Introduction
Myelodysplastic neoplasms(MDS), formerly known as myelodysplastic syndromes, are clonal hematopoietic disorders marked by ineffective hematopoiesis, frequently resulting in cytopenias and heightened risk of progression to acute myeloid leukemia (AML) [ 1 ]. These disorders originate from hematopoietic stem cells and are characterized by diverse genetic and molecular abnormalities [ 2 ]. The classification and diagnostic criteria for MDS have evolved over time, with the World Health Organization (WHO) and the International Consensus Classification (ICC) providing updates that emphasize the role of cytogenetics and molecular genetics in diagnosis and risk stratification [ 3 , 4 ]. At present, the treatment of MDS faces many challenges. The existing targeted therapy and immunotherapy strategies are still in the early stage of clinical application, and many drugs are still being verified in clinical trials [ 5 ]. Further investigation into the molecular pathology of MDS is essential for developing more effective treatments and enhancing patient survival and quality of life [ 6 ].
ABI2, or Abscisic Acid Insensitive 2, is a type 2 C protein phosphatase that plays a crucial role in various signaling pathways in cells [ 7 , 8 ]. In recent years, the role and mechanism of ABI2 in various tumors have attracted extensive attention [ 9 ]. Numerous previous studies have indicated that ABI2 potentially exhibits antitumor properties by modulating cell metabolism, inhibiting angiogenesis, affecting immune interactions, and regulating various signaling pathways, including the suppression of tumor cell proliferation and the promotion of tumor cell apoptosis [ 10 – 13 ].
Compounds such as arsenic trioxide (As 2 O 3 ) and arsenic disulfide (As 2 S 2 ) have been widely studied in the treatment of various cancers [ 14 ]. Both As 2 O 3 and As 2 S 2 have been proven to be effective in acute promyelocytic leukemia (APL) [ 15 – 17 ]. Our previous studies showed that arsenic disulfide(As 2 S 2 ) played an important role in promoting apoptosis and erythroid differentiation of MDS [ 18 – 20 ]. This research aimed to assess the regulatory impact of As₂S₂ on ABI2 and its therapeutic potential in MDS.
Materials and Methods
Data Collection and Processing
We examined ABI2 expression profiles in patients with hematological tumors, such as acute lymphoblastic leukemia (ALL), myelodysplastic syndromes (MDS), acute myeloid leukemia (AML), multiple myeloma (MM), chronic myeloid leukemia (CML), chronic lymphoblastic leukemia (CLL), and Hodgkin’s lymphoma (HL), using data from the TCGA( https://portal.gdc.cancer.gov/ ) and TARGET( https://ocg.cancer.gov/programs/target ) databases. All downloaded data sets are processed by R language (version 4.1.2).
Analysis on the Difference of ABI2 Gene Expression
We use limma package of R language to deeply explore the expression of ABI2 gene, and accurately calculate the logFC value, p-value and adj.p-value of ABI2 gene. This analysis focuses on the significantly different p-values and adj.p values. Genes with an adjusted p-value < 0.05 were classified as differential genes based on stringent screening criteria. In order to visually present the expression differences of ABI2 gene, we carefully constructed the expression box plot of ABI2 by using the boxplot function of R language (version 4.1.2).
Prognostic Analysis of ABI2 Gene
To ensure a comprehensive and reliable analysis, we obtained an expression dataset with clinical survival data, encompassing both normal control and non-control data, to thoroughly assess the prognostic value of the ABI2 gene. In the process of analysis, we used cut-off method to divide the high and low levels of gene expression. By using Kaplan-Meier (KM) curve, a classical tool for survival analysis, we draw the survival curves of ABI2 gene in each data set, and intuitively show the survival differences of patients at different expression levels.
Cell Culture
The human cell lines SKM-1 (MDS), K562 (chronic myeloid leukemia), MEG-01 (megakaryoblastic leukemia), and HS-5 (bone marrow stromal) were obtained from Procell (China) and MDS-L (MDS) were obtained from NTCC. These cell lines verified through short tandem repeat identification. SKM-1 and MEG-01 cells were cultured in RPMI-1640 medium (Gibco, 11875093) with the addition of 10% fetal bovine serum (FBS) (Gibco, A5256701), 80 U/mL penicillin and 0.08 mg/mL streptomycin. K562 cells were cultured in IMDM (Gibco, 11995065) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 0.1 mg/ml streptomycin. HS-5 cells were cultured in DMEM (Gibco, 11965092) supplemented with 10% fetal bovine serum, 80 U/ml penicillin, and 0.08 mg/ml streptomycin. MDS-L cells were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum and 100 U/mL interleukin-3. Cells were maintained in a humidified incubator at 37 °C with 5% CO₂ and passaged upon reaching 80–90% confluence.
SiRNA Transfection
Small interfering RNA (siRNA) targeting ABI2-1(Catalog #4392420, siRNA ID s19769) was procured from Thermo Fisher Scientific. And siRNA targeting ABI2-2(GCGAGAACAACTACATACAGTCA) was procured from GenePharma(China). The transfection procedure was conducted utilizing the Lipo3000 transfection reagent (Gibco, L3000001).
