusting the activity of this enzyme, se -
legiline not only boosts the beneficial effects of dopamine
given in clinical settings but also helps lower ROS levels
[7-9]. Multiple studies have also verified the cell death–
preventing properties of selegiline, though the precise way
it works is still unknown. Selegiline provides neuropro -
tective effects by controlling antioxidant enzymes and
genes that prevent cell death. More specifically, selegiline
increases the levels of Bcl-2 and Bcl-xL while decreasing
BAX, thereby reducing damage caused by oxidative stress
[10, 11].
PGC-1α is broadly viewed as a central regulator of
genes necessary for mitochondrial biogenesis [ 12, 13].
Mitochondrial dysfunction or impaired mitochondrial
renewal is a characteristic of most neurodegenerative di -
seases and is governed by a complex network of transcrip-
tion factors. Nuclear respiratory factors (Nrfs), peroxisome
proliferator-activated receptors (PPARs), and estrogen-re-
lated receptors (ERRs) are considered among these fac -
tors that turn on target genes involved in the expression of
oxidases [14, 15]. A great deal of research has focused on
understanding the role of Nrf2 in defending against oxi -
dative stress. The Nrf2–Keap1 communication pathway,
along with the resulting activation of protective proteins,
is essential for shielding cells from oxidative injury [ 16].
Earlier work has shown that lacking Nrf2 in genetically
Original Article
Selegiline induces neuroprotection via PGC-1α/Nrf2 gene upregulation in H2O2
-treated hippocampal-derived neural stem/progenitor cells
Alireza Abdanipour1, Ali Nikfar2, Hadi Feizi3*
1 Department of Anatomy, School of Medicine, Zanjan University of Medical Sciences (ZUMS), Zanjan, Iran
2 Department of Genetics and Molecular Medicine, School of Medicine, Zanjan University of Medical Sciences (ZUMS), Zanjan,
Iran
3 Department of Physiology, School of Medicine, Zanjan University of Medical Sciences (ZUMS), Zanjan, Iran
Journal Homepage: www.cellmolbiol.org
Cellular and Molecular Biology
⁎ Corresponding author.
E-mail address: hfeizik@zums.ac.ir (H. Feizi).
Doi: http://dx.doi.org/10.14715/cmb/2026.72.5.7
Article Info Abstract
Article history:
Received: March 13, 2025
Accepted: May 17, 2025
Published: May 31, 2026
Oxidative stress mediated by reactive oxygen species (ROS) is a major contributor to the pathogenesis of
neurodegenerative diseases, including Alzheimer’s, Parkinson’s, Huntington’s, multiple sclerosis, and amyo-
trophic lateral sclerosis. Selegiline, a monoamine oxidase B inhibitor, has been reported to exert neuropro -
tective effects, although its precise cytoprotective mechanisms remain unclear. In this study, we investiga -
ted the effects of selegiline on apoptosis, necrosis, and cell survival in hydrogen peroxide (H₂O₂)-treated
hippocampal-derived neural stem/progenitor cells (HD-NSPCs) in vitro. Passage 3 HD-NSPCs were treated
with varying concentrations of selegiline (10⁻³ to 10⁻⁹ M) prior to exposure to 125 μM H₂O₂. Cell viability
was assessed using the MTT assay, while apoptosis and necrosis were evaluated using TUNEL and acridine
orange/ethidium bromide staining, respectively. Real-time RT-PCR was performed to quantify mRNA levels
of PGC-1α, Nrf2, and Bcl-2. Treatment with 10⁻⁷ M selegiline significantly enhanced HD-NSC viability, re -
duced apoptotic and necrotic cell fractions, and upregulated PGC-1α, Nrf2, and Bcl-2 expression compared to
untreated cells (P < 0.05). These findings suggest that selegiline mitigates oxidative stress–induced cytotoxi -
city by activating Nrf2/PGC-1α signaling and promoting anti-apoptotic gene expression, thereby preserving
mitochondrial function and enhancing cell survival. Overall, selegiline may represent a promising therapeutic
agent for protecting neural progenitor cells and alleviating neuronal damage in neurodegenerative disorders.
Keywords: Selegiline, HD-NSPCs, oxidative stress, Nrf2, PGC-1α, Bcl-2, neuroprotection.
Use your device to scan and read
the article online
48
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
modified mice raises their vulnerability to many types of
oxidative stress–induced harmful and neurodegenerative
conditions [ 17]. Enhanced Nrf2 function, brought about
by chemopreventive substances, has been shown to offer
stronger defense against oxidative harm in animal models
[18, 19]. Consequently, cross-talk between Nrf2 and other
signaling factors affects the effectiveness of cellular stress
responses. ROS-triggered activation of Nrf2 starts the
transcription of phase II detoxifying genes, strengthening
cellular protective systems [ 3]. Neural Stem/Progenitor
Cells (NSPCs) are a specific type of cell in the nervous
system with the unique abilities to self-renew and generate
other cell types. Because of these properties, they are a
major focus of research aiming to repair damaged brains
and spinal cords [20].
