1. Introduction
Multiple myeloma (MM) is a malignant plasma cell neoplasm for which considerable treatment progress has been made in recent years [ 1 , 2 , 3 ]. Nevertheless, despite significant improvements in quality of life and length of survival for many patients, these treatments remain non-curative [ 4 ]. Except for a few individualized therapeutic concepts [ 5 , 6 , 7 ] (e.g., for MM patients with BRAF V600E [ 5 ]), there are still no approved tumor genetics-based personalized therapies for MM. This may be mostly due to the marked genetic heterogeneity of this disease, which displays very few recurrent and druggable oncogenic lesions [ 8 , 9 , 10 ].
As in many oncologic diseases, the effectors of central growth and survival signals, such as RAS/MAPK and AKT signaling, are important in MM [ 11 , 12 , 13 , 14 , 15 , 16 ]. However, no clear correlation between the potential intrinsic activation of these effectors and the clinical course of the disease has been demonstrated so far, perhaps because of signal pathway redundancies. Receptor tyrosine kinases (RTKs), such as insulin-like growth factor 1 receptor (IGF1R), epidermal growth factor receptor (EGFR), fibroblast growth factor receptor 3 (FGFR3) and erb-b2 receptor tyrosine kinase 2 (ERBB2), which are intimately connected with growth, survival, differentiation and migration processes, may play an important role in this regard [ 17 , 18 , 19 ]. Genetic alterations of RTKs and of their effectors have been linked to tumor development in various cancers, and preclinical experiments as well as clinical studies have shown that patients with RTK mutations or aberrant RTK expression may benefit from treatment with RTK inhibitors [ 20 , 21 , 22 , 23 , 24 , 25 ].
We have previously described an accumulation of single nucleotide variants (SNVs) and patient-specific single nucleotide polymorphisms (SNPs) in RTK genes (including IGF1R as the most recurrently mutated RTK), detected in MM primary samples and human MM cell lines (HMCLs) [ 10 , 26 ]. Interestingly, the presence of these mutations was associated with a significantly worse prognosis [ 26 , 27 ].
Increased expression of IGF1R is mostly detectable in patients with high-risk MM and associated with a poor prognosis [ 28 ]. Additionally, increased expression of the IGF1R ligand IGF1 has been associated with progression from MGUS to MM, and IGF1 was shown to be an important autocrine and paracrine growth and survival factor for MM in vitro and in vivo [ 29 , 30 ].
Although IGF1R is supposed to be an important oncogene in MM and other malignant diseases [ 30 , 31 , 32 ] and promising findings were made in vitro [ 33 , 34 , 35 , 36 ], significant clinical responses to monotherapies with IGF1R inhibitors have not been achieved in patients [ 37 , 38 ]. This might be due to compensation mechanisms employing other growth factors, e.g., through the ability of IGF1R to form hybrid receptors [ 37 , 38 , 39 ]. On the other hand, the small-molecule dual pIGF1R/pINSR inhibitor linsitinib has recently been employed in combination with the first-generation proteasome inhibitor (PI) bortezomib and dexamethasone to achieve responses in PI-refractory MM patients [ 31 ]. However, because these effects did not correlate with IGF1R expression or the CD45 phenotype of MM cells [ 31 , 33 , 34 ], it remains unclear what characterizes cells sensitive to IGF1R inhibition, highlighting the lack of biological or biomarker-based information [ 31 ]. Moreover, it was shown that IGF1R expression and its activation were contributing to bortezomib resistance [ 40 ]. Understanding the potential functional impact of IGF1R mutations detected in MM on survival signaling, viability/proliferation and therapy is therefore desirable.
We initially used siRNA-mediated IGF1R downregulation and IGF1 stimulation in HMCLs (n = 7) to underline published findings [ 29 , 32 , 33 , 34 , 36 , 41 , 42 , 43 ] and studied the impact of IGF1R overexpression and mutant IGF1R on the RTK effectors and growth/survival markers AKT, MEK and ERK using four different stably transfected HMCLs grown under normal culturing conditions or in serum-starved medium. Moreover, we investigated the impact of CRISPR-Cas9-mediated IGF1R knockout on the proliferation in the IGF1R -mutant HMCL L-363 and the IGF1R wild-type (WT) HMCL U-266 and analyzed the response to IGF1R inhibition in seven HMCLs using linsitinib in combination with the second-generation PI carfilzomib, commonly used in relapsed refractory MM [ 44 ].
2. Materials and Methods
2.1. Cell Culture
The HMCLs L-363 (IGF1R D1146N ) (RRID:CVCL_1357) [ 10 , 26 ], JJN-3 (IGF1R WT ) (RRID:CVCL_2078), KMS-12-BM (IGF1R WT ) (RRID:CVCL_1334), U-266 (IGF1R WT ) (RRID:CVCL_J235) and AMO-1 (IGF1R WT ) (RRID:CVCL_1806) were purchased from the “Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH” (DSMZ, Braunschweig, Germany). MM.1S (IGF1R WT ) (RRID:CVCL_8792) was acquired from LGC Biolabs (Wesel, Germany) and KMS-11 (IGF1R WT ) (RRID:CVCL_2989) from the Japanese Collection of Research Bioresources (JCRB, Osaka, Japan). The cells were cultured in RPMI-1640 supplemented with 10% FBS, 2mM L-glutamine and 1mM sodium pyruvate at 37 °C and 5% CO 2 for a maximum of 3 months and regularly tested for mycoplasma using the VenorGEM One-Step kit (Minerva Biolabs, Berlin, Germany).
2.2. IGF1 Stimulation
Per condition, 3 × 10 6 cells were cultured in serum-reduced medium (culturing medium with 0.5% FBS) for 18 h, stimulated with 20 ng/mL IGF1 (Immunotools, Friesoythe, Germany) for 10 min, immediately cooled on ice and then pelleted for the extraction of lysates. Unstimulated cells served as the controls.
2.3. Pharmacologic Inhibitors
The dual pIGF1R/pINSR inhibitor linsitinib (OSI-906) (#S1091) (Selleck Chemicals, Houston, TX, USA) and the PI carfilzomib (#S2853) (Selleck Chemicals, Houston, TX, USA) were dissolved in H 2 O-free DMSO and stored as 10 mM stock solutions at −80 °C. The working solutions were always freshly prepared in cell culture medium.