As 2 S 2 Preparation
The As 2 S 2 preparation was carried out as described previously [ 20 , 21 ]. As 2 S 2 (Alfa Aesar, 12044-79-0) was dissolved in a 20% NaOH solution and subjected to overnight ultrasound treatment. The solution was then adjusted to pH 7.0.
Cell Viability Assay
Cell viability was evaluated using the Enhanced Cell Counting Kit-8 (CCK-8) (Beyotime, C0042) following the manufacturer’s guidelines. Cells were seeded in a 96-well plate at a density of 10 6 cells per well. Following treatment, the CCK8 reagent was added to the culture medium and incubated for 2 h. The optical density (OD) was measured at 450 nm in the dark using a microplate reader. The survival rate of experimental cells was assessed relative to control cells.
Apoptosis Assay
The treated cells were harvested, and 1 × 10⁶ cells were transferred into a centrifuge tube. Wash the cells with phosphate-buffered saline (PBS) and centrifuge at 1000×g for 5 min. Remove the supernatant and introduce 195 µL of Annexin V-FITC binding solution according to the apoptosis detection kit instructions (Biyotime, C1062L). Thoroughly resuspend the cells and gently mix in 5 µL of Annexin V-FITC. Subsequently, add 10 µL of propidium iodide staining solution and mix gently. Allow the mixture to stand at room temperature in the dark for 15 min. Following incubation, perform flow cytometry analysis promptly, ensuring that the analysis is completed within 1 h.
Western Blot Assay
Cells from each group were collected into centrifuge tubes and subjected to two washes with precooled PBS. Following centrifugation, the supernatant was discarded, and an appropriate volume of cell lysis buffer was added. Total protein was extracted by lysing the cells on ice, and its concentration was measured using the BCA protein assay kit (Biyotime, P0010). Protein solution was mixed with 5× protein loading buffer in a 4:1 ratio and denatured at 100 °C for 5 min in a metal bath. The samples were stored at −20 °C for later analysis. SDS-PAGE gels were prepared according to the instructions provided with the SDS-PAGE gel preparation kit. Electrophoresis, membrane transfer, and blocking were conducted using standard procedures. The membranes were incubated with primary antibodies overnight at 4 °C, then washed. The membranes were incubated with the secondary antibody at room temperature for an hour. After thorough washing, ECL was used for color development, and images were captured using a gel imager. Antibodies used in this study, such as ABI2, KLF4, MEOX2, NANOG, caspase-3, cleaved caspase-3, and BCL-2, were sourced from Cell Signaling Technology.
Mouse Administration
NUP98-HOXD13 (NHD13) mice were obtained from Jackson Laboratory and bred at the Animal Center of Shanghai Municipal Hospital of Traditional Chinese Medicine, affiliated with Shanghai University of Traditional Chinese Medicine. All animal procedures complied with the approved protocols and institutional guidelines of the Institutional Animal Care and Use Committee at Shanghai Municipal Hospital of Traditional Chinese Medicine (approval number 2024148).
Five five-month-old wild type (WT) mice were selected to serve as the negative control group. Ten five-month-old NHD13 mice were randomly assigned to two groups: a positive control group and an As 2 S 2 treatment group, each consisting of five mice. All mice were maintained under identical conditions. The As 2 S 2 treatment group received a daily dose of As 2 S 2 at 120 mg/kg, as specified in the literature, for a duration of 14 days [ 18 , 20 ].
Peripheral Blood Analysis
Blood samples (100 µL) were collected from the tail vein of each mouse both before and after administration. The peripheral blood parameters were subsequently assessed using a blood analyzer (Sysmex, Japan).
TUNEL Assay
The murine femurs were subjected to fixation and decalcification using EDTA, followed by paraffin embedding. The sections underwent dewaxing, hydration, antigen retrieval, and permeabilization. Subsequently, they were stained utilizing the TUNEL assay (Biyotime, C1091) for the detection of apoptotic cells and examined under a microscope (Olympus, Japan).
Immunohistochemistry (IHC)
Initially, the femur of mice was fixed using 4% paraformaldehyde, followed by decalcification with EDTA. The tissue was then embedded in paraffin and sectioned. The sections underwent dewaxing and hydration, followed by antigen retrieval and permeabilization treatments, and were incubated with a blocking solution. Subsequently, the sections were incubated with an anti-ABI2 (Thermo Fisher, PA5-64445) at 4 °C overnight. The following day, a secondary antibody was applied at room temperature for incubation. Color development utilized DAB, followed by hematoxylin counterstaining of the sections. After dehydration and clearing, the sections were mounted with neutral gum. The staining of the ABI-2 protein was then observed under a microscope.
Statistical Analysis
Data analyses were performed using GraphPad Prism version 10.2. A one-way ANOVA was used for comparisons among multiple groups, and an unpaired Student’s t-test was applied for comparisons between two groups. P-values < 0.05 were considered statistically significant.
