LncRNA NEAT1 restrains the malignant biological characteristics of acute myeloid leukemia via regulating CTCF/CXCR2 axis.

Introduction

Acute myeloid leukemia (AML), the most common non-solid hematological malignancy in adults, has adverse biological characteristics such as high heterogeneity, high malignancy and high invasion and metastasis [ 1 , 2 ]. Despite continuous innovation and progress in the treatment of AML, the prognosis of patients with AML is not optimistic, and AML is still the leading cause of hematological malignancy related death worldwide [ 3 , 4 ]. As a malignant proliferative disease group of myeloid primordial cells, AML is characterized by rapid onset, systemic spread and insensitivity to chemotherapy regimens, which makes it difficult to treat and easy to relapse in AML patients, resulting in a very low overall survival rate of patients [ 5 , 6 ]. Therefore, it is urgent and of great practical significance to reveal the pathogenesis of AML and explore more effective therapeutic targets.

Long non-coding RNAs (lncRNAs) are a group of RNAs that lack coding proteins and are more than 200 nucleotides in length [ 7 , 8 ]. The regulatory mechanism and biological activity of the abnormal expression of lncRNAs in hematological malignancies have been the focus of attention in the field of hematology [ 9 , 10 ]. Among them, Nuclear paraspeckle assembly transcript 1 (NEAT1), a structural scaffold that forms paracycle elements, has been identified as a nuclear restricted lncRNA. Nowadays, two isoforms of NEAT1, 3.7 kb NEAT1_1 (MENε) and 23 kb NEAT1_2 (MENβ), have been confirmed by the academic community [ 11 ]. Interestingly, the abnormal expression of NEAT1_1 in hematological malignancies has been gradually revealed, but its specific biological function and mechanism of action in AML have not been fully clarified.

CCCTC-binding factor (CTCF), a universally expressed zinc finger protein with conserved structure, has become a key regulator of cellular identity gene transcription [ 12 ]. One study suggests that the functional and regulatory mechanisms mediated by CTCF/cohesin proteins may play a critical role in the regulation of hematopoietic stem and progenitor cells (HSPCs) and AML leukemogenesis, potentially through their involvement in hematopoiesis-specific genomic topology [ 13 ]. It had also demonstrated that disruption of the CTCF boundary at the HOXA locus could enhance the therapeutic sensitivity of AML to BET inhibitors, indicating that alteration of the CTCF boundary at oncogene loci might offer a novel strategy for overcoming drug resistance and chemotherapy resistance in hematological malignancies [ 14 ]. Furthermore, epigenetic modifications could result in the loss of CTCF binding, accompanied by alterations in chromatin interactions involving key transcription factors, thereby impacting the hematopoietic regulatory network as a driver of mixed myeloid/lymphocytic leukemia [ 15 ]. However, the exact molecular mechanism by which CTCF is involved in specific functions in hematological malignancies (especially AML) remains elusive.

The CXCR family is an important member of the G protein-coupled receptor superfamily, CXCR binds to their specific CXC chemokine ligands (CXCLs) to complete the “receptor-ligand” interaction, playing a key role in inducing inflammatory chemotaxis and regulating the malignant biological features of tumor cells [ 16 ]. Although intensive research on the role of CXC motif chemokine receptor (CXCR) family in leukemogenesis have been made, little is known about the detailed mechanism of CXCR2. Interestingly, previous studies from our team [ 17 , 18 ] have confirmed that CXCR2 is up-regulated in AML and associated with poor prognosis, but its upstream regulatory molecules and mechanisms are still fascinating.

In this context, it raises a hypothesis that deletion of NEAT1 may promote the occurrence and development of AML, and enhancing the expression of NEAT1 will effectively curb the malignant biological characteristics of AML. Mechanistically, NEAT1 probably needs to regulate downstream target genes (such as CTCF and CXCR identified in this study) in order to exert corresponding anti-leukemia effects.

Materials and methods

Ethical approval

The protocol was in accord with the guidelines of Office for Human Research Protections (OHRP). In this study, bone marrow specimens and complete clinical data of newly-diagnosed AML patients from the First Affiliated Hospital of Gannan Medical University and Fujian Medical University Union Hospital from January 2020 to June 2023 were collected and included. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Gannan Medical University and Fujian Medical University Union Hospital (approval number: LLSC-2023247 and 2019KY092, respectively). All patients or their families gave informed consent to this study and signed informed consent, in accordance with the Declaration of Helsinki, and the study protocol was approved by the Ethics Committee of the hospital.