2.4. siRNA Knockdown
siRNA-mediated knockdown was performed using IGF1R -specific stealth siRNA (HSS105253; Invitrogen, Darmstadt, Germany). AllStar scrambled RNA (scrRNA) (Qiagen, Hilden, Germany) served as the control. Prior to electroporation with a Gene Pulser II (Bio-Rad, Munich, Germany), the cells were grown in culturing medium with 15% FBS overnight. The next day, 6 × 10 6 cells per condition were washed with 1x PBS and resuspended in 200 µL fresh, unsupplemented RPMI-1640 medium containing either 2 µM IGF1R stealth siRNA or 2 µM scrRNA. Electroporations were performed with 2 mm cuvettes at 180 V (AMO-1, JJN-3 and L-363), 200 V (KMS-11, KMS-12-BM and MM.1S) or 230 V (U-266). Subsequently, the cell suspensions were immediately transferred to 500 µL unsupplemented RPMI-1640, kept at RT for 5 min and then transferred to 6-well plates with electroporation medium ((EP-medium) (culturing medium containing 15% FBS, 1x PenStrep)) and cultured at 37 °C. After 24 h, the living cells were separated from the debris by centrifugation at 800 rcf for 5 min and resuspension of the pellet in 2.5 mL EP-medium mixed with 750 µL OptiPrep (Progen, Heidelberg, Germany). The suspension was overlaid with 200 µL 1x PBS and centrifuged for 7 min at 2122 rcf. The layer of living cells was transferred from the medium/PBS interface to the EP-medium, spun down and plated in 6-well plates. The following day, the cells were pelleted and frozen for Western analyses.
2.5. CRISPR-Cas9 Screen
CRISPR-Cas9 experiments were performed using the Alt-R CRISPR-Cas9 System (IDT (Integrated DNA Technologies, Leuven, Belgium)) and guide RNAs targeting IGF1R (target-sequence exon 18 (RTK domain): GGACGAACTTATTGGCGTTG AGG; target-sequence exon 2: CCTGAGGAACATTACTC GGG) using the crRNA:tracrRNA duplex format [ 45 ]. First, the ribonucleoprotein (RNP) complex consisting of the crRNA:tracrRNA duplex and the Cas9 nuclease (IDT) was assembled and the RNP complex transfected into HMCL by electroporation (2 mm cuvettes, 190 V (L-363), 230 V (U-266)) or nucleofection (program X-005 for U-266, Amaxa nucleofector 2b (Lonza, Switzerland)). Single-cell clones were seeded and grown in 96-well plates in culturing medium supplemented with 2 ng/mL IL-6, 2 ng/mL VEGF-A and 100 U/mL TNF-α. Successful genome editing was confirmed by PCR and Sanger sequencing (primers listed in Table 1 ). Upon reaching sufficient cell numbers, the knockout clones were cultured in normal culturing medium no longer containing IL-6, VEGF-A and TNF-α.
2.6. Generation of IGF1R WT and IGF1R mut -Overexpressing HMCL Sublines
2.6.1. Mutagenesis PCR
An MM patient-derived IGF1R mutation (N1129S) [ 26 ] and the mutation intrinsic to L-363 cells (D1146N) [ 10 , 26 ] ( Table S1 ) were introduced into IGF1R-cDNA by PCR using specific mutagenesis primers ( Table S2 ), the Q5 DNA polymerase (New England Biolabs, Frankfurt, Germany (NEB)) and the plasmid pCR-XL-TOPO-IGF1R (Bioscience, Berlin, Germany) as the template [ 45 ]. Notably, both mutations are located within the conserved RTK domain and predicted to be “damaging” according to the polyphen score revealed by SeattleSeq annotation ( Table S1 ). DpnI digestion was performed to destroy the template. Finally, E. coli NEB10β cells were transformed with the newly amplified plasmids. The plasmid minipreps were sequenced to confirm the presence of the desired mutations.
2.6.2. Expression Cloning and Stable Transfection of HMCLs Using the Sleeping Beauty Transposon System
The mutant and WT IGF1R-cDNA were amplified from pCR-XL-TOPO-IGF1R-WT and pCR-XL-TOPO-IGF1R-mut plasmids and NotI and EcoRI restriction digestion sites introduced by PCR with Phusion High-Fidelity DNA polymerase (NEB, Frankfurt, Germany) (primers: Table S3 ). Subsequently, the PCR products and the expression vector pSF-CMV-Puro-COOH-GST were digested with NotI-HF and EcoRI-HF (NEB, Frankfurt, Germany) for 1 h at 37 °C and heat inactivated at 60 °C for 20 min. The vector and insert were ligated using the T4 ligase in a 1:3 (vector:insert) ratio and the ligated plasmids transformed into E. coli NEB10β. To confirm the successful integration of the insert, the isolated plasmids were digested using NotI-HF and EcoRI-HF for 1 h at 37 °C. The plasmids containing an insert were sequenced at Eurofins Scientific ( Table S4 ) [ 45 , 46 ].
Subsequently, pSF-IGF1R-WT, pSF-IGF1R-N1129S and pSF-IGF1R-D1146N were amplified using specifically designed flanking primers ( Table S3 ). The size-selected and gel-purified DNA was ligated with the NheI/NotI-digested vectors pT2-SVPuroCMV and pT2-SVPuroCAG (1:3). The E. coli NEB10β was then transformed with the ligated plasmids and plated on ampicillin + LB-agar plates for the clonal selection. The plasmid minipreparations were sequenced to verify the correct insertion and the absence of undesired mutations within the IGF1R variants ( Table S4 ) [ 45 ].
AMO-1, U-266, JJN-3 and the CRISPR-Cas9 IGF1R-knockout cell line L-363-B4 were transfected in 4 mm cuvettes by electroporation as previously published [ 47 ]. A total of 10 µg of IGF1R-expression vectors (i.e., pT2-SVPuroCAG-IGF1R-WT, pT2-SVPuroCAG-IGF1R-D1146N, pT2-SVPuroCAG-IGF1R-N1129S (AMO-1), pT2-SVPuroCMV-IGF1R-WT, pT2-SVPuroCMV-IGF1R-D1146N and pT2-SVPuroCMV-IGF1R-N1129S (L-363-B4, U-266 and JJN-3)), 2.5 µg expression vector for GFP (pmax-GFP) and 15 µg transposase expression vector (pCMV(CAT)T7-SB100-Transposase) were included in the respective electroporation mixtures. The transfection efficiency was assessed by flow cytometry using a BD FACSCanto II (BD Biosciences, Heidelberg, Germany). The electroporated cells were subjected to puromycin selection for 10 days (1 µg/mL (JJN-3, L-363 and U-266) and 1.5 µg/mL (AMO-1)). Successful overexpression was verified by comparing the IGF1R expression levels of the overexpression sublines with the EV-transfected sublines prior to any further analysis ( Figure S1 ).