While selegiline is known for its neuroprotective pro -
perties, its direct effects on NSPCs and the specific trans -
criptional pathways involved remain poorly understood.
Unlike previous studies that have primarily examined se -
legiline in differentiated neuronal models or focused on its
MAO-B inhibitory activity, this work sought to determine
whether selegiline could modulate antioxidant and anti-
apoptotic gene expression in neural progenitor cells, the -
reby offering a novel mechanistic perspective on its cyto -
protective actions. This study aimed to investigate whether
selegiline exerts neuroprotective effects against oxidative
stress-induced injury in hippocampal-derived neural stem/
progenitor cells (HD-NSPCs), and to explore the under -
lying molecular mechanisms, with particular focus on the
potential involvement of PGC-1α, Nrf2, and Bcl-2 gene
expression.
2. Materials and methods
2.1. Isolation and Expansion of HD-NSPCs
HD-NSPCs were obtained from the hippocampal region
of 10-day-old newborn Wistar rats (obtained from the Razi
Institute), following a previously described method [ 21].
In brief, after deep sedation induced by intraperitoneal
injections of ketamine (100 mg/kg) and xylazine (10 mg/
kg), the brain was quickly taken out, and the hippocampus
was separated and placed in a 4 g/L glucose solution. The
tissue pieces were chopped with scissors and blades, then
broken down chemically in a mixture containing papain
(2.5 U/ml, Sigma-Aldrich), dispase II (40 U/ml, Sigma-
Aldrich), and accutase (1 ml, Invitrogen; Thermo Fisher
Scientific) for half an hour at room temperature. The resul-
ting cell mixture was passed through a 70 μm cell sieve
(Falcon) and spun at 1000 × g for 10 minutes at 4°C. The
sediment was rinsed with PBS and re-suspended in neu -
ral stem cell culture medium (DMEM/F12) containing 2%
B27 (Gibco), 20 ng/ml bFGF (Invitrogen), 20 ng/ml EGF
(Invitrogen), 100 U/ml penicillin, and 100 μg/ml strepto -
mycin (Sigma-Aldrich; Merck KGaA). Cells were placed
in non-sticking 25 cm² plastic containers and kept at 37°C
with 5% CO₂ for one week to allow neurospheres to form,
with the medium changed every two days.
Neurospheres were then broken apart into individual
cells using 0.25% trypsin-EDTA (Sigma-Aldrich) and
gentle pipetting. HD-NSPCs (10⁵ cells per well) were sub-
sequently grown in DMEM/F12 supplemented with 2%
B27, 20 ng/ml bFGF, 20 ng/ml EGF, and 3% fetal bovine
serum (FBS; Gibco; Thermo Fisher Scientific) for one
week at 37°C with 5% CO₂. Cells were transferred up to
three times in 6-well plates covered with poly-L-lysine.
For cell type confirmation, immunocytochemistry
was carried out using an anti-nestin monoclonal antibody
(1:200, Abcam), followed by a fluorescein isothiocyanate
(FITC)-conjugated rabbit anti-mouse secondary antibody
(1:200, Millipore). Cells were grown on glass coverslips,
fixed with 3% paraformaldehyde for 20 minutes at room
temperature, and made permeable with 100% methanol
for half an hour. After an overnight incubation with the
primary antibody at 4°C, the secondary FITC-linked anti -
body was added for 4 hours. Cell nuclei were stained with
ethidium bromide for 1 minute at room temperature.
2.2. Dose-Response Effect of Selegiline on Oxidative
Stress
Passage 3 HD-NSPCs were placed into 96-well plates
at a density of 5 × 10⁴ cells per well in DMEM/F12 me -
dium containing 2.7% B27, 20 ng/ml bFGF, and 20 ng/
ml EGF, then grown for 48 hours. To evaluate the neuro -
protective effects of selegiline, cells were exposed to dif -
ferent amounts of selegiline (10⁻³, 10⁻⁴, 10⁻⁵, 10⁻⁶, 10⁻⁷,
10⁻⁸, and 10⁻⁹ M) over 48 hours, with the culture medium
changed every 12 hours, before being subjected to H₂O₂.
Oxidative injury was triggered by exposing HD-NSPCs
to 125 μM H₂O₂ for half an hour at 37°C in a 5% CO₂
environment[22]. HD-NSPCs that did not receive selegi -
line treatment (0 μM) were used as controls, and another
control group was maintained in DMEM/F12 medium for
48 hours followed by H₂O₂ exposure. Cell survival was
assessed using the MTT assay. Cells were kept with 1 mg/
ml MTT solution (Sigma-Aldrich) for 4 hours, after which
the liquid was removed, and 100 μl of dimethyl sulfoxide
(DMSO) was added to dissolve the formazan crystals. Ab-
sorbance was read at 570 nm using a microplate ELISA
reader. The percentage of viable cells was calculated as:
Relative viability (%) = (A570 of treated samples / A570
of untreated samples) × 100[23].
