Introduction
Multiple sclerosis (MS) is the most common demyelinating disease in humans and until now, no approved therapy reliably restores remyelination in MS [ 1 – 4 ]. In the injured CNS, the remyelination is initiated by a special subset of endogenous stem cells called oligodendroglial progenitor cells (OPCs), which arise from the ventricular zone during early development to proliferate and migrate into the different developing areas of the brain, where they differentiate into myelin-forming oligodendrocytes (OLs) [ 5 , 6 ]. Despite having this endogenous machinery, many axons remain demyelinated in the CNS of MS patients. Therefore, delineation of new drugs/targets for overpowering the blockade and endorsing remyelination is an important area of research.
Toll-like receptors (TLRs) assist as vital links between innate and adaptive immune responses mostly by responding to bacteria, bacterial products, viruses, viral products, and flagellin [ 7 – 9 ]. Although in the beginning, TLRs were supposed to be present in cells of only myeloid origin, recent studies indicate the presence of TLRs in non-myeloid cells as well [ 10 , 11 ]. For example, OPCs are rich in TLR2 [ 11 , 12 ]. It has been demonstrated that TLR2 is present in human MS chronic lesions and that TLR2 is a negative regulator of OPC maturation [ 12 ]. According to Sloane et al.[ 12 ], genetic knockdown of either TLR2 or its downstream partner MyD88 enhances remyelination in an animal model of demyelination. However, gene knockdown of either TLR2 or Myd88 is not a therapeutic option. Since there was no specific inhibitor of TLR2, to target induced TLR2 from therapeutic angle, we have engineered a peptide corresponding to the TLR2-interacting domain of MyD88 (TIDM) that binds to the BB loop of only TLR2, but not other TLRs [ 9 ]. Accordingly, the wild type (wt) TIDM peptide selectively dissociates the interaction between TLR2 and MyD88 to inhibit the activation of only TLR2, but not other TLRs [ 8 , 9 ].
Here, we establish that wtTIDM peptide stimulates the maturation of OPCs to OLs and that intranasal administration of wtTIDM peptide promotes remyelination in the corpus callosum of cuprizone-intoxicated mouse model of MS. Furthermore, by using OPCs isolated from TLR2 −/− and TLR4 −/− mice, we also demonstrate that wtTIDM peptide requires the interaction with TLR2, but not TLR4, for increasing the maturation of OPCs. Together, this study highlights wtTIDM as a prospective intranasal agent to promote remyelination in MS and other demyelinating disorders.
Materials and methods
Animals
Animal maintaining and experiments were in accordance with National Institute of Health guidelines and were approved (protocol ID: 22–19) by the Institutional Animal Care and Use committee of the Jesse Brown VA Medical Center, Chicago, IL. Mice were housed in ventilated micro-isolator cages in an environmentally controlled vivarium (7:00 A.M./7:00P.M. light cycle; temperature maintained at 21–23 ° C; humidity 35–55 %). Animals were provided with standard mouse chow and water ad libitum and closely monitored for health and overall well-being daily by veterinary staff and the investigator. This study was not preregistered. C57BL/6J (RRID: IMSR_JAX:000664), TLR2 −/− (RRID: IMSR_JAX:004650) and TLR4 −/− (RRID: IMSR_JAX:029015) mice were obtained from Jackson Laboratory, Bar Harbor, ME, USA.
Reagents
Molecular Biology grade agarose (RRID: 1613102) was purchased from Bio-Rad (Hercules, CA). DMEM/F-12 (RRID: 10–092-CV), Hanks’ balanced salt solution (RRID: 21–022-CM), l -glutamine (RRID: 25–005-CI), 0.05 % trypsin (RRID: 25–051-CI), and antibiotic/antimycotic (RRID: 30–004-CI) were obtained from ThermoFisher (Waltham, MA). Fetal bovine serum or FBS (RRID: EF-0500-A) was obtained from Atlas Biologicals (Fort Collins, CO). Alexa-fluor 488 donkey anti-goat (RRID: 705-546-147), Alexa-fluor 647 donkey anti-rabbit (RRID: 711-605-152), and Alexa-fluor 488 donkey anti-mouse (RRID: 715-545-150) secondary antibodies used in immunostaining were obtained from Jackson ImmunoResearch (West Grove, PA). DAPI dihydrochloride (DAPI) was purchased from Millipore-Sigma (Burlington, MA).
TLR2-interacting domain of MyD88 (TIDM) peptides
TIDM peptides (>99 % pure) were synthesized in the custom peptide synthesis facility of Genscript (Piscataway, NJ). TIDM peptides contain the Antennapedia homeodomain (lower case) and MyD88 (upper case) segments [ 8 , 9 , 13 ]. Positions of A→W and K→D mutations are underlined for TIDM peptides: Wild type (wt) TIDM: drqikiwfqnrrmkwkkPGAHQK. Mutated (m) TIDM: drqikiwfqnrrmkwkkPGWHQD.
Cuprizone feeding
Cuprizone-containing chow (0.2 % w/w) diet (RRID: TD.140803) was purchased from Envigo (Indianapolis, IN, USA). Eight-weeks-old C57BL/6J (RRID: IMSR_JAX:000664) male mice were provided cuprizone chow for 5 weeks.