Results
Elevated Expression Levels of ABI2 are Associated with Unfavorable Prognoses in Patients with Hematological Malignancies
We conducted an analysis of ABI2 mRNA expression levels in the peripheral blood of patients diagnosed with various hematological malignancies, including Hodgkin’s Lymphoma (HL), Multiple Myeloma (MM), Acute Myeloid Leukemia (AML), Myelodysplastic Syndromes (MDS), Acute Lymphoblastic Leukemia (ALL), Chronic Myeloid Leukemia (CML), and Chronic Lymphocytic Leukemia (CLL). Our findings indicate that ABI2 mRNA is highly expressed in the peripheral blood of patients with HL, AML, MDS, and CLL ( P < 0.05)(Fig. 1 A).
Fig. 1 The elevated expression of ABI2 in hematological malignancies and its association with unfavorable prognosis. A The analysis of ABI2 mRNA expression levels in the peripheral blood of patients with hematological malignancies revealed significantly higher expression in individuals diagnosed with Hodgkin’s Lymphoma (HL), Acute Myeloid Leukemia (AML), Myelodysplastic Syndromes (MDS), and Chronic Lymphocytic Leukemia (CLL) ( P < 0.05). B Kaplan-Meier survival analysis demonstrated a significant correlation between elevated ABI2 expression and reduced survival times in patients with AML ( P = 0.028, TARGET dataset P = 0.013) and Acute Lymphoblastic Leukemia (ALL) ( P = 0.014)
Additionally, we conducted an analysis of the correlation between ABI2 expression and patient survival duration in cases of hematological malignancies. The findings indicated that elevated ABI2 expression was significantly associated with a reduction in survival time among patients with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) ( P < 0.05) (Fig. 1 B).
ABI2 Influences the Survival and Proliferation of MDS and Leukemia Cells
We conducted a comparative analysis of the endogenous expression levels of ABI2 in normal hematopoietic stromal cells (HS-5), MDS cell lines(MDS-L and SKM-1) and leukemia cell lines (Meg-01 and K562), and the expression of ABI2 protein in SKM-1, K562 and MDS-L was relatively higher (Fig. 2 A). Subsequently, SKM-1, K562 and MDS-L cells were transfected with “small interfering RNA targeting ABI2 (siRNA- ABI2-1 and siRNA- ABI2-2)” and “non-targeting control small interfering RNA (siRNA-NC)”, respectively(Fig. 2 B). The findings demonstrated a time-dependent decrease in the viability of SKM-1, K562 and MDS-L cells following ABI2 interference ( P < 0.05), suggesting that ABI2 may facilitate the survival of leukemia cells. Furthermore, the interference with ABI2 was observed to inhibit cellular proliferation ( P < 0.05) (Fig. 2 C). Meanwhile, the interference with ABI2 won’t to inhibit the HS-5’s cellular proliferation ( P > 0.05) (Fig. S1). Then, we chose siRNA-ABI2-1 for further experiments. Apoptosis rate detection revealed a significantly higher percentage of apoptotic cells in the siRNA-ABl2 group compared to the siRNA-NC group, suggesting increased cell apoptosis following ABl2 inhibition( P < 0.05) (Fig. 2 D). Additionally, we analyzed the expression levels of proteins associated with stem cell characteristics (KLF4, MEOX2, NANOG) as well as those related to the apoptotic pathway (Caspase-3, cleaved caspase-3, BCL-2). The results demonstrated that inhibition of ABI2 led to the down-regulation of KLF4, MEOX2, and NANOG expression. Concurrently, there was an upregulation of the apoptosis-promoting cleaved caspase-3 and a downregulation of the anti-apoptotic BCL-2 (Fig. 2 E). These findings suggest that ABI2 plays a critical role in maintaining the stemness of leukemia cells, and influences their survival and proliferation.
Fig. 2 Impact of ABI2 on MDS and Leukemia Cell Survival and Proliferation. A Endogenous Expression of ABI2 in Hematopoietic Stromal and Leukemia Cell Lines: The expression levels of ABI2 protein were significantly elevated in SKM-1, K562 and MDS-L cell lines compared to HS-5 and Meg-01 normal hematopoietic stromal cells. B The expression of ABI2 after the transfection of SKM-1, K562, and MDS-L cells with “small interfering RNA targeting ABI2 (siRNA-ABI2-1 and siRNA-ABI2-2)” and “non-targeting control small interfering RNA (siRNA-NC)”. C Influence of siRNA on ABI2-Mediated Cell Viability: Inhibition of ABI2 via siRNA led to a statistically significant, time-dependent reduction in cell viability ( P < 0.05). D Influence of siRNA on ABI2-Mediated Apoptosis: The apoptosis rates in SKM-1, K562 and MDS-L cells treated with siRNA targeting ABI2 were significantly higher than those in the siRNA negative control group ( P < 0.05). E Impact of ABI2 Interference on Stem Cell Markers and Apoptosis-Related Proteins: ABI2 inhibition resulted in the down-regulation of stem cell markers KLF4, MEOX2, and NANOG, as well as the anti-apoptotic protein BCL-2, while up-regulating the pro-apoptotic protein cleaved caspase-3
As 2 S 2 Influences the Survival and Proliferation of Leukemia Cells
We assessed the efficacy of As 2 S 2 on SKM-1 and K562. Our findings indicate that as the concentration of As 2 S 2 increased and the exposure duration was extended, there was a corresponding decrease in overall cell viability( P < 0.05) (Fig. 3 A). This suggests that As 2 S 2 inhibits the viability of these cell lines in a manner dependent on both concentration and time. The results of apoptosis rate analysis demonstrated a positive correlation between the concentration of As 2 S 2 and the apoptosis rate in SKM-1, K562 and MDS-L cells( P < 0.05) (Fig. 3 B). This finding indicates that As 2 S 2 effectively induces apoptosis in these cell lines, with higher concentrations resulting in a more pronounced apoptotic effect. As the concentration of As 2 S 2 increased, the expression levels of KLF4, MEOX2, and NANOG proteins were observed to decrease, whereas the expression of cleaved caspase-3 increased and BCL-2 decreased (Fig. 3 C). These findings suggest that As 2 S 2 influences the stemness, apoptosis, and viability of leukemia cells in a concentration-dependent manner.