2.3. Detection of Necrotic and Apoptotic Cells
Following treatment, HD-NSPCs were preserved in
PBS with 4% paraformaldehyde for 15 minutes at room
temperature (RT). Cell death was identified using the
TUNEL method with the In Situ Cell Death Detection Kit
(Roche, Germany), following the kit’s recommended pro-
tocol. Cells showing TUNEL positivity were made visible
using diaminobenzidine (DAB) staining for 3–7 minutes
at RT, followed by a 5-minute counterstain with hema -
toxylin.
Necrosis was assessed via acridine orange/ethidium
bromide staining. Fixed HD-NSPCs were treated with
acridine orange and ethidium bromide (100 μg/ml each;
Sigma-Aldrich; Merck KGaA) for 5 minutes at RT. Necro-
tic cells were recognized by their orange to yellow cyto -
plasmic glow and examined under a fluorescence micros -
cope (BX61, Olympus, Tokyo, Japan). The proportions of
TUNEL-positive and necrotic cells were determined by
tallying cells in five randomly chosen fields per well (200
cells total per sample).
2.4. Real-Time Reverse Transcription Polymerase
Chain Reaction (RT-PCR)
After oxidative injury was induced, real-time RT-PCR
was carried out on cDNA generated from the control group
(0 M) and the 10⁻⁷ M selegiline-treated group. Total RNA
(1000 ng) from HD-NSPCs was isolated using TRIzol (In-
49
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
exposed to 125 μM H₂O₂ (Figure 2). The results showed
that increasing concentrations of selegiline (0–10⁻⁷ M)
protected against oxidative stress induced by H₂O₂. Howe-
ver, high concentrations of selegiline significantly de -
creased HD-NSC viability in a dose-dependent manner.
Scores were normalized to the control group (untreated
HD-NSPCs). The NSH group (10⁻⁷ M selegiline for 48
hours followed by 125 μM H₂O₂ exposure) exhibited a si-
gnificant increase in viable cells (64.95±3.4) compared to
lower concentrations of selegiline (0, 10⁻³, 10⁻⁴, 10⁻⁵, 10⁻⁹
M), which had viability scores of 27.12±1.84, 38.23±1.42,
33.95±2.62, 42.47±2.26, and 46.01±2.24, respectively.
3.3. Detection of Apoptotic and Necrotic Cells
Using the TUNEL assay and acridine orange/ethidium
bromide staining, we investigated the protective and anti-
apoptotic effects of selegiline on HD-NSPCs treated with
10⁻⁷ M selegiline for 48 hours, followed by exposure to
125 μM H₂O₂. As shown in Figure 3 (A-D), TUNEL-po -
sitive nuclei and necrotic cells revealed that H₂O₂ induced
both apoptotic and necrotic cell death. The percentage of
TUNEL-positive cells was significantly lower in the sele -
giline-treated group compared to the control group (0 μM
selegiline) (P < 0.05). Figures 3A, B and Figure 4 demons-
trate a significant reduction in apoptotic cells in the NSH
group compared to the NH group (49.42 ± 0.9% vs. 27.66
± 1.51%; P < 0.05). Similarly, Figures 3C and 3D, and
Figure 4 show a significant decrease in necrotic cells in the
NSH group compared to the NH group (67.45 ± 1.41% vs.
34.15 ± 0.82%; P < 0.05).
vitrogen, Thermo Fisher Scientific) and reverse-transcri -
bed into 20 µl of cDNA with the RevertAid™ First Strand
cDNA Synthesis Kit (Fermentas, Germany), following
the kit's guidelines. The obtained cDNA was then used to
measure the mRNA levels of PGC-1α, Nrf2, and Bcl-2,
with beta-2-microglobulin (B2M) employed as an internal
reference.
Each PCR mixture (12.5 µl total volume) contained 200
nM of forward and reverse primers (Shown in Table 1),
0.5 µl cDNA, 6.5 µl SYBR® Green I (Fermentas, Thermo
Fisher Scientific), and nuclease-free water. Amplification
was conducted with an initial denaturation step at 95°C for
15 seconds, followed by 40 cycles at 60°C for 1 minute.
Relative mRNA expression levels were determined using
the 2-ΔΔCt method.
2.5. Statistics
The statistical evaluation was carried out with SPSS
software (version 15). Results are shown as the mean ±
standard error of the mean (SEM) from five independent
experiments. Comparisons among groups were performed
using one-way ANOV A, followed by Tukey’s post hoc test
for individual group comparisons. A P value below 0.05
was regarded as indicating statistical significance.
3. Results
3.1. Neural stem cells culture
HD-NSC primary culture results are shown in Figures
1A-D. After several hours, self-renewing neurons with
multipolar processes and growth cone-like features were
observed. Small spheroids formed after 3 days (Figure
1A). Intact neurospheres were cultured on poly-L-lysine-
coated 6-well plates without dissociation, forming rosette-
like structures (Figure 1B). The purity of HD-NSPCs at
passage 3 was assessed using the progenitor cell marker
nestin, which showed strong positive immunostaining
(97.51 ± 0.48) (Figure 1C, D). A negative control without
the primary antibody confirmed the specificity of the labe-
ling.