Intranasal treatment of cuprizone-intoxicated mice with TIDM peptides
Wild type (wt) TIDM and mutated (m) TIDM peptides were solubilized in normal saline in such a way that each mouse receives 0.1 mg/kg of body weight TIDM peptide in 2.5 μL of saline. After 5 weeks of cuprizone feeding, mice were given regular chow and treated with TIDM peptides intranasally (2.5 μL in one nostril) every day for a total of 21 days. While the right nostril was used for treatment one day, the left one was used the next day. Since TIDM peptides were solubilized in saline, one group of cuprizone-insulted mice also received 2.5 μL of saline as vehicle control. Mice were hold in supine condition while administering TIDM solutions [ 8 , 9 , 13 ]. Treatment started daily at 10 AM and continued for 21 days. During treatment, no mouse either reached the moribund stage or died. After 21 d of treatment, mice were anesthetized with ketamine/xylazine injectables followed by perfusion with PBS and paraformaldehyde. Animals were deeply anesthetized and transcardially perfused.
Isolation of mouse OPCs
OPCs were isolated from P1-P2 neonatal pups as described before [ 14 – 16 ] with modifications. Briefly, the brain tissues from the pups were pooled together and placed together in the DMEM/F-12 media supplemented with 10 % heat-inactivated fetal bovine serum. Cells were dissociated by trituration, and single cell suspension was plated in poly- d -lysine (RRID: P0899; Sigma) pre-coated flasks containing complete DMEM/F12 media. On the 9th day, flasks were shaken for 2 h at 240 rpm to remove microglia from the rest of the cells. Then, on the 11th day, flasks were shaken overnight at 180 rpm, followed by 2 h shaking at 240 rpm to isolate OPCs. In order to remove microglia and astrocytes from OPCs, suspended cells were allowed to adhere on uncoated flasks for 1 h. Non-adherent cells were centrifuged at 1,000 rpm for 10 min and plated on experimental wells, plates or coverslips in the presence of OPC medium [DMEM containing 4 mM l -glutamine (RRID: 25–005-CI), 1 mM sodium pyruvate (RRID: 11360070L; ThermoFisher), 0.1 % BSA (RRID: J64248.AE; ThermoFisher), 50 μg/mL apotransferrin (RRID: T2036–100 MG; Sigma), 5 μg/mL insulin (RRID: H0888–1G; Sigma), 30 nM sodium selenite (RRID: S5261–10G; Sigma), 10 nM D-biotin (RRID: B4639–100 MG; Sigma), 10 nM hydrocortisone (RRID: H0888–1G; Sigma), 10 ng/mL PDGF (RRID: P3326; Sigma), and 10 ng/mL bFGF (RRID: F0291; Sigma)]. Recently, we have seen that OPCs isolated by this procedure are highly pure and apparently that OPCs are free of either GFAP-positive astrocytes or Iba-1-positive microglia [ 6 ]. During treatment, OPCs were cultured in OPC medium in the absence of PDGF and bFGF and treated with different concentrations of wtTIDM and mTIDM for different time periods as mentioned for particular experiments.
Real-time PCR analysis
Total RNA was isolated from OPCs using the QIAGEN RNeasy kit following the manufacturer’s protocol. The isolated RNA was reverse transcribed into cDNA, and real-time PCR was performed using the following primers: MBP: Sense: 5 ′ - TGGAGAGATTCACCGAGGAGA −3′ Antisense: 5′ - TGAAGCTCGTCGGACTCTGAG −3 ′ PLP: Sense: 5 ′- CTTCCCTGGTGGCCACTGGATTGT −3′ Antisense: 5′ - CCGCAGATGGTGGTCTTGTAGTCG −3′ MOG: Sense: 5′ - CCTCTCCCTTCTCCTCCTTC −3′ Antisense: 5′ - AGAGTCAGCACACCGGGGTT −3′ GAPDH: Sense: 5′ - CAGGGGATGATCATGGCTTCTCC −3 ′ Antisense: 5′ - GATGCTCACAAGAGCCCCGTTAGC −3′
Real-time PCR was carried out in a QuantStudio 3 detection system (Thermo Fisher Scientific) using the SYBR green real-time kit obtained from Quantabio. Cycle threshold crossing point ( C t ) values for each sample were obtained from the software, and data were analyzed using the 2 −ΔΔCt method as described previously [ 17 , 18 ].
Western blot
It was performed as described before [ 6 , 19 , 20 ]. Briefly, equal amounts of proteins were electrophoresed in 10 % or 12 % polyacrylamide-SDS gels in 1X SDS running buffer. Proteins were transferred to 0.45 μm nitrocellulose membranes under wet conditions. Membranes were blocked for 1 h with Li-Cor blocking buffer, incubated with primary antibodies overnight at 4 ° C under shaking conditions, washed, incubated with IR-dye labeled secondary antibodies at room temperature, washed and visualized with the Odyssey Infrared Imaging System (Li-Cor) . Blots were converted to binary, analyzed using ImageJ (NIH) and normalized to the loading control (β-actin).
Immunostaining
Cells were washed three times with 1X PBS, fixed in 4 % paraformaldehyde for 10 min or with chilled methanol (RRID: A412–500; ThermoFisher, Waltham, MA) overnight, washed again with 1X PBS, and incubated first with primary antibodies followed by Alexa Fluor 488- or Alexa Fluor 647-conjugated Affinity Pure Donkey secondary antibodies (Jackson ImmunoResearch) as described earlier [ 21 – 23 ]. For details on primary antibodies, please see Table 1 . After secondary antibody incubation, coverslips were rinsed in 1X PBS, mounted on slides in Fluoromount (Sigma) and imaged using an Olympus BX41 fluorescent microscope equipped with a Hamamatsu ORCA-03G camera. Immunostaining of tissue was performed by fixing the brains in 4 % paraformaldehyde followed by 30 % sucrose [ 24 , 25 ]. Tissue was sectioned every 40 μm on a Leica Cryostat CM3050 S and kept in cryoprotectant. DAPI was added at the final step of washing of secondary antibodies for staining nuclei.