Fig. 3 The concentration-dependent impact of As₂S₂ on the survival and apoptosis of SKM-1, K562 and MDS-L cells. A Effect on cell viability: The viability of SKM-1, K562 and MDS-L cells exhibited a significant decrease with increasing concentrations of As₂S₂ and over time ( P < 0.05). B Effect on apoptosis: The apoptosis rate of SKM-1, K562 and MDS-L cells significantly increased with higher concentrations of As₂S₂ ( P < 0.05). C Effect on stem cell markers and apoptotic proteins: As₂S₂ led to the down-regulation of KLF4, MEOX2, NANOG, and BCL-2, while up-regulating cleaved caspase-3, all in a concentration-dependent manner
As 2 S 2 Affects the Survival and Proliferation of Leukemia Cells Through ABI2
We investigated the impact of the combined treatment of siRNA-ABI2 and As 2 S 2 on the viability and proliferation of SKM-1, K562 and MDS-L cell lines. The findings indicated that tFollowing the inhibition of ABI2, As 2 S 2 did not exhibit a significant reduction in the activity of SKM-1 and K562 cells, nor did it markedly enhance the inhibition of cellular proliferation ( P > 0.05) (Fig. 4 A). Our findings indicate that the inhibition of ABI2 did not result in a significant increase in the apoptosis rate associated with As 2 S 2 ( P > 0.05) (Fig. 4 B). Moreover, our findings indicate that the inhibition of ABI2 did not result in a further down-regulation of KLF4, MEOX2, NANOG, and BCL-2 expression, nor did it lead to an additional increase in cleaved caspase-3 expression (Fig. 4 C).
Fig. 4 As₂S₂ influences the survival and apoptosis of leukemia cells via the ABI2 pathway. A Impact on cell viability: SKM-1, K562 and MDS-L cells were transfected with siRNA targeting ABI2 and subsequently treated with As₂S₂. Following the suppression of ABI2, As₂S₂ did not result in a further decrease in cell viability ( P > 0.05). B Impact on apoptosis: Upon inhibition of ABI2, As₂S₂ did not lead to a further increase in the apoptosis rate ( P > 0.05). C Impact on the expression of stem cell markers and apoptotic proteins: The inhibition of ABI2 resulted in As₂S₂ not further down-regulating the expression of KLF4, MEOX2, NANOG, and BCL-2, nor up-regulating cleaved caspase-3
Investigation of the Treatment Effects of As₂S₂ in the NHD13 Mice
Following a 14-day treatment regimen with As 2 S 2 (120 mg/kg/day), the levels of red blood cells (RBC), hemoglobin (HGB), and platelets (PLT) in the peripheral blood of NHD13 mice were elevated compared to those in the model group, indicating an improvement in anemia symptoms (Fig. 5 A). Apoptosis in the bone marrow of these mice was assessed using TUNEL staining, revealing a significantly higher proportion of apoptotic cells in the As₂S₂-treated group relative to the control group (Fig. 5 B). Furthermore, immunohistochemical analysis demonstrated a marked reduction in the expression of ABI2 protein in the bone marrow of As₂S₂-treated mice (Fig. 5 B), corroborating the in vitro experimental findings.