3.2. Dose-Response Effect of Selegiline
Using the MTT assay, we demonstrated a dose-de -
pendent neuroprotective effect of selegiline on HD-NSPCs
Gene Gene Accession no. Sense 5 → 3 Anti-sense 5 → 3
B2M NM_012512.2 CTTGCCATTCAGAAAACTCC CATCGGTCTCGGTGGGTG
Nrf2 NM_031789.2 ATTCCCGAGTTACAGTGTCT CGTGGAGAGGATGCTGCT
Bcl-2 NM_016993.1 AGGATAACGGAGGCTGGGATG GGTCTGCTGACCTCACTTGTGG
PGC-1α NM_031347.1 GACAGAACTGAGAGACCGCT CTGAGTTTGAATCTAGGTCTGC
Table-1. Primer Sequences and PCR Parameters.
Fig. 1. Isolation and Culture of HD-NSPCs. A) Phase contrast micros-
copy of neurons in suspension culture for 3 days. B) Appearance of an
asterisk-like structure after 7 days of culture. C & D) Phase contrast
image and Nestin-positive immunohistochemistry of HD-NSPCs, res-
pectively. Nestin is labeled green (FITC-conjugated secondary anti -
body) and the nucleus is red (ethidium bromide).
Fig. 2. Protective Effect of Selegiline on Cell Viability. Dose-response
curve showing the viability of HD-NSPCs at different concentrations
of selegiline, treated with 125 μM H₂O₂, as assessed by the MTT as -
say. Results are presented as the average percentage of viable cells
relative to untreated HD-NSPCs. Each bar represents the mean of 5
replicates. Bars indicate mean ± SEM. P < 0.05 (compared to 10⁻⁷ M).
50
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
3.4. Gene Expression Results
The q-PCR results are shown in Figure 5. Real-time
quantitative RT-PCR confirmed elevated mRNA levels of
PGC-1α, Nrf2, and Bcl-2 in the NSH group (HD-NSPCs
treated with 10⁻⁷ M selegiline for 48 hours). Significant
increases were observed in the mRNA levels of PGC-1α,
Nrf2, and Bcl-2 in the NSH group (2.63 ± 0.31, 5.00 ±
0.20, and 2.32 ± 0.16, respectively) compared to the NH
group (0.52 ± 0.04, 3.26 ± 0.18, 1.62 ± 0.10, respectively)
and the NS group (1.13 ± 0.10, 1.77 ± 0.19, 0.64 ± 0.07,
respectively) (P < 0.05).
4. Discussion
In the present work, we showed that selegiline reduces
apoptotic and necrotic cell death in HD-NSPCs subjected
to oxidative injury by increasing the mRNA expression of
PGC-1α, Nrf2, and Bcl-2. Earlier studies have found that
free radicals can directly or indirectly harm essential bio -
molecules, thereby leading to neuronal cell death under
oxidative stress conditions [ 1, 24]. Lowering oxidative
stress in neurodegenerative illnesses has been shown to
block neuronal apoptosis and delay disease progression.
By easing oxidative damage, nerve cells can be shielded
from degeneration, potentially enhancing outcomes in
disorders such as Alzheimer’s disease, Parkinson’s di -
sease, and other neurodegenerative conditions [ 1, 25].
Monoamine oxidase inhibitors (MAOIs), including sele -
giline and rasagiline, serve a key function in suppressing
apoptosis [ 26]. According to both laboratory and animal
studies, selegiline blocks MAO-B and boosts the produc -
tion of neurotrophic factors [27, 28]. Additionally, it is an
anti-Parkinson medication known for its antioxidant and
anti-apoptotic characteristics [29]. Nevertheless, the exact
protective mechanism of selegiline at the cellular level
remains not completely understood [30]. In this study, we
describe a distinct cellular defense mechanism of selegi -
line involving Nrf2- and PGC-1α–mediated stimulation
of oxidative stress–responsive proteins. Prior research has
shown that mitochondrial transcription factor A (mtTFA)
helps regulate antioxidant signaling, and its levels rise
when Nrf2 is activated[ 31]. We also report a new cyto -
protective pathway of n-deprenyl involving the elevated
expression of Nrf2, PGC-1α, and Bcl-2 genes. It is well
known that PGC-1α is the primary controller of mitochon-
drial biogenesis and has shown neuroprotective effects in
models of Parkinson's disease. Liu and colleagues have
reported that increasing PGC-1α expression protects neu -
rons from alcohol-induced harm [32]. Recent studies have
shown that elevated PGC-1α levels trigger the transcription
of Nrf1 and Nrf2, which in turn boosts the expression of
mitochondrial transcription factor A (mtTFA) [33]. Mito-
chondrial transcription specificity factors are controlled by
Nrf1, Nrf2, and the PGC-1α family of coactivators. Keap1
acts as a suppressor by trapping Nrf2 in the cytoplasm and
promoting its breakdown through the Cul3/Rbx1 com -
plex. Activation of Nrf2 and the subsequent induction of
downstream antioxidant enzymes initiate the cellular an -
tioxidant stress response [34, 35]. We performed assays to
assess the genomic protection and antioxidant responses
mediated by PGC-1α and Nrf2. There is strong evidence
supporting the idea that PGC-1α acts upstream of Nrf2
in regulating antioxidant defense mechanisms [ 36]. In a
study by Pang et. al, they showed that T-2 toxin triggers
Fig. 4. Detection of Programmed Cell Death and Necrosis. Histogram
plots show the mean percentages of programmed cell death and ne -
crosis in the N, NH, NS, and NSH experimental groups. Bars repre -
sent the mean ± SEM. P < 0.05 (compared to group N), Ω (compared
to group NH).