2.7. SDS-PAGE and Immunoblotting
Preparation of the whole cell lysates, SDS-PAGE and immunoblotting were performed as previously described [ 46 ] (for antibodies see Table 2 ). The Western blot images were evaluated by visual inspection and, where technically possible, the intensities calculated using Fiji (“Gels” tool). The intensities calculated for each marker were always normalized to those of the corresponding GAPDH bands. For details, see the figure legends. See the Supplementary Methods for the uncropped blot figures.
2.8. Viability and Proliferation Assays
AlamarBlue assays: Were performed to analyze the viability of the HMCLs overexpressing IGF1R WT , IGF1R D1146N or IGF1R N1129S under normal culturing conditions.
15 × 10 3 cells/well were seeded in 96-well plates in quadruplicates and cultured overnight in 200 µL culture medium (for standard conditions). The following day, 20 µL AlamarBlue solution (and 20 ng/mL IGF1 for the stimulation experiments) was added to each well and the absorbance was measured at 570 nm and 600 nm after 24 h, 48 h and 72 h with a microtiter plate reader (FLUOstar Omega, BMG Labtech, Ortenberg, Germany). Quadruplicates of the medium alone and medium with AlamarBlue were used as the controls.
MTT assays: For the measurement of the metabolic activity/viability after treatment with linsitinib at distinct time points (24 h, 48 h, 72 h and 96 h), 8000 cells/100 µL (MM.1S, AMO-1, JJN-3, KMS-11 and L-363), 15,000 cells/100 µL (U-266) or 25,000 cells/100 µL (KMS-12-BM) were seeded in culture medium and 0.4 µM inhibitor or the adequate amount of DMSO (negative control) added stepwise at 0 h or after 24 h, 48 h and 72 h. Subsequently, 10 μL thiazolyl blue tetrazolium bromide was added to 100 µL cell suspension in the 96-well plates. After 4 h, 90 μL solubilization solution was added. Following overnight incubation, the absorbance of the reduced solubilized formazan was measured at 570 nm.
IGF1R-knockout clone proliferation assays: The L-363 (6 × 10 5 ) and U-266 cells (1 × 10 6 ) were seeded in T-25 cell culture flasks in 5 mL and 8 mL culture medium, respectively. Regarding L-363, the living cells were counted using a Neubauer counting chamber on days 3, 6, 8, 10 and 13. On day 3, 3 mL medium was added to the cell culture flask. The cells were split in a 1:4 ratio on day 6, 4 mL medium was added on day 8 and the culture was split again in a 1:3 ratio on day 10. The U-266 cells were counted on days 4, 7, 11, 14 and 17. On day 7, the culture was split in a 3:4 ratio and 2 mL medium was added on day 9, followed by a 1:2 split on day 11 and the addition of 2 mL medium on day 14.
2.9. Apoptosis and Survival Assay (Annexin-V/PI)
A total of 10,000–20,000 cells per well were seeded in 96-well plates and treated with either linsitinib, carfilzomib or both drugs for 3 days. Subsequently, the cells were collected, stained with annexin V-FITC and propidium iodide (PI) solution and measured according to a previously described flow cytometry protocol [ 47 ]. After an initial estimation of single-drug effects, the concentrations that would produce only minor effects were chosen for the complete combination experiments shown.
3. Results
3.1. Stimulation as Well as Attenuation of IGF1R Signaling Influence the Activation of IGF1R Effectors and the Proliferation Rate in HMCLs
All the HMCLs used in the current study expressed and activated IGF1R, with KMS-11 showing the highest and AMO-1 the lowest IGF1R levels ( Figure S2 ), and IGF1R deprivation affected the AKT and/or MEK-ERK signaling in all the HMCLs ( Figure S3 ), underlining previous findings [ 29 , 32 , 33 , 34 , 36 , 41 , 42 , 43 ].
Moreover, the proliferation was considerably reduced in the different CRISPR-Cas9 IGF1R -knockout clones ( Figures S4 and S5 ) of both the L-363 (IGF1R mut ) and U-266 (IGF1R WT ) cells ( Figure 1 A,B), confirming the role of IGF1R as an important survival and proliferation factor in MM.
3.2. IGF1R Overexpression Impacts the Activation of MEK/ERK and AKT
Because IGF1R depletion affected the RTK signaling (especially AKT activation) and proliferation in all the HMCLs investigated, we next studied the effects of IGF1R overexpression in three IGF1R WT HMCLs (AMO-1, U-266 and JJN-3) and one IGF1R mut HMCL (L-363) by Western blotting ( Figure 2 A). Due to the intrinsic occurrence of an IGF1R mutation, we used the IGF1R -knockout cell line L-363-B4 instead of the parental cell line L-363.
Overexpression of IGF1R WT resulted in the increased activation of AKT and/or MEK/ERK signaling in normal cell culture conditions in all the HMCLs (slight effects, especially in U-266) ( Figure 2 A,B) but had no effect on viability ( Figure S6 ).
3.3. Mutations Can Impact IGF1R Activation and/or Downstream Signaling
RTK mutations can be a decisive factor in tumor progression and targeted treatment approaches [ 20 , 23 , 48 , 49 , 50 ] and are associated with inferior survival in MM. Therefore, we investigated whether the L-363 mutation IGF1R D1146N or the MM patient-derived mutation IGF1R N1129S (for details, see Section 2 and Table S1 ) alter the activation of the classical RTK effectors.
Comparing the HMCLs overexpressing IGF1R D1146N with IGF1R WT , a significant reduction in pIGF1R Y1135 was observed in L-363-B4 under normal culturing conditions and in all four IGF1R overexpression HMCL models under serum reduction ( Figure 3 A and Figure 4 A–D). However, this inactivation did not translate to changes in the AKT and MEK/ERK signaling. Comparing IGF1R N1129S with IGF1R WT under standard culturing conditions, a slight but significantly higher MEK activation ( p = 0.028) and a higher activation of ERK was observed in L-363-B4-overexpressing IGF1R N1129S in three out of four independent experiments ( Figure 3 A). Moreover, there also seemed to be a tendency for higher AKT activation upon the expression of mutant IGF1R ( Figure 3 A).
Notably, similar observations were made when L363-B4 was kept in low-FBS (0.5%) culture ( Figure 4 A). However, the expression of mutant IGF1R did not impact the viability ( Figure S6 ). The effect of overexpression of mutant IGF1R on downstream effectors in the other HMCLs under normal culturing conditions and in serum-reduced medium was inconclusive ( Figure 3 B–D and Figure 4 B–D).