Research criteria for clinical AML patients

The AML patients included in this study were examined by laboratory inspection methods of cell morphology, immunology, molecular biology and cytogenetics, and were classified according to the French, American and British Collaborative Group (FAB) criteria. The diagnostic criteria were based on the 2016 World Health Organization (WHO) Classifcation of AML [ 19 ]. Bone marrow specimens from healthy donors were collected as healthy control group.

Specimens of AML patients and acquisition

All patients enrolled in the study underwent bone marrow puncture under sterile conditions, and 3 ~ 5 ml bone marrow was reserved by the anticoagulant tube. The bone marrow specimens were diluted with equal amount of PBS and gently mixed, then an equal volume of lymphocyte separation medium to 15 ml centrifuge tube was prepared. The diluted bone marrow was slowly superimposed on the human lymphocyte separation solution to form a clear boundary. After centrifugation at 2000 rpm/min for 20 min, the intermediate layer of flocculant was sucked into 1.5 ml EP tube, washed twice with PBS, centrifuged at 2000 rpm/min for 5 min, and the supernatant after centrifugation was discarded. The cells deposited at the bottom of the tube were leukemic primary cells. Then, 1 ml of TRIzol should be added and thoroughly mixed, and stored at -80 °C for subsequent RNA extraction.

Cell lines and culture

AML cell lines (HL60, THP-1, U937, KG-1a, NB4, Molm-13, K562) and human bone marrow hematopoietic stem cell line CD34 were respectively bought from the China Center for Typical Culture Collection (Wuhan, China) and American Type Culture Collection (ATCC, USA), then cultured in RPMI-1640 (Gibco, USA) in a humidifed incubator containing 5%CO 2 at 37 °C. Specially, the 10% FBS (Gibco, USA) and 1% penicillin-streptomycin mixture (Transgen, China) must be supplemented into the basic medium.

Cell transfection

Cell transfection was executed when the cell confluence reached about 70%, and AML cells were transfected with pcDNA3.1/NEAT1, shNEAT1, pcDNA3.1/CTCF, si-CTCF, and their negative controls (GenePharma, China) were transfected into the cells with Lipofectamine ® 3000 reagent (Invitrogen, USA) according to the manufacturer’s protocol.

RNA isolation and RT-qPCR

Total RNA extraction was used TRIzol reagent (Takara, Japan) according to the manufacturer’s instructions. First-strand cDNA was synthesized using the RevertAid First-Strand cDNA Synthesis kit (Thermo Fisher Scientific, USA). The ABI7500 RT-qPCR System (ABI, USA) and FastStart Universal SYBR Green Master kit (Roche, USA) were employed to investigate reverse transcription products using GAPDH as the internal control. The relative expression ratio was calculated using the 2 −ΔΔCt method. The primer sequences of genes are shown in Table 1 .

Table 1 Primer sequences for RT-qPCR Gene Primer sequence (5’→3’) Product size (bp) NEAT1 F: GTACTGGGAGGGATGAGGGT 115 R: AATTCCCCAAAGCCCCAGAG CTCF F: ACGCCAGTGTAGAAGTCAGC 100 R: GTGTCCCTGCTGGCATAACT CXCR2 F: TACTGGCCTGCATCAGTGTG 110 R: CAGACCCCAGATGCTGAGAC GAPDH F: TTCGTCATGGGTGTGAACCA 170 R: GTCTTCTGGGTGGCAGTGAT

Cell proliferation assay

The cell proliferation assay was conducted using the cell counting kit-8 (Dojindo, Japan) following the manufacturer’s instruction. Briefly, the transfected AML cells were seeded into a 96-well plate in triplicates at the density of 2 × 10 4 cells/well for 24 h, 48 h and 72 h. Cell proliferation was evaluated by incubating cells with 10 µl dye solution to each well and incubating it for 3 h. Absorbance at 450 nm (A 450 ) was measured using a microplate spectrophotometer.