Cell counting
Counting analysis was performed using the Olympus Micro-suite V software with the help of touch counting module as described [ 26 , 27 ]. After acquiring images under 20× objective lens, images were further analyzed as follows. Before counting cells, entire Image area was calibrated with the help of a rectangular box available in the touch counting panel. Once the area of the image was measured, touch counting program was applied to count number of fluorescent signals. Next, the total number of signals in a given area was divided by the total area of the image and presented as number of cells per square millimeter unit.
Mean fluorescence intensity (MFI) calculation
MFI was calculated using ImageJ as described before [ 17 , 18 , 28 ]. Briefly, to calculate the MFI of a whole image, the average pixel value of the whole frame was recorded followed by selecting a region of the image with no fluorescence from tissue or cell using the rectangle tool for measuring background intensity. Then true MFI of the image was determined by subtracting background intensity from the whole image intensity.
Blinding and statistical analysis
All Western blot, real-time PCR, and immunohistochemical analyses were performed in a blinded manner. Laboratory personnel only knew about ID of each sample. For animal experiments, five mice were randomly included in each group. The sample size was similar to those reported in previous publications [ 29 , 30 ] and is mentioned in figure legends. All cell culture experiments were repeated at least three times. Results were statistically analyzed using GraphPad Prism 10.1.1. Values are expressed as either mean ± SD or mean ± SEM. One-way ANOVA followed by Tukey’s multiple comparisons was performed for statistical analyses among multiple groups. For analyzing maturation of OPCs isolated from WT and TLR2 −/− mice, two-way ANOVA was performed followed by Tukey’s post hoc test. Normality assumptions were tested before applying ANOVA. The criterion for statistical significance was p<0.05.
Results
Effect of wtTIDM on the maturation of OPCs into OLs
OPCs are switched towards new myelinating OLs during remyelination. A2B5, a cell surface ganglioside epitope, is considered as a reliable marker of OPCs. According to Figarella-Branger et al. [ 31 ], A2B5 is required probably to support the self-renewal property of OPCs. Since PLP is a marker of OLs, downregulation of A2B5 along with subsequent upregulation of PLP is therefore used to examine the generation of OLs from OPCs. Primary mouse OPCs isolated from WT mice were treated with different doses of wtTIDM and mTIDM for 18 h followed by immunostaining with PLP and A2B5. We found that wtTIDM at both 1 and 2 μM concentrations upregulated the level of PLP with strong inhibition of A2B5 ( Figure 1A ). To confirm the finding further, we performed cell counting that clearly showed marked reduction in A2B5 + ( Figure 1B ) along with strong increase in PLP + ( Figure 1C ) cells. To confirm the findings further, we examined the mRNA expression of MBP, PLP and MOG (markers of OLs) by real-time PCR. Consistent to immunostaining results, wtTIDM, but not mTIDM, increased the mRNA expression of MBP ( Figure 2A ), PLP ( Figure 2B ) and MOG ( Figure 2C ) in OPCs, indicating that wtTIDM, but not mTIDM, is capable of inducing maturation of OPCs to OLs.
The wtTIDM induces the maturation of OPCs into OLs in TLR4 −/− , but not TLR2 −/− , OPCs
Since wtTIDM is known to bind TLR2, but not other TLRs [ 9 ], to understand the specificity of this promyelinating function of wtTIDM, OPCs isolated from TLR2 −/− and TLR4 −/− mice were treated with wtTIDM peptide. After 24 h of treatment, OPCs were double-labeled with antibodies against PLP and A2B5. As evident from Figure 3A – D , the knockdown of TLR2 alone was sufficient to significantly increase the levels of PLP + OLs and decrease the number of A2B5 + OPCs as compared to control WT OPCs, indicating that TLR2 is a negative regulator of OPC maturation. However, treatment with wtTIDM peptide remained ineffective to further upregulate PLP and downregulate A2B5 in TLR2 −/− OPCs, indicating that in the absence of TLR2, the wtTIDM is unable to stimulate the maturation of OPCs to OLs.
On the other hand, in contrast to the knockdown of TLR2, the absence of TLR4 alone did not augment the number of PLP + OLs and reduce the number of A2B5 + OPCs ( Figure 4A – C ), indicating that dissimilar to TLR2, TLR4 is not a negative regulator of OPC maturation. However, similar to WT OPCs ( Figure 3A , C and D ), the wtTIDM peptide markedly increased the number of PLP + OLs and decreased the number of A2B5 + OPCs in TLR4 −/− OPCs ( Figure 4A – C ). Although TLR4 is an important TLR, our results clearly indicate that wtTIDM does not require TLR4 for stimulating the maturation of OPCs to OLs.
Intranasal administration of wtTIDM stimulates remyelination in the corpus callosum of cuprizone-intoxicated mice
Since cuprizone-insulted mice exhibit demyelination in the brain particularly in the myelin-rich corpus callosum [ 32 ], these mice are generally used to monitor remyelinating efficacy of different drugs in vivo in the brain. Therefore, after 5 weeks of cuprizone feeding, groups of mice (n=5) were treated with 0.1 mg/kg body weight of wtTIDM and mTIDM daily via intranasal route. Please see the schematic presentation of the experiment ( Figure 5A ). After 3 weeks of wtTIDM/mTIDM treatment, the maturation of OPCs to OLs was monitored in the corpus callosum by double-labeling of corpus callosum sections for PLP & A2B5. As expected, widespread demyelination was observed in the corpus callosum of cuprizone-intoxicated mice in comparison to control mice ( Figure 5B ). The corpus callosum of cuprizone-insulted mice was full of A2B5 + OPCs and almost devoid of PLP + OLs and myelin ( Figure 5B – D ). However, 3 weeks of wtTIDM treatment markedly increased the level of PLP ( Figure 5B and C ) and decreased the level of A2B5 ( Figure 5B and D ) in the corpus callosum of cuprizone-intoxicated mice, indicating that intranasal wtTIDM is capable of stimulating remyelination in the brain of cuprizone-challenged mice. On the other hand, such increase in PLP and decrease in A2B5 were not found in mTIDM-treated cuprizone-challenged mice ( Figure 5B – D ).