3.4. Linsitinib Affects AKT Signaling, Viability and Survival in All HMCLs
Treatment with linsitinib affected the viability of all the HMCLs except for U-266 in a dose- and time-dependent manner within a concentration range of 0.2–0.8 µM. Notably, the U-266 cells remained virtually unaffected after 48 h and their viability was only minimally reduced after 72 h and 96 h of treatment ( Figure 5 A and Figure S7 ). Because 0.2 µM linsitinib only had a moderate impact on the viability of the AMO-1, JJN-3 and L-363 cells, while the MM.1S cells appeared to be particularly sensitive with maximal drug effects already visible at 48 h, we chose a concentration of 0.4 µM for the subsequent experiments.
At 0.4 µM linsitinib, a clear reduction, although not complete extinction, of the pIGF1R and pAKT signals was observed for all seven HMCLs tested ( Figure 5 B). The annexin-V/PI staining ( Figure 6 ) showed that incubation with 0.4 µM linsitinib for 72 h significantly reduced the survival of the MM.1S (IGF1R WT ) and KMS-12-BM (IGF1R WT ) cells, while the survival of the other five HMCLs was clearly less affected (L-363 (IGF1R mut ), JJN-3 (IGF1R WT ) and KMS-11 (IGF1R WT )) or even unaffected (AMO-1 (IGF1R WT ) and U-266 (IGF1R WT )).
Increased PARP1 and caspase 9 cleavage following linsitinib treatment was only observed for MM.1S in the independent experiments ( Figure 5 B,C).
3.5. Combined Treatment with Linsitinib and Carfilzomib Is Effective in HMCL with and without IGF1R Mutations
Previous studies have concluded that single-agent treatments with IGF1R inhibitors (e.g., linsitinib) are not effective [ 37 , 38 , 39 ] and the intrinsic IGF1R mutation in L-363 did not correlate with an improved response of the L-363 cells to linsitinib alone compared to the IGF1R WT HMCLs ( Figure 6 ). A combination of linsitinib with the first-generation PI bortezomib has shown promising results in patients [ 31 ]; however, bortezomib was reported to be inhibited by IGF1R expression [ 40 ]. For this reason and given that HMCLs rather represent relapsed and refractory MM, we chose the second-generation PI carfilzomib, commonly used for relapsed and refractory MM [ 44 ], for our investigations.
Initially, the carfilzomib sensitivity of each HMCL was determined in order to identify concentrations with little efficacy (i.e., 10–40% cell death after 3 days) to allow for the assessment of the combination effects with linsitinib. As expected from the single-agent inhibition experiment, linsitinib did not add to the effect of carfilzomib in U-266 and AMO-1 ( Figure 6 ). Linsitinib in combination with carfilzomib had, however, a significantly stronger effect on survival in all the other HMCLs (KMS-12-BM, MM.1S, L-363, JJN-3 and KMS-11), which neither seemed to correlate with the level of IGF1R expression (see Figure S2 ) nor the presence of an IGF1R mutation ( Figure 6 ).
4. Discussion
Many cancers depend at least to some extent on oncogenic growth and survival signaling from RTKs. These are frequently affected by genetic alterations such as SNVs, although with greatly variable significance and prevalence between and within specific tumor types [ 21 , 22 , 23 , 24 , 25 , 42 , 48 , 51 ]. However, even under circumstances where only a rather small subgroup of patients might benefit from a particular anti-RTK therapy, such an approach can be warranted, if the responsive patient population can be confidently identified.
Our previous analysis of SNVs and rare patient-specific single nucleotide polymorphisms in MM patients demonstrated that IGF1R is one of the most frequently affected RTK genes and that RTK mutations are associated with inferior survival [ 26 , 27 ], supporting the role of IGF1R as a bad prognostic marker in MM [ 28 ]. Although previous publications have investigated the effects of IGF1 and IGF1R blockade on a molecular level in MM [ 29 , 32 , 33 , 34 , 36 , 41 , 42 , 43 ], this study is the first to investigate the functional consequences of IGF1R overexpression and the impact of IGF1R mutations. Given the high genetic heterogeneity of MM [ 8 , 10 , 52 ] and the potential of IGF1R for oncogenic activity through the formation of hybrid receptors as well as through activating mutations, we chose HMCLs that represent different molecular aspects with relevance to IGF1R signaling, such as intrinsic AKT activity, AKT dependence [ 16 , 53 ] and the mutation pattern [ 10 ]. Notably, we included the HMCL L-363, which carries an intrinsic IGF1R missense mutation (D1146N) [ 10 ].
Consistent with previous findings [ 29 , 32 , 33 , 34 , 36 , 41 , 42 , 43 ], the HMCLs investigated in the current study all responded to IGF1 stimulation, IGF1R-specific knockdown and pIGF1R/pINSR inhibition by linsitinib, with either increased or decreased levels of the survival marker pAKT. Of note, survival was hardly affected by the selective blockade of pIGF1R/pINSR using linsitinib in CD45 + HMCLs (e.g., U-266), confirming previous findings [ 33 , 34 ]. However, decreased proliferation was observed upon the CRISPR-Cas9 knockout of IGF1R in several single-cell clones of both the IGF1R -WT and CD45+ HMCL U-266 and the IGF1R -mutant HMCL L-363, supporting the observation that MM depends on IGF1R and that IGF1R is preferentially essential for MM compared to other neoplasias [ 42 ]. Although the reduction in proliferation did not seem to be dependent on the mutation status, it might still be interesting to test inhibitors that not “only” target pIGF1R but also IGF1R expression, especially in pIGF1R inhibition-resistant CD45 + MM [ 33 , 34 ].
In agreement with previous results [ 35 ], IGF1R expression did, however, not seem to be a suitable biomarker to discriminate between HMCLs responding to IGF1R inhibition in the current study. The sensitivity to linsitinib might thus be influenced by other parameters such as AKT activation levels or mutant KRAS, which were shown to be associated with the response to, for example, AKT inhibition [ 16 , 53 ]. This theory fits well with the behavior of MM.1S cells (KRAS mut , AKT-dependent) [ 16 , 46 ], which showed the strongest response with respect to metabolism and survival. However, there were notable exceptions, e.g., the fairly strong responses of the KMS-12-BM cells (KRAS WT , very low pAKT) and very little effect on the survival of AMO-1 cells (KRAS mut , low-to-moderate pAKT levels) [ 35 ].