Fig. 5 Therapeutic effect of As₂S₂ in NHD13 mice. A Routine peripheral blood analysis revealed that the levels of red blood cells (RBC), hemoglobin (HGB), and platelets (PLT) were significantly elevated in the As₂S₂ treatment group compared to the model group ( P < 0.05). B TUNEL assay and ABI2 immunohistochemistry (IHC) were conducted on bone marrow cells. The As₂S₂ treatment group exhibited a significant increase in the proportion of apoptotic cells within the bone marrow, accompanied by a decrease in ABI2 protein expression
Molecular Docking and Binding Verification of As₂S₂ and ABI2
Our study indicated that realgar may exert therapeutic effects on myelodysplastic syndromes (MDS) through the regulation of ABI2. Furthermore, we explored whether ABI2 could be combined with As₂S₂. The result of cellular thermal shift assay (CETSA) demonstrated that the expression level of the ABI2 protein is elevated following As₂S₂ treatment in comparison to the control group, with this effect becoming more pronounced at higher temperatures. This observation suggested that arsenic enhances the thermal stability of ABI2.(Fig. 6 A). Additionally, we investigated the binding mode of As₂S₂ and ABI2. Molecular docking analysis indicated that As₂S₂ interacts with the Val20 and Val69 sites of ABI2, exhibiting a binding energy of −2.43 kcal/mol and forming hydrophobic bond interactions (Fig. 6 B and C).
Fig. 6 Molecular docking and binding validation of As₂S₂ with ABI2. A The Cellular Thermal Shift Assay (CETSA) demonstrated that treatment with As₂S₂ enhanced the thermal stability of ABI2. B and C Molecular docking analysis revealed that As₂S₂ interacts with the Val20 and Val69 sites of ABI2, exhibiting a binding energy of −2.43 kcal/mol and forming hydrophobic bond interactions
Discussion
The potential of ABI2 as a therapeutic target for MDS warrants further investigation. This study found that ABI2 was highly expressed in MDS patients and correlated with poor prognosis, suggesting that ABI2 may promote the progression of MDS. Prior research has demonstrated that ABI2 is capable of sustaining the properties of tumor stem cells through the regulation of the MEOX2/KLF4/NANOG axis [ 9 , 22 – 24 ]. However, the present study establishes that As₂S₂ can effectively down-regulate the expression of ABI2 and associated stem cell markers, thereby inhibiting the stemness of MDS cells. This discovery introduces a novel concept for the targeted therapy of MDS: targeting ABI2 has the dual potential to induce apoptosis and inhibit the self-renewal capacity of leukemia stem cells.
The mechanism of As₂S₂ involves the transition from molecular binding to the regulation of signaling pathways. Molecular docking and CETSA experiments have demonstrated that As₂S₂ directly interacts with the Val20 and Val69 sites of ABI2, resulting in a reduction in ABI2 protein stability. This destabilization subsequently activates the caspase-3 pathway and inhibits BCL-2. This mechanism differs from that of arsenic trioxide (As₂O₃) in the treatment of acute promyelocytic leukemia (APL). As₂O₃ contributes to the degradation of the PML-RARα fusion protein, as demonstrated in previous studies [ 16 , 25 – 27 ].
As₂S₂ possesses significant potential for clinical application and transformation. Arsenic disulfide (As₂S₂), the primary constituent of realgar, has demonstrated both safety and efficacy in the treatment of acute promyelocytic leukemia (APL) [ 15 ]. Our initial experimental findings indicate that realgar exhibits therapeutic efficacy without significant hepatorenal toxicity when administered at an appropriate dosage, suggesting its safety [ 18 , 19 ]. This study substantiates the antitumor therapeutic efficacy of As₂S₂ in MDS and underscores its potential for clinical application. Nonetheless, the study presents several limitations. Firstly, the findings are validated in only three cell lines (SKM-1, K562, MDS-L) and a single mouse model, necessitating further confirmation across a broader spectrum of MDS subtypes. Secondly, the impact of As₂S₂ on the bone marrow microenvironment has not been thoroughly investigated. Thirdly, the long-term safety profile of As₂S₂ requires additional evaluation. Future research should focus on analyzing the correlation between ABI2 expression and the therapeutic efficacy of As₂S₂ using clinical samples, as well as exploring its combined application with other targeted therapies, such as demethylating agents.
The treatment of myelodysplastic syndromes (MDS) continues to encounter challenges due to the absence of specific therapeutic targets. This study elucidates the pivotal role of ABI2 in MDS, thereby providing a theoretical foundation for the development of a dual therapeutic approach that combines “targeting apoptosis and inhibiting stem cell quiescence.” The multi-target properties of arsenic disulfide (As₂S₂), such as its simultaneous regulation of apoptosis and metabolism, may confer an advantage in overcoming drug resistance. Future investigations should further examine the selective effects of As₂S₂ on MDS hematopoietic stem and progenitor cells (HSPCs) to minimize its impact on normal hematopoiesis.
Conclusion
This study demonstrated that As₂S₂ induces apoptosis in MDS cells through direct binding to ABI2, down-regulation of stem cell markers, and activation of the caspase pathway. This finding elucidates the molecular mechanism of As₂S₂ and offers a novel therapeutic strategy targeting ABI2 for MDS, thereby laying the groundwork for advancing the clinical application of realgar-based drugs.
Supplementary Information
Supplementary Material 1: Fig.S1. The cell viability of HS-5 after interference with siRNA-ABI2
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Yuchen Tao, Ning Ding, Runfeng Ni and Shuyang Cai contributed equally to this work.