Fig. 3. Represent TUNEL and acridine orange staining, respectively.
A & C) Represent NH, TUNEL, and acridine orange staining, respec-
tively. B & D) Represent NSH, TUNEL, and acridine orange staining,
respectively. Red arrows indicate DNA fragmentation, and late necro-
tic HD-NSPCs are shown with an orange-red nucleus (yellow arrow).
Hematoxylin counterstaining is shown in blue in the TUNEL assay.
Magnification: 200X.
Fig. 5. Quantitative Real-Time RT-PCR Results. The fold change in
mRNA levels of PGC-1α, Nrf2, and Bcl-2 is shown, normalized to
B2M mRNA expression. Amplification of all genes from the NS, NH,
and NSH groups revealed a significant increase in the expression of
PGC-1α, Nrf2, and Bcl-2 following 10⁻⁷ M selegiline treatment. Bars
represent the mean ± SEM. P < 0.05, compared to the NSH group.
51
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
oxidative damage and impairs mitochondrial function in
SH-SY5Y cells, acting at least partially through the NRF2/
PGC-1α axis to disrupt mitochondrial biogenesis [37]. The
cooperative action of NRF2 and PGC-1α serves as cen -
tral hubs that coordinate a range of vital cellular functions,
including adaptive stress responses, mitochondrial turno -
ver, and both antioxidant and neuroinflammatory defense
systems [ 38]. Supporting the existence of this crosstalk,
Li and colleagues demonstrated that in cortical neurons
subjected to oxidative stress, PGC-1α confers both an -
tioxidant and anti-apoptotic protection by stimulating the
NRF1/NRF2/TFAM signaling cascade[39].
The outcomes of this study highlight the gene- and cell-
protective effects of n-deprenyl, as evidenced by a lower
percentage of TUNEL-positive cells in the NSH group
compared to the NH group. Furthermore, Nrf2 helps pre -
vent p53-dependent apoptosis and improves cell survival
by directly promoting the transcription of anti-apoptotic
genes, including Bcl-2 and Bcl-xL [40]. Our results showed
that Nrf2 raises the levels of the anti-apoptotic protein Bcl-
2, leading to reduced apoptotic cell death and improved
cell survival after H₂O₂ exposure. These observations align
with earlier reports. Selegiline has been found to activate
Nrf2/ARE signaling in PC12 cells, a process that occurs
independently of its MAO-B blocking activity [ 41]. Nrf2
serves as a regulatory protein that governs the activity of
numerous genes involved in antioxidant defense [42]. Cy-
tochrome C release from mitochondria is regulated by the
Bcl-2 family, which includes both pro-apoptotic members
(e.g., Bax, Bak, Bid, and Bad) and anti-apoptotic members
(e.g., Bcl-2 and Bcl-xL). The main role of anti-apoptotic
Bcl-2 is to regulate mitochondrial Ca²⁺ release, manage
oxidative stress, and prevent cytochrome C release by
preserving normal mitochondrial membrane permeability
[13, 43]. According to a study by Jiangsu et al., the anti-
apoptotic protein Bcl-2 is increased by the Nrf2 protein
[44]. Moreover, when oxidative stress occurs, the protein
Nrf2 enhances the production of multiple defensive genes,
leading to increased levels of various antioxidant enzymes
[45, 46]. Although the protective effects of selegiline have
not been fully established, the current results suggest that
its anti-apoptotic actions on neural stem cells are media -
ted through Nrf2 and PGC-1α. Additionally, Nrf2 controls
the production of the mitochondrial protein UCP3, thereby
decreasing reactive oxygen species (ROS) levels and pro-
tecting cells from death [47].
5. Conclusion
In summary, this work demonstrates the protective
effects of (L)-deprenyl (selegiline) in HD-NSPCs during
H2O2-induced stress. The results indicated that Nrf2, PGC-
1α, and Bcl-2 could play central roles in selegiline's anti-
apoptotic activity. Hence, it can be proposed that selegiline
may somehow promote mitochondrial renewal and there -
by contribute to the survival of NSPCs. While preliminary,
these in vitro findings indicate that selegiline could offer
a therapeutic avenue for various neurodegenerative disor -
ders, though further validation is needed.
Acknowledgements
The authors gratefully acknowledge the Vice Chancel -
lor for Research of the Islamic Azad University, Ardabil
Branch, for their generous support and facilitation of this
research work.
Human and animal rights
In this in vitro investigation, no human study was conduc-
ted and just one rat was used to obtain HD-NSPCs. The
protocol for the study conforms to the provisions of the
WMA Declaration of Helsinki and also the ethical stan -
dards of the faculty of medicine, Zanjan University of
Medical Sciences, Iran.