Overexpression of IGF1R had the opposite effect on RTK signaling as IGF1R knockdown, though the effect seemed to be more moderate and did not result in increased viability. In comparison to the overexpression of IGF1R WT , overexpression of IGF1R N1129S led to a slightly increased activation of potential IGF1R effectors (MEK, ERK and/or AKT) in L-363-B4 cells under normal culturing conditions but also in serum-reduced medium. This suggests that IGF1R N1129S may be activated independently from external stimuli in this HMCL. However, the observed effects for mutant IGF1R were subtle in the L-363-B4 cells and rather inconclusive in the other three IGF1R-overexpressing HMCL models. Expression of mutant IGF1R in four different HMCL models also did not translate into increased viability. The slight and inconclusive effect of IGF1R mutations on survival signaling and the missing impact on viability might be due to the high number of mutations in important oncogenes within the HMCLs, including other RTKs and RTK effectors, which might compensate the effect of the IGF1R mutation (e.g., NRAS mutation in L-363 and BRAF mutation in U-266) [ 10 ]. Notably, the mutation IGF1R D1146N displayed a significant decrease in the phosphorylation of the residue Y1135—located in the activation loop of IGF1R—in all four IGF1R overexpression HMCL models under serum-reduced conditions. However, this inactivation did not translate to changes in AKT and MEK/ERK signaling. Interestingly, previous investigations demonstrated that phosphorylation of the IGF1R is necessary for its ubiquitination and proteasomal degradation [ 54 ]. At this point, it remains unclear if the IGF1R mutation D1146N in L363 has an impact on this mechanism or if the loss of IGF1R activation is compensated for by other upstream regulators.
Moreover, this study showed that a combination of linsitinib and the second-generation PI carfilzomib, which is commonly used in relapsed/refractory MM and which, to our knowledge, has not been investigated in functional or clinical studies in the context of IGF1R so far, was effective in six out of seven HMCLs. However, no clear correlation between the level of response and the IGF1R mutation status was found. This might indicate that, for MM patients potentially responsive to IGF1R blockade, a combination with carfilzomib might be suitable to achieve longer and/or deeper remissions.
Of note, it has been previously shown that increased IGF1R expression and the activation of its signaling system contribute to acquired bortezomib resistance in MM cell lines, which were progressively adapted to withstand high bortezomib concentrations [ 40 ]. IGF1R suppression re-sensitized such cells to bortezomib [ 40 ]. Although the mechanisms and temporal patterns of PI resistance may vary, not just for different chemical compounds but also between preclinical and clinical settings, it is still worth mentioning that we did not observe that the comparatively high IGF1R expression or activation levels of the MM.1S and KMS-12-BM cells implicated any resilience against carfilzomib. These cells were fully sensitive to treatment with carfilzomib, indicating its potential suitability for combination with linsitinib in MM patients, irrespective of the IGF1R expression level and the IGF1R mutation status.
5. Conclusions
Our studies in four HMCL models overexpressing WT and mutant IGF1R showed that IGF1R mutations can affect the phosphorylation status of IGF1R (D1146N) and slightly increase survival signaling (N1129S), although they did not impact viability of the affected cells. However, the combination treatment of linsitinib and carfilzomib effectively enhanced MM cell death in six out of seven HMCLs. Even though this effect was not correlated with the strength of IGF1R expression or with the IGF1R mutation status, it warrants further clinical testing.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cancers16112139/s1 , Figure S1: Verification of IGF1RWT and IGF1Rmut (D1146N and N1129S) overexpression in stably transfected AMO-1 (A), U-266 (B), JJN-3 (C) and L-363 B4 (D). GAPDH was detected on the same blot as IGF1R. EV: empty vector-transfected control; Figure S2: (A) Investigation of the expression and activation status of IGF1R under normal culturing conditions. Intensities revealed with the Fiji tool were calculated for each marker by normalizing it to those of the corresponding GAPDH bands. Data shown are mean of three independent experiments. (B) Expression and activation status of IGF1R and activation status of AKT, MEK and ERK before (serum-reduced (0.5% FBS)) and after stimulation with IGF1. Western blot shown is representative for three independent experiments; Figure S3: Investigation of the expression and activation status of potential IGF1R effectors by Western analysis in 7 HMCLs after siRNA-mediated IGF1R knockdown. (A) The blot shown is representative of three independent experiments. (B) In addition, the signal intensities as revealed by Western blot analyses in the siRNA knockdown experiments were calculated for all repetitions using Fiji (“Gels” tool) and depicted as a bar diagram. Intensities revealed with the Fiji tool were calculated for each marker by normalizing it to those of the corresponding GAPDH bands and the intensities of the siRNA-treated samples were subsequently normalized to those of the corresponding scrRNA-treated samples. Cells transfected with scrambled siRNA (scrRNA) served as negative controls. Knockdowns were performed in at least three independent experiments. Each data point represents one independent experiment. The signal intensities for pERK in KMS-12-BM were too low for calculation with Fiji (n.e.); Figure S4: Overview of L-363 CRISPR-Cas9 IGF1R-knockout clones. (A) Comparison of IGF1R sequence in IGF1R KO clones at the sgRNA target site (Exon 18 KO). Figure adapted from Ref. [ 45 ]. (B) Overview of IGF1R expression in all KO clones used for experiments (Exon 18 and Exon 2 KO clones). (C) Indirect immunofluorescence (IF). For IF, cells were stained with DAPI (CST (#4412); 1:1000). IGF1R [alphaR3] (Genetex mouse; 1:50) and goat/anti-mouse-Alexa-Fluor 647 (ThermoFisher (A32728), 1:400). Images were scanned using either a Zeiss Elyra S.1- structural imaging microscope (63× oil) and a S-CMOS-Camera: PCO Edge 5.5 or using a Leica SP2 confocal laser scanning microscope (40× oil). Analysis was performed using ZEN lite and Fiji; Figure S5: Overview of U-266 CRISPR-Cas9 IGF1R-knockout clones. (A) Comparison of IGF1R sequence in IGF1R KO clones at the sgRNA target site (Exon 18 KO). Figure adapted from Ref. [ 40 ]. (B) Overview of IGF1R expression in all KO clones used for experiments (Exon 18 and Exon 2 KO clones). B3 is a WT single-cell clone. (C) Indirect immunofluorescence (IF). For IF, cells were stained with DAPI (CST (#4412); 1:1000). IGF1R [alphaR3] (Genetex mouse; 1:50) and goat/anti-mouse-Alexa-Fluor 647 (ThermoFisher (A32728), 1:400). Images were scanned using a Zeiss Elyra S.1- structural imaging microscope (63× oil). Analysis was performed using ZEN lite and Fiji; Figure S6: Viability assay (AlamarBlue) of IGF1R-overexpressing cells under normal culturing conditions. Results were derived from three independent experiments (mean ± SEM); Figure S7: Treatment of MM cell lines with different concentrations of linsitinib and subsequent measurement of the effects on metabolism using an MTT assay after 72h incubation (mean ± SEM); Table S1: SeattleSeq annotation was used to annotate the IGF1R mutations D1146N and N1129S to the reference genome hg19. The bioinformatic predictors PhastCons and GERP predict the level of conservation and PolyPhen2 predicts structural changes; Table S2: Primers used for mutagenesis PCR; Table S3: Primers used for cloning of expression and donor vectors; Table S4: Primer used for Sanger sequencing of ligated plasmids.