Authors’ Contributions
Yuchen Tao#, Ning Ding#, Runfeng Ni#, and Shuyang Cai# contributed equally to this work. They jointly designed the research framework, conducted experimental data collection, and participated in initial data analysis. Rui Jin and Yirong Chen contributed to sample preparation, experimental validation, and data curation. Jianye Ren assisted in statistical analysis and manuscript drafting.Hao Xu*, Qian Ba*, and Jiahui Lu* supervised the entire research project, provided conceptual guidance, and contributed to manuscript revision and finalization.
Funding
This work was supported by the National Natural Science Foundation of China (No.82474260; No.82405217), Shanghai Science Technology and Innovation Action Plan (No.21Y31920400; No.24YF2741500).
Data Availability
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Declarations
Ethics Approval and Consent to Participate
Not applicable.
Competing Interests
The authors declare no competing interests.
References
1. Cazzola M Myelodysplastic syndromes N Engl J Med 2020 383 1358 74 10.1056/NEJMra1904794 32997910 Cazzola M. Myelodysplastic syndromes. N Engl J Med. 2020;383:1358–74. 32997910 10.1056/NEJMra1904794
2. Hasserjian RP Germing U Malcovati L Diagnosis and classification of myelodysplastic syndromes Blood 2023 142 2247 57 10.1182/blood.2023020078 37774372 Hasserjian RP, Germing U, Malcovati L. Diagnosis and classification of myelodysplastic syndromes. Blood. 2023;142:2247–57. 37774372 10.1182/blood.2023020078
3. Khoury JD Solary E Abla O Akkari Y Alaggio R Apperley JF The 5th edition of the world health organization classification of haematolymphoid tumours: myeloid and histiocytic/dendritic neoplasms Leukemia 2022 36 1703 19 10.1038/s41375-022-01613-1 35732831 PMC9252913 Khoury JD, Solary E, Abla O, Akkari Y, Alaggio R, Apperley JF, et al. The 5th edition of the world health organization classification of haematolymphoid tumours: myeloid and histiocytic/dendritic neoplasms. Leukemia. 2022;36:1703–19. 35732831 10.1038/s41375-022-01613-1 PMC9252913
4. Hasserjian RP Orazi A Orfao A Rozman M Wang SA The international consensus classification of myelodysplastic syndromes and related entities Virchows Arch 2023 482 39 51 10.1007/s00428-022-03417-1 36287260 Hasserjian RP, Orazi A, Orfao A, Rozman M, Wang SA. The international consensus classification of myelodysplastic syndromes and related entities. Virchows Arch. 2023;482:39–51. 36287260 10.1007/s00428-022-03417-1
5. Bidikian A Bewersdorf JP Shallis RM Getz TM Stempel JM Kewan T Targeted therapies for myelodysplastic syndromes/neoplasms (MDS): current landscape and future directions Expert Rev Anticancer Ther 2024 24 1131 46 10.1080/14737140.2024.2414071 39367718 Bidikian A, Bewersdorf JP, Shallis RM, Getz TM, Stempel JM, Kewan T, et al. Targeted therapies for myelodysplastic syndromes/neoplasms (MDS): current landscape and future directions. Expert Rev Anticancer Ther. 2024;24:1131–46. 39367718 10.1080/14737140.2024.2414071
6. Shastri A Will B Steidl U Verma A Stem and progenitor cell alterations in myelodysplastic syndromes Blood 2017 129 1586 94 10.1182/blood-2016-10-696062 28159737 PMC5364336 Shastri A, Will B, Steidl U, Verma A. Stem and progenitor cell alterations in myelodysplastic syndromes. Blood. 2017;129:1586–94. 28159737 10.1182/blood-2016-10-696062 PMC5364336
7. Park S-Y Fung P Nishimura N Jensen DR Fujii H Zhao Y Abscisic acid inhibits type 2 C protein phosphatases via the PYR/PYL family of START proteins Science 2009 324 1068 71 10.1126/science.1173041 19407142 PMC2827199 Park S-Y, Fung P, Nishimura N, Jensen DR, Fujii H, Zhao Y, et al. Abscisic acid inhibits type 2 C protein phosphatases via the PYR/PYL family of START proteins. Science. 2009;324:1068–71. 19407142 10.1126/science.1173041 PMC2827199
8. Grill E Himmelbach A ABA signal transduction Curr Opin Plant Biol 1998 1 412 8 10.1016/S1369-5266(98)80265-3 10066625 Grill E, Himmelbach A. ABA signal transduction. Curr Opin Plant Biol. 1998;1:412–8. 10066625 10.1016/s1369-5266(98)80265-3