Flow cytometry

Apoptosis rate of AML cells was measured at 48 h post-transfection. Harvested cells were resuspended with 100 µl pre-cooled 1×Annexin V Binding buffer, then added with 5 µl Annexin V-FITC staining solution and 5 µl PI staining solution, respectively, and incubated at 4 °C in the dark for 15 min. The cells were gently mixed with 400 µl of 1×Annexin V Binding buffer and placed at 4 °C away from light. The apoptosis rate was detected by the flow cytometer (BD, USA) within an hour.

Western blotting

The AML cells were lysed using RIPA protein extraction reagent (Roche, USA) supplemented with protease inhibitors and phosphatase inhibitors (Roche, USA), and quantified using a BCA protein Assay Kit (Beyotime, China). 80 µg of protein extraction was separated by 10% SDS-PAGE, transferred onto PVDF membranes (Millipore, USA) and incubated with the following antibodies at 4 °C on a shaking table overnight: CXCR2, CTCF, Survivin and c-myc (Abcam, USA), Bcl-2, Bax, Caspase-3, cleaved Caspase-3, PI3K, p-PI3K, AKT, p-AKT, and GAPDH (CST, USA). Thereafter, the membranes were incubated with secondary antibody (CST, USA) at room temperature for 2 h. Finally, protein bands were visualized using an ECL system (Thermo Fisher Scientific, USA). Band intensities were analysed with the ImageJ software (NIH, USA). The results were normalized to the expression of GAPDH.

RNA pull-down

The RNA pull-down assay was performed by Pierce™ Magnetic RNA-protein Pull-Down Assay Kit (Thermo Scientific, USA) following the manufacturer’s protocol. Briefly, the cells were lysed and incubated with the biotinylated probe and its control probe. Streptavidin-labeled magnetic beads were resuspended and incubated with the probes (50 pmol) at 4 °C overnight. Additionally, centrifugation was performed after incubation. After being centrifuged and the retrieved proteins were collected for mass spectrometry or Western blot.

RNA Immunoprecipitation (RIP)

The RIP assay was performed by Magna RIP ® RNA-binding protein immunoprecipitation kit (Sigma-Aldrich, USA) following the manufacturer’s protocol. The cell lysates were precleared with 20 µL protein A/G beads, and incubated with 20 µL protein A/G beads coated with indicated antibodies at 4 °C for 2 h. After extracted from the immunocomplexes, the precipitated RNAs were analyzed by qRT-PCR.

Chromatin Immunoprecipitation (ChIP)

The transfected AML cells were cross-linked with 4% formaldehyde for 15 min. Next, they were resuspended in lysis buffer for sonication. The chromatin lysates (containing 25 mg chromatin) were immunoprecipitated with 5 mg anti-CTCF (Abcam, USA) or anti-IgG antibody (Abcam, USA) and 20 mL of Protein-A/G-Sepharose beads (Beyotime, China). After this, the immunoprecipitated RNAs were extracted, purified, and finally analyzed by qRT-PCR.

CRISPR/Cas9

The CDS region of CXCR2 was searched in either NCBI or ENSEMBLE. Its genome structure was analyzed, the exon portion of CDS was defined, candidate exons to be knocked out were selected, and the knockout site was determined. Once the knockout site was identified, the sequences were input into the input box of the online sgRNA design software ( http://crispor.tefor.net ), followed by conducting design calculations to obtain the sgRNA sequences. The ones with fewer off-target effects were chosen as the targets for gene knockout. According to the primers designed for the target location of gRNA, gRNA materials and Cas9 protein were synthesized. The CXCR2 gene of the AML cells was knocked out through the electrotransfer method, and then single cells were isolated and cultured by ClonePlus™ technology for monocloning. After amplification and culture, positive monoclones of the CXCR2 knockout were obtained via PCR and sequencing.

Wright-Giemsa staining

The transfected AML cells were collected and washed twice with pre-cooled PBS and the supernant was discarded, adding an appropriate amount of PBS for re-suspension, the cell suspension of 10–20 µl was evenly applied on the slide with a diameter of about 2.5 cm. The slide was placed flat and then stained with Wright-Giemsa solution for 10 min after drying. After staining, the dyeing solution was gently rinsed with PBS. After air drying, the morphological changes of the cells were observed under the microscope and the images were taken.

Colony formation assay

The transfected AML cells were seeded in 6-well plates with 500 cells/well for 14 days. The culture medium was discarded, and the cells were washed twice with PBS. Next, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet at room temperature. Colonies of more than 50 cells were calculated manually. All AML cells used for the colony formation assay were stably transfected, and the microscope was used for counting the colony cells.