Author Contributions
Conceptualization or design of the work: R.C.B., A.R., T.S. (Thorsten Stühmer) and E.L.; Data acquisition: S.C.H.-G., M.E., S.K., M.S., V.F., A.K., T.N., T.G., J.P., H.K., O.-J.B. and T.S. (Thorsten Stühmer); Data curation: S.C.H.-G., M.E., S.K., M.S., J.P., H.K., T.S. (Thorsten Stühmer) and E.L.; Analysis and interpretation of data: S.C.H.-G., M.E., S.K., M.S., V.F., H.R.-W., J.P., H.K., T.S. (Thorsten Stühmer) and E.L.; Investigation: S.C.H.-G., M.E., S.K., M.S., V.F., A.K., T.N., T.G., J.P., H.K., O.-J.B. and T.S. (Thorsten Stühmer); Methodology: S.C.H.-G., M.E., S.K., M.S., T.N., H.K. and T.S. (Thorsten Stühmer); Project administration: R.C.B., T.S. (Thorsten Stühmer) and E.L.; Resources: R.C.B., A.R. and E.L.; Supervision: R.C.B., T.S. (Thorsten Stühmer) and E.L.; Validation: S.C.H.-G., M.E., S.K., M.S., J.P., H.K., T.S. (Thorsten Stühmer) and E.L.; Visualization: S.C.H.-G., M.E., S.K., T.S. (Thorsten Stühmer) and E.L.; Funding acquisition: R.C.B. and E.L.; Writing—original draft: E.L.; Critical review and editing: S.C.H.-G., M.E., S.K., M.S., V.F., H.R.-W., A.K., T.N., T.G., J.P., H.K., T.S. (Torsten Steinbrunn), O.-J.B., R.C.B., A.R., T.S. (Thorsten Stühmer) and E.L. All authors approved of the final version to be published and agreed to be accountable for all aspects of this work in ensuring that questions related to the accuracy or integrity of any part of this work are appropriately investigated and resolved. S.C.H.-G. and M.E. are co-first authors and contributed equally to this work. E.L. and T.S. (Thorsten Stühmer) are co-senior authors and contributed equally to this work. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The raw data supporting the conclusions of this article will be made available by the authors on request.
Conflicts of Interest
The authors declare no conflicts of interest.
Abbreviations
References
1. Engelhardt M. Yong K. Bringhen S. Wasch R. Carfilzomib combination treatment as first-line therapy in multiple myeloma: Where do we go from the carthadex (ktd)-trial update? Haematologica 2019 104 2128 2131 10.3324/haematol.2019.228684 31666342 PMC6821633
2. Moreau P. Hulin C. Perrot A. Arnulf B. Belhadj K. Benboubker L. Bene M.C. Zweegman S. Caillon H. Caillot D. Maintenance with daratumumab or observation following treatment with bortezomib, thalidomide, and dexamethasone with or without daratumumab and autologous stem-cell transplant in patients with newly diagnosed multiple myeloma (cassiopeia): An open-label, randomised, phase 3 trial Lancet Oncol. 2021 22 1378 1390 34529931 10.1016/S1470-2045(21)00428-9
3. Rajkumar S.V. Multiple myeloma: 2022 update on diagnosis, risk stratification, and management Am. J. Hematol. 2022 97 1086 1107 10.1002/ajh.26590 35560063 PMC9387011
4. Mateos M.V. Nooka A.K. Larson S.M. Moving toward a cure for myeloma Am. Soc. Clin. Oncol. Educ. Book 2022 42 1 12 10.1200/EDBK_349603 35623025
5. Andrulis M. Lehners N. Capper D. Penzel R. Heining C. Huellein J. Zenz T. von Deimling A. Schirmacher P. Ho A.D. Targeting the braf v600e mutation in multiple myeloma Cancer Discov. 2013 3 862 869 10.1158/2159-8290.CD-13-0014 23612012
6. Giesen N. Chatterjee M. Scheid C. Poos A.M. Besemer B. Miah K. Benner A. Becker N. Moehler T. Metzler I. A phase 2 clinical trial of combined braf/mek inhibition for brafv600e-mutated multiple myeloma Blood 2023 141 1685 1690 10.1182/blood.2022017789 36608320
7. Kaufman J.L. Gasparetto C. Schjesvold F.H. Moreau P. Touzeau C. Facon T. Boise L.H. Jiang Y. Yang X. Dunbar F. Targeting bcl-2 with venetoclax and dexamethasone in patients with relapsed/refractory t(11;14) multiple myeloma Am. J. Hematol. 2021 96 418 427 10.1002/ajh.26083 33368455 PMC7986778
8. Chapman M.A. Lawrence M.S. Keats J.J. Cibulskis K. Sougnez C. Schinzel A.C. Harview C.L. Brunet J.P. Ahmann G.J. Adli M. Initial genome sequencing and analysis of multiple myeloma Nature 2011 471 467 472 10.1038/nature09837 21430775 PMC3560292
9. Kuehl W.M. Bergsagel P.L. Molecular pathogenesis of multiple myeloma and its premalignant precursor J. Clin. Invest. 2012 122 3456 3463 10.1172/JCI61188 23023717 PMC3461901
10. Leich E. Weissbach S. Klein H.U. Grieb T. Pischimarov J. Stühmer T. Chatterjee M. Steinbrunn T. Langer C. Eilers M. Multiple myeloma is affected by multiple and heterogeneous somatic mutations in adhesion- and receptor tyrosine kinase signaling molecules Blood Cancer J. 2013 3 e102 10.1038/bcj.2012.47 23396385 PMC3584721
11. Chng W.J. Gonzalez-Paz N. Price-Troska T. Jacobus S. Rajkumar S.V. Oken M.M. Kyle R.A. Henderson K.J. Van Wier S. Greipp P. Clinical and biological significance of ras mutations in multiple myeloma Leukemia 2008 22 2280 2284 10.1038/leu.2008.142 18528420 PMC3864109
12. Heuck C.J. Jethava Y. Khan R. van Rhee F. Zangari M. Chavan S. Robbins K. Miller S.E. Matin A. Mohan M. Inhibiting mek in mapk pathway-activated myeloma Leukemia 2016 30 976 980 10.1038/leu.2015.208 26228812 PMC4832073