To confirm this finding further, corpus callosum sections were immunostained with antibodies against MBP and NG2. Similar to PLP, remarkable loss of MBP was seen in the corpus callosum of cuprizone-fed mice as compared to normal mice ( Figure 6A and B ). On the other hand, as expected, NG2-positive OPCs were recruited to the corpus callosum of cuprizone-insulted mice ( Figure 6A and C ). However, intranasal treatment with wtTIDM, but not mTIDM, led to upregulation of MBP and downregulation of NG2 in the corpus callosum of cuprizone-challenged mice ( Figure 6A – C ).
For further confirmation of remyelinating efficacy of wtTIDM, protein levels of MBP and PLP were monitored in corpus callosum by Western blot. Similar to immunofluorescence results, marked reduction of MBP and PLP was seen in the corpus callosum of cuprizone-fed mice in comparison to control mice ( Figure 7A – C ). However, intranasal wtTIDM increased the levels of both MBP and PLP in cuprizone-intoxicated mice, which was not seen in case of mTIDM treatment ( Figure 7A – C ). These results suggest that wtTIDM, but not mTIDM, is capable of stimulating remyelination in the brain of a mouse model of demyelination.
Discussion
Myelin is a lipid rich plasma membrane [ 4 , 33 ], which forms manifold concentric coatings around the axon for preserving electrical conduction through a healthy neuron [ 34 ]. However, in demyelinating conditions, the ionic conduction through the neuron is reduced, ultimately leading to axonal loss. Therefore, demyelination is considered as an important pathological hallmark in several neuroinflammatory disorders including MS [ 35 ], Devic’s disease [ 36 ], progressive multifocal leukoencephalopathy [ 37 ], Krabbe disease [ 38 ], neuromyelitis optica [ 39 ], and X-Adrenoleukodystrophy [ 40 , 41 ]. Since OLs are the only myelin-synthesizing cells in the CNS, the death or dysfunction of OLs is considered as the major cause of demyelination [ 38 , 42 – 47 ].
Dissimilar to most progenitor cells, OPCs stay throughout life as adult [ 48 ]. According to Elbaz and Popko [ 49 ], self-renewing OPCs are capable of differentiating into newly formed myelinating OLs for maintaining myelin plasticity. Accordingly, lost myelin may be regenerated during remyelination, thus preventing axonal degeneration and restoring function. It has been shown that defective maturation of OPCs into OLs is one of the important primary mechanisms of demyelination [ 50 – 52 ]. In chronic active lesions, Boyd et al. have shown that deficiency of OPC within lesions either due to impaired recruitment and/or proliferation is another cause of remyelination failure [ 53 ]. Although remyelination is a natural regenerative process, which is believed to prevent neurodegeneration and restore function in human MS lesions, Chang et al. [ 54 ] and Kuhlmann et al. [ 55 ] identified a block in OPC differentiation into oligodendrocytes. Therefore, describing underlying mechanisms behind defective OPC maturation and developing an effective neuroprotective therapeutic approach to achieve remyelination are important areas of research.
Recently, we have developed wtTIDM peptide that inhibits microglial activation induced by lipoteichoic acid and fibrillar Aβ, tau and α -syn [ 8 , 9 , 13 ]. In contrast, wtTIDM peptide does not interfere with LPS-, IL-1β-, polyIC-, MPP + -, flagellin-, and CpG DNA-mediated activation of microglia [ 9 ]. This is because wtTIDM is specific for TLR2 and fibrillar Aβ, tau and α -syn activate microglia via TLR2 [ 8 , 9 , 13 , 56 ]. It has been shown that TLR2 is expressed in OLs in MS lesions [ 12 ] and that TLR2 ligands as well as hyaluronan hold OPCs in an immature state via TLR2 [ 12 ]. Therefore, we examined the efficacy of wtTIDM in promoting the maturation of OPCs. The results clearly demonstrate that low dose wtTIDM markedly stimulates the maturation of OPCs to OLs. MBP, PLP and MOG are considered as specific markers of matured OLs, and it is nice to see that micromolar concentrations of wtTIDM readily upregulate MBP, PLP and MOG in OPCs. For checking the specificity, when TLR2 −/− and TLR4 −/− OPCs were used for treatment, wtTIDM stimulated the maturation in TLR4 −/− , but not TLR2 −/− , OPCs, clearly delineating the involvement of TLR2 in wtTIDM-mediated OPC maturation. This also suggests that wtTIDM will not function if TLR2 is not present.
In human MS, chronic demyelination often becomes recalcitrant to simple differentiation-inducing agents, indicating that in the chronically demyelinated CNS, inducing differentiation alone sometimes fails to support full repair processes if the underlying inflammatory “milieu” is not addressed. Although we have not analyzed microglial activation here, glial inflammation plays an important role in the pathogenesis of demyelination in MS [ 57 , 58 ]. Several studies from CNS tissues of MS and experimental autoimmune encephalomyelitis, an animal model of MS, have suggested that proinflammatory cytokines, chemokines, nitric oxide, etc. released activated glial cells and macrophages create a conducive environment for demyelination and a hostile environment for remyelination in MS [ 2 , 58 – 60 ]. Therefore, chronic neuroinflammation and demyelination and/or failure to remyelination are important contributors of disability among patients with MS [ 57 , 58 , 61 – 64 ]. However, microglia are rich in TLR2 and MyD88 and in several studies [ 8 , 9 , 13 ], we have already described that wtTIDM is capable of inhibiting microglial inflammation. Since wtTIDM is also capable of promoting the maturation of OPCs, it may be a valuable tool for encouraging remyelination in an inflamed CNS.