Consent for publication
Not applicable.
Availability of data and materials
Not applicable.
Funding
The majority of the experimental procedures were conduc-
ted at the laboratory of the Islamic Azad University, Arda-
bil Branch, while supplementary experimental procedures
were performed at Zanjan University of Medical Sciences.
Conflict of interest
The authors declare that they have no conflict of interest.
Author’s Contributions
A. Abdanipour contributed to the interpretation and obser-
vations and oversaw the project progress; A. Nikfar contri-
buted to data collection; H. Feizi contributed to data analy-
sis and wrote the paper.
Use of Artificial Intelligence Tools
Some sentences in this manuscript were revised with the
assistance of artificial intelligence, using language models
to improve clarity and readability. All intellectual content,
interpretations, and conclusions are solely the responsibi -
lity of the authors.
References
1. Houldsworth A (2024) Role of oxidative stress in neurodegene -
rative disorders: a review of reactive oxygen species and preven -
tion by antioxidants. Brain Commun 6 (1): fcad356. doi: 10.1093/
braincomms/fcad356
2. Dash UC, Bhol NK, Swain SK, Samal RR, Nayak PK, Raina V ,
Panda SK, Kerry RG, Duttaroy AK, Jena AB (2025) Oxidative
stress and inflammation in the pathogenesis of neurological disor-
ders: Mechanisms and implications. Acta Pharm Sin B 15 (1): 15-
34. doi: 10.1016/j.apsb.2024.10.004
3. Birben E, Sahiner UM, Sackesen C, Erzurum S, Kalayci O (2012)
Oxidative stress and antioxidant defense. World Allergy Organ J
5 (1): 9-19. doi: 10.1097/WOX.0b013e3182439613
4. Chi H, Chang H-Y , Sang T-K (2018) Neuronal cell death mecha-
nisms in major neurodegenerative diseases. Int J Mol Sci 19 (10):
3082. doi: 10.3390/ijms19103082
5. Guo D, Liu Z, Zhou J, Ke C, Li D (2024) Significance of pro -
grammed cell death pathways in neurodegenerative diseases. Int J
Mol Sci 25 (18): 9947. doi:
6. Huot P, Fox SH, Brotchie JM (2015) Monoamine reuptake inhi -
bitors in Parkinson's disease. Parkinsons Dis 2015: 609428. doi:
10.1155/2015/609428
7. Binda C, Aldeco M, Geldenhuys WJ, Tortorici M, Mattevi A, Ed-
mondson DE (2012) Molecular Insights into Human Monoamine
Oxidase B Inhibition by the Glitazone Antidiabetes Drugs. ACS
Med Chem Lett 3 (1): 39-42. doi: 10.1021/ml200196p
8. Teo KC, Ho S-L (2013) Monoamine oxidase-B (MAO-B) inhibi-
52
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
tors: implications for disease-modification in Parkinson’s disease.
Transl Neurodegener 2: 19-19. doi: 10.1186/2047-9158-2-19
9. Ramsay RR (2016) Molecular aspects of monoamine oxidase B.
Progress in Neuro-Psychopharmacology & Biological Psychiatry
69: 81-89. doi: 10.1016/j.pnpbp.2016.02.005
10. Abdanipour A, Jafari Anarkooli I, Shokri S, Ghorbanlou M, Baya-
ti V , Nejatbakhsh R (2018) Neuroprotective effects of selegiline
on rat neural stem cells treated with hydrogen peroxide. Biomed
Rep 8 (1): 41-46. doi: 10.3892/br.2017.1023
11. Naoi M, Maruyama W, Inaba-Hasegawa K (2013) Revelation
in the neuroprotective functions of rasagiline and selegiline: the
induction of distinct genes by different mechanisms. Expert Rev
Neurother 13 (6): 671-684. doi: 10.1586/ern.13.60
12. Scarpulla RC (2011) Metabolic control of mitochondrial bioge -
nesis through the PGC-1 family regulatory network. Biochim
Biophys Acta 1813 (7): 1269-1278. doi: 10.1016/j.bbam -
cr.2010.09.019
13. Vervliet T, Clerix E, Seitaj B, Ivanova H, Monaco G, Bultynck G
(2017) Modulation of Ca(2+) Signaling by Anti-apoptotic B-Cell
Lymphoma 2 Proteins at the Endoplasmic Reticulum-Mitochon -
drial Interface. Front Oncol 7: 75. doi: 10.3389/fonc.2017.00075
14. Choi EH, Kim MH, Park SJ (2024) Targeting Mitochondrial
Dysfunction and Reactive Oxygen Species for Neurodegene -
rative Disease Treatment. Int J Mol Sci 25 (14). doi: 10.3390/
ijms25147952
15. Qian L, Zhu Y , Deng C, Liang Z, Chen J, Chen Y , Wang X, Liu Y ,
Tian Y , Yang Y (2024) Peroxisome proliferator-activated receptor
gamma coactivator-1 (PGC-1) family in physiological and patho-