Transwell assay

The transfected AML cells were placed on top of 24-well Transwell chambers (Corning, USA). The cells were first resuspended in serum-free medium and plated in the upper chambers with Matrigel for the invasion assay or without Matrigel for the migration assay. The lower chamber was filled with complete medium of RPMI-1640. After 24 or 48 h, cells in the upper chambers were swiped slightly with a cotton swab and then fixed in methanol solution for 20 ~ 30 min. Crystal violet was next used to stain the membranes for 10 ~ 15 min. At last, the invading or migrated cells were observed and counted under the microscope.

Cignal reporter assay

To detect the activities of various signaling pathways involved in the pathogenesis of leukemia, the cignal reporter assay was performed by Cignal Reporter Assay Kit (Qiagen, Germany) following the manufacturer’s protocol. Due to the cignal reporter assay kit contains multiple copies of the basic promoter elements of the signaling pathway at the binding sites of specific transcription factors, the activities of different pathways could be detected. Using a ready-to-use transfection vector of the dual reporter gene system, the activity changes of each signaling pathway were determined by comparing the standardized luciferase activity of the treated and untreated transfection reporter genes. Renilla luciferase activity was tested as the positive control. The ready-to-use transfection vectors for several leukemia-related pathways conducted in our study are listed as follows: CCS-004 L (p53 pathway), CCS-014 L (Notch pathway), CCS-012 L (MYC pathway), CCS-001 L (C/EBP pathway), CCS-018 L (Wnt pathway), CCS-017 L (TGF-β pathway), CCS-013 L (NF-κB pathway), CCS-1022 L (PI3K/AKT pathway), CCS-011 L (MAPK/JNK pathway), and CCS-010 L (MAPK/ERK pathway).

TOP/FOP reporter assay

To determine the activation of signaling pathway, TOP/FOP flash assay (Addgene, USA) was performed following the manufacturer’s instructions. Briefly, one day before transfection, 5 × 10 5 cells/well were seeded into a 24-well plate, after the overnight incubation, the cells (90% confluence) were transiently co-transfected with 0.4 mg DNA of reporter constructs (TOP/FOP Flash) and control plasmid (pCMV-GLuc) using 1 mL Lipofectamine 2000 (Invitrogen, USA) in 50 mL RPMI1640 media (Invitrogen, USA). Thereafter, the transfected AML cells were stimulated with control unconditioned media or conditioned media for 24 h. Cells from the treated and control conditions were collected for dual luciferase assay according to manufacturer’s instructions. Each assay was performed in triplicate and the results of reporter activity presented as the relative TOP/FOP value.

Animals and in vivo xenograft tumor model

Mouse xenograft studies were approved by the Institutional Animal Care and Use Committee (IACUC), and the ethics approval number is LLSC2023247. Before the start of animal experiments, all NOD/SCID mice were housed under standard conditions (22–26 °C, 45–65% of humidity, a 12 h light/dark cycle), with free access to food and water for one week. This study strictly followed the rules of experimental animal ethics. The 4-week-old male NOD/SCID mice (Sibeifu Biotechnology, Beijing) were randomly assigned into different groups ( n = 5/group), subcutaneously injected with AML cells (1 × 10 6 ) to establish ectopic tumors. From the start of the animal experiment, tumor volumes ( V ) were measured every three days based on formula V = L × W 2 × 0.5, where L represents the largest tumor diameter and W represents the perpendicular tumor diameter. After 4 weeks, all mice were sacrificed by cervical dislocation under deep anesthesia (sodium pentobarbital), and the tumors, liver and spleen were photographed, weighed, and processed for paraffin sections or further experiments. To minimize subjective bias, our research team implemented blinding during the outcome assessment phase, ensuring that evaluators were unaware of the experimental group assignments of the mice, thereby reducing potential influence on the results. Furthermore, randomization was conducted using computer-generated random number tables or specialized randomization software to achieve balanced baseline characteristics - including body weight, age, and gender - across all mice groups.