While many molecules exhibit function in cell cultures, very few cross the blood-brain barrier (BBB) and show efficacy in vivo in the brain. However, wtTIDM contains the antennapedia homeodomain tag at the N-terminus, which helps the wtTIDM to enter into the cells and cross the BBB [ 8 , 9 ]. Therefore, after intranasal administration, wtTIDM enters into different parts of the brain of diseased as well as normal mice. While by using infrared scanning and electrospray ionization-coupled mass spectrometry, Rangasamy et al. [ 9 ] have reported the entry of intranasally delivered wtTIDM into the hippocampus of 5XFAD mice, Dutta et al. [ 8 ] have detected wtTIDM in frontal cortex, midbrain and cerebellum of normal B6C3 mice by infrared scanning after intranasal administration. Accordingly, after 3 weeks of treatment, the wtTIDM stimulated the maturation of OPCs and increased remyelination in corpus callosum of cuprizone-intoxicated mice. Our conclusions are based on the following. First , the wtTIDM, but not mTIDM, peptide treatment increased the level of both PLP and MBP (markers of OLs and myelin) in the corpus callosum of cuprizone-intoxicated mice. Second , levels of both A2B5 and NG2 (markers of OPCs) decreased after treatment with wtTIDM, but not mTIDM, peptide. TLR2 is known to function via both MyD88-dependent and – independent pathways [ 65 , 66 ] and the real strength of our finding is that TIDM peptide targets only the MyD88-dependent induced TLR2 signaling pathway without inhibiting basal TLR2 activity.
Although until now, there is no FDA-approved remyelination-specific drug, recent studies have identified several ones for clinical or preclinical development. For example, a selective M1 muscarinic receptor antagonist (PIPE-307) [ 67 ] and a synthetic peptide (FTX-101) designed to disrupt the Plexin A1/Neuropilin 1 (NRP1) receptor complex [ 68 ] are being developed for remyelination in MS patients based on their potential on stimulating the maturation of OPCs. While these drugs are targeting either M1 muscarinic G protein-coupled receptor or semaphorin transmembrane receptor, wtTIDM is targeting a specific pattern recognition receptor (TLR2) in the innate immune system [ 8 , 9 ].
In summary, here, we demonstrate that selective inhibition of TLR2-to-MyD88 interaction by wtTIDM stimulates the differentiation of OPCs to OLs via TLR2, but not TLR4, and that after intranasal administration, the wtTIDM increases the differentiation of OPCs and promotes remyelination in the corpus callosum of cuprizone mouse model of demyelination. Therefore, specific blocking of the TLR2-MyD88 pathway with the synthetic peptide wtTIDM may be considered for remyelination in MS and other demyelinating conditions.
Research funding:
This study was supported by a merit award (BX005613) from the U.S. Department of Veterans Affairs and a grant (AT10980) from NIH. Moreover, Dr. Pahan is the recipient of a Research Career Scientist Award (1IK6 BX004982) from the U.S. Department of Veterans Affairs. However, the views expressed in this article are those of the authors and do not necessarily reflect the position or policy of the Department of Veterans Affairs or the United States government.
Research ethics: Animal maintenance was done according to the guidelines of National Institute of Health and Department of Veterans Affairs and was approved by the Institutional Animal Care and Use committee of the Jesse Brown VA Medical Center.
Use of Large Language Models, AI and Machine Learning Tools: None declared.
Conflict of interest: Although authors state no conflict of interest for this study, Dr. Kalipada Pahan is in the Scientific Advisory Board of Polaryx Therapeutics.
Data availability:
Data will be made available on request.
References
1. Dendrou CA , Fugger L , Friese MA . Immunopathology of multiple sclerosis . Nat Rev Immunol 2015 ; 15 : 545 – 58 . 26250739 10.1038/nri3871
2. Pahan K . Multiple sclerosis and experimental allergic encephalomyelitis . J Clin Cell Immunol 2013 ; 4 . PMC3903289 24478934
3. Bose A , Pahan K . Build muscles and protect myelin . NeuroImmune Pharm Ther 2024 ; 3 : 175 – 82 ., 39741558 10.1515/nipt-2024-0015 PMC11683878
4. Hartline DK . What is myelin? Neuron Glia Biol 2008 ; 4 : 153 – 63 ., 19737435 10.1017/S1740925X09990263
5. Gonzalez-Perez O , Alvarez-Buylla A . Oligodendrogenesis in the subventricular zone and the role of epidermal growth factor . Brain Res Rev 2011 ; 67 : 147 – 56 ., 21236296 10.1016/j.brainresrev.2011.01.001 PMC3109119