physiological process and diseases. Signal Transduct Target Ther
9 (1): 50. doi: 10.1038/s41392-024-01756-w
16. David JA, Rifkin WJ, Rabbani PS, Ceradini DJ (2017) The Nrf2/
Keap1/ARE Pathway and Oxidative Stress as a Therapeutic Tar -
get in Type II Diabetes Mellitus. J Diabetes Res 2017: 15. doi:
10.1155/2017/4826724
17. Zgorzynska E, Dziedzic B, Walczewska A (2021) An Overview
of the Nrf2/ARE Pathway and Its Role in Neurodegenerative Di -
seases. Int J Mol Sci 22 (17). doi: 10.3390/ijms22179592
18. Panieri E, Buha A, Telkoparan-Akillilar P, Cevik D, Kouretas D,
Veskoukis A, Skaperda Z, Tsatsakis A, Wallace D, Suzen S, Saso
L (2020) Potential Applications of NRF2 Modulators in Cancer
Therapy. Antioxidants (Basel) 9 (3). doi: 10.3390/antiox9030193
19. Kubo E, Chhunchha B, Singh P, Sasaki H, Singh DP (2017) Sulfo-
raphane reactivates cellular antioxidant defense by inducing Nrf2/
ARE/Prdx6 activity during aging and oxidative stress. Sci Rep 7:
14130. doi: 10.1038/s41598-017-14520-8
20. Miller LN, Walters AE, Denninger JK, Hanson MA, Marshall
AH, Johantges AC, Hosawi M, Sebring G, Rieskamp JD, Ding
T (2025) Neural stem and progenitor cells support and protect
adult hippocampal function via vascular endothelial growth fac -
tor secretion. Mol Psychiatry 30 (5): 2152-2167. doi: 10.1038/
s41380-024-02827-8
21. Abdanipour A, Sagha M, Noori-Zadeh A, Pakzad I, Tirai -
hi T (2015) In vitro study of the long-term cortisol treat -
ment effects on the growth rate and proliferation of the neu -
ral stem/precursor cells. Neurol Res 37 (2): 117-124. doi:
10.1179/1743132814y.0000000431
22. Liu Y , Fu H, Ma J, Wang Y , Shi Z, Liu Y , Huang X, Han B, Li J
(2026) Kuwanon A from Morus alba L. Alleviates H2O2-Induced
Oxidative Damage in HaCaT Keratinocytes by Inhibiting Ferrop-
tosis and Enhancing Antioxidant Capacity. Antioxidants 15 (6):
657. doi:
23. Zhan X, Li J, Zhou T (2021) Targeting Nrf2-Mediated Oxidative
Stress Response Signaling Pathways as New Therapeutic Stra -
tegy for Pituitary Adenomas. Front Pharmacol 12: 565748. doi:
10.3389/fphar.2021.565748
24. Rahman K (2007) Studies on free radicals, antioxidants, and co-
factors. Clin Interv Aging 2 (2): 219-236. doi:
25. Olufunmilayo EO, Gerke-Duncan MB, Holsinger RMD (2023)
Oxidative Stress and Antioxidants in Neurodegenerative Disor -
ders. Antioxidants (Basel) 12 (2). doi: 10.3390/antiox12020517
26. Riederer P, Laux G (2011) MAO-inhibitors in Parkinson's Di -
sease. Exp Neurobiol 20 (1): 1-17. doi: 10.5607/en.2011.20.1.1
27. Zhao Q, Cai D, Bai Y (2013) Selegiline rescues gait deficits and
the loss of dopaminergic neurons in a subacute MPTP mouse mo-
del of Parkinson's disease. Int J Mol Med 32 (4): 883-891. doi:
10.3892/ijmm.2013.1450
28. Youdim MB, Gross A, Finberg JP (2001) Rasagiline [N-propar -
gyl-1R(+)-aminoindan], a selective and potent inhibitor of mito -
chondrial monoamine oxidase B. Br J Pharmacol 132 (2): 500-
506. doi: 10.1038/sj.bjp.0703826
29. Tsao CM, Jhang JG, Chen SJ, Ka SM, Wu TC, Liaw WJ, Huang
HC, Wu CC (2014) Adjuvant potential of selegiline in attenuating
organ dysfunction in septic rats with peritonitis. PLoS One 9 (9):
e108455. doi: 10.1371/journal.pone.0108455
30. Nakaso K, Nakamura C, Sato H, Imamura K, Takeshima T, Na -
kashima K (2006) Novel cytoprotective mechanism of anti-par -
kinsonian drug deprenyl: PI3K and Nrf2-derived induction of
antioxidative proteins. Biochem Biophys Res Commun 339 (3):
915-922. doi: 10.1016/j.bbrc.2005.11.095
31. Zhang Z, Zhou S, Jiang X, Wang YH, Li F, Wang YG, Zheng Y ,
Cai L (2015) The role of the Nrf2/Keap1 pathway in obesity and
metabolic syndrome. Rev Endocr Metab Disord 16 (1): 35-45.
doi: 10.1007/s11154-014-9305-9
32. Liu Z, Liu Y , Gao R, Li H, Dunn T, Wu P, Smith RG, Sarkar PS,
Fang X (2014) Ethanol suppresses PGC-1alpha expression by in-
terfering with the cAMP-CREB pathway in neuronal cells. PLoS
One 9 (8): e104247. doi: 10.1371/journal.pone.0104247
33. Ventura-Clapier R, Garnier A, Veksler V (2008) Transcriptional
control of mitochondrial biogenesis: the central role of PGC-1α.