9. Chen J Li H Zhang B Xiong Z Jin Z Chen J Abi2-mediated MEOX2/KLF4-NANOG axis promotes liver cancer stem cell and drives tumour recurrence Liver Int 2022 42 2562 76 10.1111/liv.15412 36017822 PMC9825985 Chen J, Li H, Zhang B, Xiong Z, Jin Z, Chen J, et al. Abi2-mediated MEOX2/KLF4-NANOG axis promotes liver cancer stem cell and drives tumour recurrence. Liver Int. 2022;42:2562–76. 36017822 10.1111/liv.15412 PMC9825985
10. Hofmann I Baum A Hofmann MH Trapani F Reichel-Voda C Ehrensperger D Pharmacodynamic and antitumor activity of BI 836880, a dual vascular endothelial growth factor and angiopoietin 2 inhibitor, alone and combined with programmed cell death protein-1 inhibition J Pharmacol Exp Ther 2023 384 331 42 10.1124/jpet.122.001255 36241203 Hofmann I, Baum A, Hofmann MH, Trapani F, Reichel-Voda C, Ehrensperger D, et al. Pharmacodynamic and antitumor activity of BI 836880, a dual vascular endothelial growth factor and angiopoietin 2 inhibitor, alone and combined with programmed cell death protein-1 inhibition. J Pharmacol Exp Ther. 2023;384:331–42. 36241203 10.1124/jpet.122.001255
11. Li Y Wang H Zhang L BAI1 acts as a tumor suppressor in lung cancer A549 cells by inducing metabolic reprogramming via the SCD1/HMGCR module Oncogene 2020 39 28 5073 86 10.1093/carcin/bgaa036 32255478 Li Y, Wang H, Zhang L, et al. BAI1 acts as a tumor suppressor in lung cancer A549 cells by inducing metabolic reprogramming via the SCD1/HMGCR module. Oncogene. 2020;39(28):5073–86. 10.1093/carcin/bgaa036 32255478
12. Wang JB Wang MD Li EX Dong DF Advances and prospects of anginex as a promising anti-angiogenesis and anti-tumor agent Peptides 2012 38 457 62 10.1016/j.peptides.2012.09.007 22985857 Wang JB, Wang MD, Li EX, Dong DF. Advances and prospects of anginex as a promising anti-angiogenesis and anti-tumor agent. Peptides. 2012;38:457–62. 22985857 10.1016/j.peptides.2012.09.007
13. Boyman O Arenas-Ramirez N Development of a novel class of interleukin-2 immunotherapies for metastatic cancer Swiss Med Wkly 2019 149 w14697 10.4414/smw.2019.14697 30673115 Boyman O, Arenas-Ramirez N. Development of a novel class of interleukin-2 immunotherapies for metastatic cancer. Swiss Med Wkly. 2019;149:w14697. 30673115 10.4414/smw.2019.14697
14. Liu J-X Zhou G-B Chen S-J Chen Z Arsenic compounds: revived ancient remedies in the fight against human malignancies Curr Opin Chem Biol 2012 16 92 8 10.1016/j.cbpa.2012.01.015 22342767 Liu J-X, Zhou G-B, Chen S-J, Chen Z. Arsenic compounds: revived ancient remedies in the fight against human malignancies. Curr Opin Chem Biol. 2012;16:92–8. 22342767 10.1016/j.cbpa.2012.01.015
15. Zhu H-H Hu J Lo-Coco F Jin J The simpler, the better: oral arsenic for acute promyelocytic leukemia Blood 2019 134 597 605 10.1182/blood.2019000760 40208647 Zhu H-H, Hu J, Lo-Coco F, Jin J. The simpler, the better: oral arsenic for acute promyelocytic leukemia. Blood. 2019;134:597–605. 31113776 10.1182/blood.2019000760
16. Chen S-J Zhou G-B Zhang X-W Mao J-H de Thé H Chen Z From an old remedy to a magic bullet: molecular mechanisms underlying the therapeutic effects of arsenic in fighting leukemia Blood 2011 117 6425 37 10.1182/blood-2010-11-283598 21422471 PMC3123014 Chen S-J, Zhou G-B, Zhang X-W, Mao J-H, de Thé H, Chen Z. From an old remedy to a magic bullet: molecular mechanisms underlying the therapeutic effects of arsenic in fighting leukemia. Blood. 2011;117:6425–37. 21422471 10.1182/blood-2010-11-283598 PMC3123014
17. Wang L Zhou G-B Liu P Song J-H Liang Y Yan X-J Dissection of mechanisms of Chinese medicinal formula realgar-indigo naturalis as an effective treatment for promyelocytic leukemia Proc Natl Acad Sci U S A 2008 105 4826 31 10.1073/pnas.0712365105 18344322 PMC2290784 Wang L, Zhou G-B, Liu P, Song J-H, Liang Y, Yan X-J, et al. Dissection of mechanisms of Chinese medicinal formula realgar-indigo naturalis as an effective treatment for promyelocytic leukemia. Proc Natl Acad Sci U S A. 2008;105:4826–31. 18344322 10.1073/pnas.0712365105 PMC2290784