6. Jana M , Prieto S , Gorai S , Dasarathy S , Kundu M , Pahan K . Muscle-building supplement beta-hydroxy beta-methylbutyrate stimulates the maturation of oligodendroglial progenitor cells to oligodendrocytes . J Neurochem 2024 ; 168 : 1340 – 58 ., 38419348 10.1111/jnc.16084 PMC11260247
7. Akira S , Takeda K . Toll-like receptor signalling . Nat Rev Immunol 2004 ; 4 : 499 – 511 ., 15229469 10.1038/nri1391
8. Dutta D , Jana M , Majumder M , Mondal S , Roy A , Pahan K . Selective targeting of the TLR2/MyD88/NF-kappaB pathway reduces alpha-synuclein spreading in vitro and in vivo . Nat Commun 2021 ; 12 : 5382 ., 34508096 10.1038/s41467-021-25767-1 PMC8433339
9. Rangasamy SB , Jana M , Roy A , Corbett GT , Kundu M , Chandra S , Selective disruption of TLR2-MyD88 interaction inhibits inflammation and attenuates Alzheimer’s pathology . J Clin Investig 2018 ; 128 : 4297 – 312 ., 29990310 10.1172/JCI96209 PMC6159992
10. Nouri Y , Weinkove R , Perret R . T-cell intrinsic toll-like receptor signaling: implications for cancer immunotherapy and CAR T-cells . J Immunother Cancer 2021 ; 9 . 10.1136/jitc-2021-003065 . PMC8606765 34799397
11. Rouillard ME , Hu J , Sutter PA , Kim HW , Huang JK , Crocker SJ . The cellular senescence factor extracellular HMGB1 directly inhibits oligodendrocyte progenitor cell differentiation and impairs CNS remyelination . Front Cell Neurosci 2022 ; 16 : 833186 ., 35573828 10.3389/fncel.2022.833186 PMC9095917
12. Sloane JA , Batt C , Ma Y , Harris ZM , Trapp B , Vartanian T . Hyaluronan blocks oligodendrocyte progenitor maturation and remyelination through TLR2 . Proc Natl Acad Sci USA 2010 ; 107 : 11555 – 60 ., 20534434 10.1073/pnas.1006496107 PMC2895128
13. Dutta D , Jana M , Paidi RK , Majumder M , Raha S , Dasarathy S , Tau fibrils induce glial inflammation and neuropathology via TLR2 in Alzheimer’s disease-related mouse models . J Clin Investig 2023 ; 133 . 10.1172/jci161987 . PMC10503811 37552543
14. Jana M , Jana A , Pal U , Pahan K . A simplified method for isolating highly purified neurons, oligodendrocytes, astrocytes, and microglia from the same human fetal brain tissue . Neurochem Res 2007 ; 32 : 2015 – 22 ., 17447141 10.1007/s11064-007-9340-y PMC2085356
15. Jana M , Mondal S , Gonzalez FJ , Pahan K . Gemfibrozil, a lipid-lowering drug, increases myelin genes in human oligodendrocytes via peroxisome proliferator-activated receptor-beta . J Biol Chem 2012 ; 287 : 34134 – 48 ., 22879602 10.1074/jbc.M112.398552 PMC3464522
16. Dincman TA , Beare JE , Ohri SS , Whittemore SR . Isolation of cortical mouse oligodendrocyte precursor cells . J Neurosci Methods 2012 ; 209 : 219 – 26 ., 22743801 10.1016/j.jneumeth.2012.06.017 PMC3407963
17. Dutta D , Paidi RK , Raha S , Roy A , Chandra S , Pahan K . Treadmill exercise reduces alpha-synuclein spreading via PPARalpha . Cell Rep 2022 ; 40 : 111058 ., 35830804 10.1016/j.celrep.2022.111058 PMC9308946
18. Jana M , Dutta D , Poddar J , Pahan K . Activation of PPARalpha exhibits therapeutic efficacy in a mouse model of juvenile neuronal ceroid lipofuscinosis . J Neurosci 2023 ; 43 : 1814 – 29 ., 36697260 10.1523/JNEUROSCI.2447-21.2023 PMC10010460
19. Khasnavis S , Ghosh A , Roy A , Pahan K . Castration induces Parkinson disease pathologies in young male mice via inducible nitric-oxide synthase . J Biol Chem 2013 ; 288 : 20843 – 55 ., 23744073 10.1074/jbc.M112.443556 PMC3774356
20. Saha RN , Ghosh A , Palencia CA , Fung YK , Dudek SM , Pahan K . TNF-alpha preconditioning protects neurons via neuron-specific up-regulation of CREB-binding protein . J Immunol 2009 ; 183 : 2068 – 78 ., 19596989 10.4049/jimmunol.0801892 PMC2724010
21. Chakrabarti S , Gorai S , Pahan K . A simple protocol for isolating microglia from adult mouse brain . NeuroImmune Pharm Ther 2023 ; 2 : 293 – 300 ., 37885917 10.1515/nipt-2023-0014 PMC10474378
22. Gottschalk CG , Jana M , Roy A , Patel DR , Pahan K . Gemfibrozil protects dopaminergic neurons in a mouse model of Parkinson’s disease via PPARalpha-dependent astrocytic GDNF pathway . J Neurosci 2021 ; 41 : 2287 – 300 ., 33514677 10.1523/JNEUROSCI.3018-19.2021 PMC8018777
23. Raha S , Ghosh A , Dutta D , Patel DR , Pahan K . Activation of PPARalpha enhances astroglial uptake and degradation of beta-amyloid . Sci Signal 2021 ; 14 :eabg4747., 10.1126/scisignal.abg4747 PMC8793854 34699252
24. Paidi RK , Raha S , Roy A , Pahan K . Muscle-building supplement beta-hydroxy beta-methylbutyrate binds to PPARalpha to improve hippocampal functions in mice . Cell Rep 2023 ; 42 : 112717 37437568 10.1016/j.celrep.2023.112717 PMC10440158
25. Raha S , Paidi RK , Dutta D , Pahan K . Cinnamic acid, a natural plant compound, exhibits neuroprotection in a mouse model of sandhoff disease via PPARalpha . NeuroImmune Pharm Ther 2024 ; 3 : 17 – 32 . 38532783 10.1515/nipt-2023-0027 PMC10961485