Statistical analysis

SPSS 20.0 and GraphPad Prism 7 software were used for statistical analysis and plotting. Image J software was used for imaging and Flow Jo software was used for analysis of apoptosis. The power calculation was performed on the sample size and using G*Power software. The normal distribution of measurement data was expressed as x̄ ± SD , and the non-normal distribution was expressed as median. The mean value of measurement data was compared, and t -test was used for analysis between two groups, and one-way ANOVA was used for analysis between multiple groups. Spearman’s correlation coefficient was used for linear correlation analysis. Besides, correlation analysis, classification data were analyzed by Chi-square analysis, rank data by Spearman analysis, and normal distribution measurement data by Pearson analysis. P < 0.05 was regarded as the difference was statistically significant.

Results

NEAT1 deletion accelerates the malignant biological features of AML cells

We gathered bone marrow samples from 31 newly diagnosed AML patients, 23 relapsed AML patients, and 14 complete remission (CR) AML patients. Additionally, bone marrow samples from 19 healthy donors were collected as control. The baseline data of the participants in this study were shown in Table 2 . Correspondingly, RT-qPCR was employed to detect the expression of NEAT1. We discovered that the expression of NEAT1 was significantly low in newly diagnosed AML patients. The expression level was even lower in relapsed patients, but there was no marked difference in the expression level of AML patients who received standard chemotherapy and achieved CR when compared with healthy controls (Fig. 1 A). Subsequently, we selected 7 distinct AML cell lines (HL60, THP-1, U937, KG-1a, NB4, Molm-13, K562) to examine the expression of NEAT1. The outcomes indicated that nearly all AML cell lines showed low expression of NEAT1. Nevertheless, the relative expression levels of KG-1 and K562 cell lines were slightly lower than those of the control group, and NEAT1 was significantly lower in all the other AML cell lines (Fig. 1 B). We chose THP-1 and U937 for subsequent functional experiments. In order to provide more conclusive evidence for the biological function of NEAT1 in AML cells, we transfected pcDNA3.1/NEAT1 or sh/NEAT1 into AML cells separately. The overexpression or knockdown efficiency of NEAT1 was successfully verified (Fig. 1 C-D). Next, we conducted a series of functional experiments to assess whether NEAT1 influences the malignant biological characteristics of AML cells. The results demonstrated that after overexpression of NEAT1, the proliferation activity of AML cells was reduced, and the apoptosis level was increased (Fig. 1 E-F). However, knockdown of NEAT1 could exacerbate the malignant proliferation of AML cells and inhibit apoptosis (Fig. 1 G-H), and the above-mentioned malignant phenotype changes also led to alterations in the expression of apoptotic regulatory proteins (Fig. 1 I-J). In summary, NEAT1 is aberrantly low expressed in AML cells, and the deletion of NEAT1 promotes the malignant biological features of AML cells, while overexpression of NEAT1 impedes the malignant biological characteristics of AML cells and promotes programmed death.

Table 2 Comparison of clinical characteristics and demographics in AML groups and control group Parameters and items AML-ND group ( n = 31) AML-RL group ( n = 23) AML-CR group ( n = 14) Healthy control group ( n = 19) a P / @ P b P / $ P c P / & P P Age (years) n (%) 0.001 a < 0.001 b 0.034 c < 0.001 < 60 18 (58.06) 9 (39.13) 11 (78.57) 19 (100) ≥ 60 13 (41.94) 14 (60.87) 3 (21.43) 0 (0) Gender n (%) 0.566 a 0.663 b 0.947 c 0.749 Male 22 (70.97) 13 (56.52) 9 (64.29) 12 (63.16) Female 9 (29.03) 10 (43.48) 5 (35.71) 7 (36.84) Fever n (%) – < 0.001 @ 0.061 $ < 0.001 & < 0.001 Yes 24 (77.42) 5 (21.74) 0 (0) No 7 (22.58) 18 (78.26) 14 (100) Extramedullary infiltration n (%) – 0.141 @ 0.001 $ 0.016 & 0.004 Yes 10 (32.26) 12 (52.17) 0 (0) No 21 (67.74) 11 (47.83) 14 (100) Hemorrhagic tendency n (%) – 0.443 @ < 0.001 $ < 0.001 & < 0.001 Yes 17 (54.84) 15 (65.22) 0 (0) No 14 (45.16) 8 (34.78) 14 (100) ECOG status n (%) — 0.202 @ 0.050 $ 0.041 & 0.019 0 4 (12.90) 2 (8.70) 6 (42.86) 1 8 (25.81) 5 (21.74) 5 (35.71) 2 12 (38.71) 14 (60.87) 3 (21.43) 3 7 (22.58) 1 (4.35) 0 (0) 4 0 (0) 1 (4.35) 0 (0) ELN category n (%) – 0.087 @ < 0.001 $ 0.018 & 0.001 Favorable (Low risk) 7 (22.58) 2 (8.70) 9 (64.29) Intermediate (Medium risk) 13 (41.94) 6 (26.09) 4 (28.57) Adverse (High risk) 11 (35.48) 15 (65.22) 1 (7.14) Notes: (1) Abbreviation : AML = acute myeloid leukemia; AML-ND = newly diagnosed AML patients; AML-RL = relapsed AML patients; AML-CR = AML patients with complete remission; ECOG = Eastern Cooperative Oncology Group; ELN = European LeukemiaNet 2022. (2) Statistical identification : a P : comparison between the AML-ND and control group; b P : comparison between the AML-RL and control group; c P : comparison between the AML-CR and control group; @ P : comparison between the AML-ND and AML-RL group; $ P : comparison between the AML-RL and AML-CR group; & P : comparison between the AML-ND and AML-CR group