18. Tao Y Xue T Li X Guo R Wang Y Xu H Comparative analysis of immunological changes following Realgar and arsenic trioxide treatments in a murine model of myelodysplastic syndrome Immunopharmacol Immunotoxicol 2024 46 408 16 10.1080/08923973.2024.2344158 38816179 Tao Y, Xue T, Li X, Guo R, Wang Y, Xu H, et al. Comparative analysis of immunological changes following Realgar and arsenic trioxide treatments in a murine model of myelodysplastic syndrome. Immunopharmacol Immunotoxicol. 2024;46:408–16. 38816179 10.1080/08923973.2024.2344158
19. Xu H Hu K Wang Y Cai S Wu F Bao J Single-cell transcriptome sequencing reveals the mechanism of Realgar improvement on erythropoiesis in mice with myelodysplastic syndrome Cancer Cell Int 2025 25 135 10.1186/s12935-025-03768-0 40200265 PMC11978147 Xu H, Hu K, Wang Y, Cai S, Wu F, Bao J, et al. Single-cell transcriptome sequencing reveals the mechanism of Realgar improvement on erythropoiesis in mice with myelodysplastic syndrome. Cancer Cell Int. 2025;25:135. 40200265 10.1186/s12935-025-03768-0 PMC11978147
20. Xue T Tao Y Wu Z Yuan C Wang Y Xu H Realgar induces apoptosis by inhibiting glycolysis via regulating STAT3 in myelodysplastic syndrome J Ethnopharmacol 2025 341 119339 10.1016/j.jep.2025.119339 39788167 Xue T, Tao Y, Wu Z, Yuan C, Wang Y, Xu H, et al. Realgar induces apoptosis by inhibiting glycolysis via regulating STAT3 in myelodysplastic syndrome. J Ethnopharmacol. 2025;341:119339. 39788167 10.1016/j.jep.2025.119339
21. Xu M Ren J-Y Guo Y-C Xu B-X Zeng Q Hu Q Effects of arsenic disulfide on apoptosis, histone acetylation, toll like receptor 2 activation, and erythropoiesis in bone marrow mononuclear cells of myelodysplastic syndromes patients in vitro Leuk Res 2017 62 4 11 10.1016/j.leukres.2017.09.010 28963909 Xu M, Ren J-Y, Guo Y-C, Xu B-X, Zeng Q, Hu Q, et al. Effects of arsenic disulfide on apoptosis, histone acetylation, toll like receptor 2 activation, and erythropoiesis in bone marrow mononuclear cells of myelodysplastic syndromes patients in vitro . Leuk Res. 2017;62:4–11. 28963909 10.1016/j.leukres.2017.09.010
22. Kashyap V Rezende NC Scotland KB Shaffer SM Persson JL Gudas LJ Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs Stem Cells Dev 2009 18 1093 108 10.1089/scd.2009.0113 19480567 PMC3135180 Kashyap V, Rezende NC, Scotland KB, Shaffer SM, Persson JL, Gudas LJ, et al. Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev. 2009;18:1093–108. 19480567 10.1089/scd.2009.0113 PMC3135180
23. Saunders A Faiola F Wang J Concise review: pursuing self-renewal and pluripotency with the stem cell factor Nanog Stem Cells 2013 31 7 1227 36 10.1002/stem.1384 23653415 PMC3706551 Saunders A, Faiola F, Wang J. Concise review: pursuing self-renewal and pluripotency with the stem cell factor Nanog. Stem Cells. 2013;31(7):1227–36. 23653415 10.1002/stem.1384 PMC3706551
24. Yu P Nie Q Tang C Zhang L Nanog induced intermediate state in regulating stem cell differentiation and reprogramming BMC Syst Biol 2018 12 22 10.1186/s12918-018-0552-3 29486740 PMC6389130 Yu P, Nie Q, Tang C, Zhang L. Nanog induced intermediate state in regulating stem cell differentiation and reprogramming. BMC Syst Biol. 2018;12:22. 29486740 10.1186/s12918-018-0552-3 PMC6389130
25. Chen J Liu X Zhao Y Targeting HDAC3 to overcome the resistance to ATRA or arsenic in acute promyelocytic leukemia through ubiquitination and degradation of PML-RARα Blood Adv 2023 7 8 1745 58 10.1038/s41418-023-01139-8 PMC10154408 36894687 Chen J, Liu X, Zhao Y, et al. Targeting HDAC3 to overcome the resistance to ATRA or arsenic in acute promyelocytic leukemia through ubiquitination and degradation of PML-RARα. Blood Adv. 2023;7(8):1745–58. 10.1038/s41418-023-01139-8 PMC10154408 36894687
26. Testa U Pelosi E Function of PML-RARA in acute promyelocytic leukemia Adv Exp Med Biol 2024 1459 321 39 10.1007/978-3-031-62731-6_14 39017850 Testa U, Pelosi E. Function of PML-RARA in acute promyelocytic leukemia. Adv Exp Med Biol. 2024;1459:321–39. 39017850 10.1007/978-3-031-62731-6_14
27. Chang HR Munkhjargal A Kim M-J Park SY Jung E Ryu J-H The functional roles of PML nuclear bodies in genome maintenance Mutat Res 2018 809 99 107 28521962 10.1016/j.mrfmmm.2017.05.002 Chang HR, Munkhjargal A, Kim M-J, Park SY, Jung E, Ryu J-H, et al. The functional roles of PML nuclear bodies in genome maintenance. Mutat Res. 2018;809:99–107. 28521962 10.1016/j.mrfmmm.2017.05.002