26. Chandra G , Roy A , Rangasamy SB , Pahan K . Induction of adaptive immunity leads to nigrostriatal disease progression in MPTP mouse model of Parkinson’s disease . J Immunol 2017 ; 198 : 4312 – 26 . 28446566 10.4049/jimmunol.1700149 PMC5467696
27. Kundu M , Raha S , Roy A , Pahan K . Regression of triple-negative breast cancer in a patient-derived xenograft mouse model by monoclonal antibodies against IL-12 p40 monomer . Cells 2022 ; 11 . 10.3390/cells11020259 . PMC8773899 35053375
28. Roy A , Jana M , Kundu M , Corbett GT , Rangaswamy SB , Mishra RK , HMG-CoA reductase inhibitors bind to PPARalpha to upregulate neurotrophin expression in the brain and improve memory in mice . Cell Metab 2015 ; 22 : 253 – 65 . 26118928 10.1016/j.cmet.2015.05.022 PMC4526399
29. Corbett GT , Gonzalez FJ , Pahan K . Activation of peroxisome proliferator-activated receptor alpha stimulates ADAM10-mediated proteolysis of APP . Proc Natl Acad Sci USA 2015 ; 112 : 8445 – 50 26080426 10.1073/pnas.1504890112 PMC4500265
30. Rangasamy SB , Corbett GT , Roy A , Modi KK , Bennett DA , Mufson EJ , Intranasal delivery of NEMO-binding domain peptide prevents memory loss in a mouse model of Alzheimer’s disease . J Alzheimers Dis 2015 ; 47 : 385 – 402 . 26401561 10.3233/JAD-150040 PMC4582676
31. Figarella-Branger D , Colin C , Baeza-Kallee N , Tchoghandjian A . A2B5 expression in central nervous system and gliomas . Int J Mol Sci 2022 ; 23 . 10.3390/ijms23094670 . PMC9103745 35563061
32. Ravichandar R , Gadelkarim F , Muthaiah R , Glynos N , Murlanova K , Rai NK , Dysregulated cholinergic signaling inhibits oligodendrocyte maturation following demyelination . J Neurosci 2024 ; 44 . 10.1523/jneurosci.0051-24.2024 . PMC11236584 38749703
33. Smith T . The capsules or sheaths of bacillus actinoides . J Exp Med 1921 ; 34 : 593 – 8 ., 19868580 10.1084/jem.34.6.593 PMC2128072
34. Sanders FK , Whitteridge D . Conduction velocity and myelin thickness in regenerating nerve fibres . J Physiol 1946 ; 105 : 152 – 74 ., 20999939
35. Friese MA , Schattling B , Fugger L . Mechanisms of neurodegeneration and axonal dysfunction in multiple sclerosis . Nat Rev Neurol 2014 ; 10 : 225 – 38 24638138 10.1038/nrneurol.2014.37
36. Jarius S , Wildemann B . The history of neuromyelitis optica . J Neuroinflammation 2019 ; 10 : 8 . 10.1186/1742-2094-10-8 PMC3599417 23320783
37. Richardson EP Jr . Progressive multifocal leukoencephalopathy . N Engl J Med 1961 ; 265 : 815 – 23 14038684 10.1056/NEJM196110262651701
38. Kondo Y , Adams JM , Vanier MT , Duncan ID . Macrophages counteract demyelination in a mouse model of globoid cell leukodystrophy . J Neurosci 2011 ; 31 : 3610 – 24 . 21389217 10.1523/JNEUROSCI.6344-10.2011 PMC3086602
39. Zhang W , Han Y , Huang H , Su Y , Ren H , Qi C , CD22 blockade exacerbates neuroinflammation in neuromyelitis optica spectrum disorder . J Neuroinflammation 2024 ; 21 : 313 ., 39616380 10.1186/s12974-024-03305-2 PMC11607829
40. Zhu J , Eichler F , Biffi A , Duncan CN , Williams DA , Majzoub JA . The changing face of adrenoleukodystrophy . Endocr Rev 2020 ; 41 : 577 – 93 32364223 10.1210/endrev/bnaa013 PMC7286618
41. Pahan K , Khan M , Singh I . Therapy for X-adrenoleukodystrophy: normalization of very long chain fatty acids and inhibition of induction of cytokines by cAMP . J Lipid Res 1998 ; 39 : 1091 – 100 . 9610777
42. Akassoglou K , Bauer J , Kassiotis G , Pasparakis M , Lassmann H , Kollias G , Oligodendrocyte apoptosis and primary demyelination induced by local TNF/p55TNF receptor signaling in the central nervous system of transgenic mice: models for multiple sclerosis with primary oligodendrogliopathy . Am J Pathol 1998 ; 153 : 801 – 13 9736029 10.1016/S0002-9440(10)65622-2 PMC1853008
43. Traka M , Podojil JR , McCarthy DP , Miller SD , Popko B . Oligodendrocyte death results in immune-mediated CNS demyelination . Nat Neurosci 2016 ; 19 : 65 – 74 26656646 10.1038/nn.4193 PMC4837900
44. Caprariello AV , Mangla S , Miller RH , Selkirk SM . Apoptosis of oligodendrocytes in the central nervous system results in rapid focal demyelination . Ann Neurol 2012 ; 72 : 395 – 405 23034912 10.1002/ana.23606 PMC3464960
45. Jana A , Hogan EL , Pahan K . Ceramide and neurodegeneration: susceptibility of neurons and oligodendrocytes to cell damage and death . J Neurol Sci 2009 ; 278 : 5 – 15 19147160 10.1016/j.jns.2008.12.010 PMC2660887
46. Singh I , Pahan K , Khan M , Singh AK . Cytokine-mediated induction of ceramide production is redox-sensitive. Implications to proinflammatory cytokine-mediated apoptosis in demyelinating diseases . J Biol Chem 1998 ; 273 : 20354 – 62 . 9685387 10.1074/jbc.273.32.20354