13. Lionetti M. Barbieri M. Todoerti K. Agnelli L. Marzorati S. Fabris S. Ciceri G. Galletti S. Milesi G. Manzoni M. Molecular spectrum of braf, nras and kras gene mutations in plasma cell dyscrasias: Implication for mek-erk pathway activation Oncotarget 2015 6 24205 24217 10.18632/oncotarget.4434 26090869 PMC4695180
14. Steinbrunn T. Stühmer T. Gattenlohner S. Rosenwald A. Mottok A. Unzicker C. Einsele H. Chatterjee M. Bargou R.C. Mutated ras and constitutively activated akt delineate distinct oncogenic pathways, which independently contribute to multiple myeloma cell survival Blood 2011 117 1998 2004 10.1182/blood-2010-05-284422 21149634
15. Tu Y. Gardner A. Lichtenstein A. The phosphatidylinositol 3-kinase/akt kinase pathway in multiple myeloma plasma cells: Roles in cytokine-dependent survival and proliferative responses Cancer Res. 2000 60 6763 6770 11118064
16. Zollinger A. Stuhmer T. Chatterjee M. Gattenlohner S. Haralambieva E. Muller-Hermelink H.K. Andrulis M. Greiner A. Wesemeier C. Rath J.C. Combined functional and molecular analysis of tumor cell signaling defines 2 distinct myeloma subgroups: Akt-dependent and akt-independent multiple myeloma Blood 2008 112 3403 3411 10.1182/blood-2007-11-119362 18635812
17. Blume-Jensen P. Hunter T. Oncogenic kinase signalling Nature 2001 411 355 365 10.1038/35077225 11357143
18. Robinson D.R. Wu Y.M. Lin S.F. The protein tyrosine kinase family of the human genome Oncogene 2000 19 5548 5557 10.1038/sj.onc.1203957 11114734
19. Ullrich A. Schlessinger J. Signal transduction by receptors with tyrosine kinase activity Cell 1990 61 203 212 10.1016/0092-8674(90)90801-K 2158859
20. Lemmon M.A. Schlessinger J. Cell signaling by receptor tyrosine kinases Cell 2010 141 1117 1134 10.1016/j.cell.2010.06.011 20602996 PMC2914105
21. Nappi A. Berretta M. Romano C. Tafuto S. Cassata A. Casaretti R. Silvestro L. Divitiis C. Alessandrini L. Fiorica F. Metastatic colorectal cancer: Role of target therapies and future perspectives Curr. Cancer Drug Targets 2018 18 421 429 10.2174/1568009617666170209095143 28183254
22. Pao W. Girard N. New driver mutations in non-small-cell lung cancer Lancet Oncol. 2011 12 175 180 10.1016/S1470-2045(10)70087-5 21277552
23. Regad T. Targeting rtk signaling pathways in cancer Cancers 2015 7 1758 1784 10.3390/cancers7030860 26404379 PMC4586793
24. Tiacci E. Schiavoni G. Forconi F. Santi A. Trentin L. Ambrosetti A. Cecchini D. Sozzi E. Francia di Celle P. Di Bello C. Simple genetic diagnosis of hairy cell leukemia by sensitive detection of the braf-v600e mutation Blood 2012 119 192 195 10.1182/blood-2011-08-371179 22028477
25. Tiacci E. Trifonov V. Schiavoni G. Holmes A. Kern W. Martelli M.P. Pucciarini A. Bigerna B. Pacini R. Wells V.A. Braf mutations in hairy-cell leukemia N. Engl. J. Med. 2011 364 2305 2315 10.1056/NEJMoa1014209 21663470 PMC3689585
26. Keppler S. Weissbach S. Langer C. Knop S. Pischimarov J. Kull M. Stühmer T. Steinbrunn T. Bargou R. Einsele H. Rare snps in receptor tyrosine kinases are negative outcome predictors in multiple myeloma Oncotarget 2016 7 38762 38774 10.18632/oncotarget.9607 27246973 PMC5122427
27. Leich E. Schreder M. Pischimarov J. Stühmer T. Steinbrunn T. Rudelius M. Brunnert D. Chatterjee M. Langer C. Keppler S. Novel molecular subgroups within the context of receptor tyrosine kinase and adhesion signalling in multiple myeloma Blood Cancer J. 2021 11 51 10.1038/s41408-021-00442-2 33664224 PMC7933144
28. Chng W.J. Gualberto A. Fonseca R. Igf-1r is overexpressed in poor-prognostic subtypes of multiple myeloma Leukemia 2006 20 174 176 10.1038/sj.leu.2403997 16239907
29. Georgii-Hemming P. Wiklund H.J. Ljunggren O. Nilsson K. Insulin-like growth factor i is a growth and survival factor in human multiple myeloma cell lines Blood 1996 88 2250 2258 10.1182/blood.V88.6.2250.bloodjournal8862250 8822946
30. Jernberg-Wiklund H. Nilsson K. Targeting the igf-1r signaling and mechanisms for epigenetic gene silencing in human multiple myeloma Ups. J. Med. Sci. 2012 117 166 177 10.3109/03009734.2012.659293 22348393 PMC3339548
31. Khan S. LeBlanc R. Gyger M. White D. Kaufman J. Jazubowiak A. Gul E. Paul H. Le L.W. Lau A. A phase-1 trial of linsitinib (osi-906) in combination with bortezomib and dexamethasone for the treatment of relapsed/refractory multiple myeloma Leuk. Lymphoma 2021 62 1721 1729 10.1080/10428194.2021.1876864 33509009
32. Wang P. Mak V.C. Cheung L.W. Drugging igf-1r in cancer: New insights and emerging opportunities Genes Dis. 2023 10 199 211 10.1016/j.gendis.2022.03.002 37013053 PMC10066341
33. Descamps G. Pellat-Deceunynck C. Szpak Y. Bataille R. Robillard N. Amiot M. The magnitude of akt/phosphatidylinositol 3′-kinase proliferating signaling is related to cd45 expression in human myeloma cells J. Immunol. 2004 173 4953 4959 10.4049/jimmunol.173.8.4953 15470037
34. Descamps G. Wuilleme-Toumi S. Trichet V. Venot C. Debussche L. Hercend T. Collette M. Robillard N. Bataille R. Amiot M. Cd45neg but not cd45pos human myeloma cells are sensitive to the inhibition of igf-1 signaling by a murine anti-igf-1r monoclonal antibody, mave1642 J. Immunol. 2006 177 4218 4223 10.4049/jimmunol.177.6.4218 16951388