Cardiovasc Res 79 (2): 208-217. doi: 10.1093/cvr/cvn098
34. Kang KW, Lee SJ, Kim SG (2005) Molecular mechanism of nrf2
activation by oxidative stress. Antioxidants & redox signaling 7
(11-12): 1664-1673. doi: 10.1089/ars.2005.7.1664
35. Kasai S, Shimizu S, Tatara Y , Mimura J, Itoh K (2020) Regulation
of Nrf2 by Mitochondrial Reactive Oxygen Species in Physiology
and Pathology. Biomolecules 10 (2). doi: 10.3390/biom10020320
36. Gureev AP, Shaforostova EA, Popov VN (2019) Regulation of
mitochondrial biogenesis as a way for active longevity: interac -
tion between the Nrf2 and PGC-1α signaling pathways. Front
Genet 10: 435. doi: 10.3389/fgene.2019.00435
37. Pang Y , Zhang L, Liu Q, Peng H, He J, Jin H, Su X, Zhao J, Guo J
(2022) NRF2/PGC-1α-mediated mitochondrial biogenesis contri-
butes to T-2 toxin-induced toxicity in human neuroblastoma SH-
SY5Y cells. Toxicology & Applied Pharmacology 451: 116167.
doi: 10.1016/j.taap.2022.116167
38. D’Egidio F, Qosja E, Ammannito F, Topi S, d’Angelo M, Cimini
A, Castelli V (2025) Antioxidant and anti-inflammatory defenses
in Huntington’s disease: roles of NRF2 and PGC-1α, and thera -
peutic strategies. Life 15 (4): 577. doi: 10.3390/life15040577
39. Li J, Zhang W, Hu W, Gao W, Wang J, Li J, Wang Y , Wang W, Gao
H, Yi B (2025) Analysis of the Protective Mechanism of PGC-1α/
NRF1/2/TFAM Pathway in Cortical Neuron Injury Induced by
Oxidative Stress. Bulletin of Experimental Biology and Medicine
180 (2): 259-266. doi: 10.1007/s10517-026-06617-w
40. Niture SK, Jaiswal AK (2012) Nrf2 protein up-regulates antia -
poptotic protein Bcl-2 and prevents cellular apoptosis. Journal
of Biological Chemistry 287 (13): 9873-9886. doi: 10.1074/jbc.
M111.312694
53
Selegiline upregulates PGC-1α/Nrf2. Cell. Mol. Biol. 2026, 72(5): 47-53
41. Xiao H, Lv F, Xu W, Zhang L, Jing P, Cao X (2011) Deprenyl
prevents MPP(+)-induced oxidative damage in PC12 cells by the
upregulation of Nrf2-mediated NQO1 expression through the
activation of PI3K/Akt and Erk. Toxicology 290 (2-3): 286-294.
doi: 10.1016/j.tox.2011.10.007
42. Ishikawa T (2014) Genetic polymorphism in the NRF2 gene as a
prognosis marker for cancer chemotherapy. Front Genet 5: 383.
doi: 10.3389/fgene.2014.00383
43. Cory S, Adams JM (2002) The Bcl2 family: regulators of the cel-
lular life-or-death switch. Nature Reviews Cancer 2 (9): 647-656.
doi: 10.1038/nrc883
44. Ji XJ, Chen SH, Zhu L, Pan H, Zhou Y , Li W, You WC, Gao CC,
Zhu JH, Jiang K, Wang HD (2013) Knockdown of NF-E2-related
factor 2 inhibits the proliferation and growth of U251MG human
glioma cells in a mouse xenograft model. Oncol Rep 30 (1): 157-
164. doi: 10.3892/or.2013.2476
45. Habeos IG, Ziros PG, Chartoumpekis D, Psyrogiannis A, Kyriazo-
poulou V , Papavassiliou AG (2008) Simvastatin activates Keap1/
Nrf2 signaling in rat liver. J Mol Med (Berl) 86 (11): 1279-1285.
doi: 10.1007/s00109-008-0393-4
46. Pi Y , Zuo H, Wang Y , Zheng W, Zhou H, Deng L, Song H (2024)
Oleanolic acid alleviating ischemia-reperfusion injury in rat se -
vere steatotic liver via KEAP1/NRF2/ARE. Int Immunopharma -
col 138: 112617. doi: 10.1016/j.intimp.2024.112617
47. Anedda A, Lopez-Bernardo E, Acosta-Iborra B, Saadeh Suleiman
M, Landazuri MO, Cadenas S (2013) The transcription factor
Nrf2 promotes survival by enhancing the expression of uncou -
pling protein 3 under conditions of oxidative stress. Free Radic
Biol Med 61: 395-407. doi: 10.1016/j.freeradbiomed.2013.04.007