47. Jana M , Pahan K . Down-regulation of myelin gene expression in human oligodendrocytes by nitric oxide: implications for demyelination in multiple sclerosis . J Clin Cell Immunol 2013 ; 4 . 10.4172/2155-9899.1000157 . PMC3837467 24273691
48. Beiter RM , Rivet-Noor C , Merchak AR , Bai R , Johanson DM , Slogar E , Evidence for oligodendrocyte progenitor cell heterogeneity in the adult mouse brain . Sci Rep 2022 ; 12 : 12921 . 35902669 10.1038/s41598-022-17081-7 PMC9334628
49. Elbaz B , Popko B . Molecular control of oligodendrocyte development . Trends Neurosci 2019 ; 42 : 263 – 77 30770136 10.1016/j.tins.2019.01.002 PMC7397568
50. Kremer D , Aktas O , Hartung HP , Kury P . The complex world of oligodendroglial differentiation inhibitors . Ann Neurol 2011 ; 69 : 602 – 18 . 21520230 10.1002/ana.22415
51. Kremer D , Kury P , Dutta R . Promoting remyelination in multiple sclerosis: current drugs and future prospects . Mult Scler 2015 ; 21 : 541 – 9 . 25623245 10.1177/1352458514566419
52. Chong SY , Chan JR . Tapping into the glial reservoir: cells committed to remaining uncommitted . J Cell Biol 2010 ; 188 : 305 – 12 . 20142420 10.1083/jcb.200905111 PMC2819683
53. Boyd A , Zhang H , Williams A . Insufficient OPC migration into demyelinated lesions is a cause of poor remyelination in MS and mouse models . Acta Neuropathol 2013 ; 125 : 841 – 59 . 23595275 10.1007/s00401-013-1112-y PMC3661931
54. Chang A , Tourtellotte WW , Rudick R , Trapp BD . Premyelinating oligodendrocytes in chronic lesions of multiple sclerosis . N Engl J Med 2002 ; 346 : 165 – 73 11796850 10.1056/NEJMoa010994
55. Kuhlmann T , Miron V , Cui Q , Wegner C , Antel J , Bruck W . Differentiation block of oligodendroglial progenitor cells as a cause for remyelination failure in chronic multiple sclerosis . Brain 2008 ; 131 : 1749 – 58 . 18515322 10.1093/brain/awn096
56. Jana M , Palencia CA , Pahan K . Fibrillar amyloid-beta peptides activate microglia via TLR2: implications for Alzheimer’s disease . J Immunol 2008 ; 181 : 7254 – 62 . 18981147 10.4049/jimmunol.181.10.7254 PMC2701549
57. Attfield KE , Jensen LT , Kaufmann M , Friese MA , Fugger L . The immunology of multiple sclerosis . Nat Rev Immunol 2022 ; 22 : 734 – 50 35508809 10.1038/s41577-022-00718-z
58. Becher B , Derfuss T , Liblau R . Targeting cytokine networks in neuroinflammatory diseases . Nat Rev Drug Discov 2024 ; 23 : 862 – 79 . 39261632 10.1038/s41573-024-01026-y
59. Saha RN , Pahan K . Regulation of inducible nitric oxide synthase gene in glial cells . Antioxid Redox Signaling 2006 ; 8 : 929 – 47 10.1089/ars.2006.8.929 PMC1963415 16771683
60. Saha RN , Pahan K . Signals for the induction of nitric oxide synthase in astrocytes . Neurochem Int 2006 ; 49 : 154 – 63 . 16740341 10.1016/j.neuint.2006.04.007 PMC1963413
61. Klotz L , Antel J , Kuhlmann T . Inflammation in multiple sclerosis: consequences for remyelination and disease progression . Nat Rev Neurol 2023 ; 19 : 305 – 20 . 37059811 10.1038/s41582-023-00801-6
62. Bittner S , Pape K , Klotz L , Zipp F . Implications of immunometabolism for smouldering MS pathology and therapy . Nat Rev Neurol 2023 ; 19 : 477 – 88 . 37430070 10.1038/s41582-023-00839-6
63. Dasgupta S , Jana M , Zhou Y , Fung YK , Ghosh S , Pahan K . Antineuro-inflammatory effect of NF-kappaB essential modifier-binding domain peptides in the adoptive transfer model of experimental allergic encephalomyelitis . J Immunol 2004 ; 173 : 1344 – 54 15240729 10.4049/jimmunol.173.2.1344
64. Dong Y , Yong VW . When encephalitogenic T cells collaborate with microglia in multiple sclerosis . Nat Rev Neurol 2019 ; 15 : 704 – 17 31527807 10.1038/s41582-019-0253-6
65. Friis LM , Keelan M , Taylor DE . Campylobacter jejuni drives MyD88-independent interleukin-6 secretion via toll-like receptor 2 . Infect Immun 2009 ; 77 : 1553 – 60 . 19139198 10.1128/IAI.00707-08 PMC2663148
66. Gao Q , Qi L , Wu T , Wang J . Clostridium butyricum activates TLR2-mediated MyD88-independent signaling pathway in HT-29 cells . Mol Cell Biochem 2012 ; 361 : 31 – 7 21956671 10.1007/s11010-011-1084-y
67. Poon MM , Lorrain KI , Stebbins KJ , Edu GC , Broadhead AR , Lorenzana AJ , Targeting the muscarinic M1 receptor with a selective, brain-penetrant antagonist to promote remyelination in multiple sclerosis . Proc Natl Acad Sci USA 2024 ; 121 : e2407974121 . 39083422 10.1073/pnas.2407974121 PMC11317586
68. Biname F , Leguay K , Spenle C , Van Der Heyden M , Kent OA , Mancini J , Disruption of Plexin-A1 signaling by FTX-101: mode of action and effect on oligodendrocyte biology . Biomed Pharmacother 2025 ; 188 : 118186 . 40435840 10.1016/j.biopha.2025.118186