35. Liang S.B. Yang X.Z. Trieu Y. Li Z. Zive J. Leung-Hagesteijn C. Wei E. Zozulya S. Coss C.C. Dalton J.T. Molecular target characterization and antimyeloma activity of the novel, insulin-like growth factor 1 receptor inhibitor, gtx-134 Clin. Cancer Res. 2011 17 4693 4704 10.1158/1078-0432.CCR-10-3097 21632854
36. Mitsiades C.S. Mitsiades N.S. McMullan C.J. Poulaki V. Shringarpure R. Akiyama M. Hideshima T. Chauhan D. Joseph M. Libermann T.A. Inhibition of the insulin-like growth factor receptor-1 tyrosine kinase activity as a therapeutic strategy for multiple myeloma, other hematologic malignancies, and solid tumors Cancer Cell 2004 5 221 230 10.1016/S1535-6108(04)00050-9 15050914
37. Menu E. van Valckenborgh E. van Camp B. Vanderkerken K. The role of the insulin-like growth factor 1 receptor axis in multiple myeloma Arch. Physiol. Biochem. 2009 115 49 57 10.1080/13813450902736583 19234898
38. Moreau P. Attal M. Hulin C. Arnulf B. Belhadj K. Benboubker L. Bene M.C. Broijl A. Caillon H. Caillot D. Bortezomib, thalidomide, and dexamethasone with or without daratumumab before and after autologous stem-cell transplantation for newly diagnosed multiple myeloma (cassiopeia): A randomised, open-label, phase 3 study Lancet 2019 394 29 38 10.1016/S0140-6736(19)31240-1 31171419
39. Singh P. Alex J.M. Bast F. Insulin receptor (ir) and insulin-like growth factor receptor 1 (igf-1r) signaling systems: Novel treatment strategies for cancer Med. Oncol. 2014 31 805 10.1007/s12032-013-0805-3 24338270
40. Kuhn D.J. Berkova Z. Jones R.J. Woessner R. Bjorklund C.C. Ma W. Davis R.E. Lin P. Wang H. Madden T.L. Targeting the insulin-like growth factor-1 receptor to overcome bortezomib resistance in preclinical models of multiple myeloma Blood 2012 120 3260 3270 10.1182/blood-2011-10-386789 22932796 PMC3476538
41. Beauvais D.M. Jung O. Yang Y. Sanderson R.D. Rapraeger A.C. Syndecan-1 (cd138) suppresses apoptosis in multiple myeloma by activating igf1 receptor: Prevention by synstatinigf1r inhibits tumor growth Cancer Res. 2016 76 4981 4993 10.1158/0008-5472.CAN-16-0232 27364558 PMC5010496
42. de Matos Simoes R. Shirasaki R. Downey-Kopyscinski S.L. Matthews G.M. Barwick B.G. Gupta V.A. Dupere-Richer D. Yamano S. Hu Y. Sheffer M. Genome-scale functional genomics identify genes preferentially essential for multiple myeloma cells compared to other neoplasias Nat. Cancer 2023 4 754 773 10.1038/s43018-023-00550-x 37237081 PMC10918623
43. Ge N.L. Rudikoff S. Insulin-like growth factor i is a dual effector of multiple myeloma cell growth Blood 2000 96 2856 2861 10.1182/blood.V96.8.2856 11023522
44. Yee A.J. The role of carfilzomib in relapsed/refractory multiple myeloma Ther. Adv. Hematol. 2021 12 20406207211019612 10.1177/20406207211019612 34163580 PMC8191071
45. Keppler S. Characterization of novel mutations in receptor-tyrosine kinases in multiple myeloma Charakterisierung Neuer Mutationen in Rezeptor-Tyrosin Kinasen im Multiplen Myelom Universitätsbibliothek Würzburg Würzburg, Germany 2020
46. Weissbach S. Heredia-Guerrero S.C. Barnsteiner S. Grosshans L. Bodem J. Starz H. Langer C. Appenzeller S. Knop S. Steinbrunn T. Exon-4 mutations in kras affect mek/erk and pi3k/akt signaling in human multiple myeloma cell lines Cancers 2020 12 455 10.3390/cancers12020455 32079091 PMC7072554
47. Steinbrunn T. Chatterjee M. Bargou R.C. Stühmer T. Efficient transient transfection of human multiple myeloma cells by electroporation—An appraisal PLoS ONE 2014 9 e97443 10.1371/journal.pone.0097443 24901949 PMC4047019
48. Gouda M. Subbiah V. Precision oncology for braf-mutant cancers with braf and mek inhibitors: From melanoma to tissue-agnostic therapy ESMO Open 2023 8 100788 10.1016/j.esmoop.2023.100788 36842301 PMC9984800
49. Normanno N. Esposito Abate R. Lambiase M. Forgione L. Cardone C. Iannaccone A. Sacco A. Rachiglio A.M. Martinelli E. Rizzi D. Ras testing of liquid biopsy correlates with the outcome of metastatic colorectal cancer patients treated with first-line folfiri plus cetuximab in the capri-goim trial Ann. Oncol. 2018 29 112 118 10.1093/annonc/mdx417 28950295
50. Rossi D. Ciardullo C. Gaidano G. Genetic aberrations of signaling pathways in lymphomagenesis: Revelations from next generation sequencing studies Semin. Cancer Biol. 2013 23 422 430 10.1016/j.semcancer.2013.04.002 23665546
51. Paez J.G. Janne P.A. Lee J.C. Tracy S. Greulich H. Gabriel S. Herman P. Kaye F.J. Lindeman N. Boggon T.J. Egfr mutations in lung cancer: Correlation with clinical response to gefitinib therapy Science 2004 304 1497 1500 10.1126/science.1099314 15118125
52. Morgan G.J. Walker B.A. Davies F.E. The genetic architecture of multiple myeloma Nat. Rev. Cancer 2012 12 335 348 10.1038/nrc3257 22495321
53. Steinbrunn T. Stühmer T. Sayehli C. Chatterjee M. Einsele H. Bargou R.C. Combined targeting of mek/mapk and pi3k/akt signalling in multiple myeloma Br. J. Haematol. 2012 159 430 440 10.1111/bjh.12039 22985491
54. Sehat B. Andersson S. Vasilcanu R. Girnita L. Larsson O. Role of ubiquitination in igf-1 receptor signaling and degradation PLoS ONE 2007 2 e340 10.1371/journal.pone.0000340 17406664 PMC1838569