Fig. 1 NEAT1 deletion leads to malignant biological features of AML cells. ( A ) RT-qPCR revealed that NEAT1 expression was significantly lower in AML patients. ( B ) The RT-qPCR results indicated that almost all AML cell lines had low expression of NEAT1. ( C ) We transfected pcDNA3.1/NEAT1 into AML cells and successfully verified the overexpression efficiency of NEAT1. ( D ) We transfected sh/NEAT1 into AML cells and successfully verified the knockdown efficiency of NEAT1. ( E ) CCK-8 assay showed that the proliferation activity of AML cells decreased after overexpression of NEAT1. ( F ) Flow cytometry indicated that overexpression of NEAT1 facilitated the increase of the apoptosis level. ( G ) CCK-8 assay demonstrated that NEAT1 knockdown could intensify the malignant proliferation of AML cells. ( H ) Flow cytometry showed that apoptosis of AML cells could be suppressed after NEAT1 Knockdown. ( I-J ) Western blotting showed that overexpression or knockdown of NEAT1 could cause variations in the expression of apoptotic regulatory proteins. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001

Peculiar regulatory relationship between NEAT1, CTCF, and CXCR2 in AML

In our team’s previously published studies [ 17 , 18 ], it was confirmed that CXCR2 is aberrantly highly expressed in AML cell lines and bone marrow mononuclear cells of AML patients, and its indispensable role in the disease mechanism of AML has been elucidated. Subsequently, we identified binding sites between the CTCF protein and lncRNA NEAT1 through bioinformatics software (RNainter) and literature retrieval [ 20 , 21 ], bioinformatics analysis using the hTFtarget database revealed that CTCF could target and regulate CXCR2, so we hypothesized that CTCF was likely to be the bridging gene between NEAT1 and CXCR2. Then, in this study, we utilized qRT-PCR to detect the expressions of CTCF and CXCR2 in bone marrow samples of AML patients and healthy individuals. Then we discovered that the expressions of NEAT1 and CTCF, as well as NEAT1 and CXCR2, were negatively correlated in AML patients (Fig. 2 A-B), while the expressions of CTCF and CXCR2 were positively correlated in AML patients (Fig. 2 C). We conducted RNA pull-down assay and RIP assay to verify whether CTCF could directly bind NEAT1. The results indicated that NEAT1 might directly and specifically sponge CTCF, and it also proved that NEAT1 could interact with the CTCF protein (Fig. 2 D-E). Accordingly, to further explore whether there is an interaction between CTCF and CXCR2, ChIP detection was promptly performed. The target protein was set as CTCF, and the negative control protein was IgG. Compared with IgG, the CXCR2 promoter sequence bound to the CTCF protein was significantly higher. It indicates that CTCF might interact with the CXCR2 promoter (Fig. 2 F). In conclusion, in this part, we clarified the intricate relationship between NEAT1, CTCF, and CXCR2 in AML, which also laid a foundation for the subsequent investigation of the pathogenesis of AML.

Fig. 2 The peculiar regulatory relationship between NEAT1, CTCF, and CXCR2. ( A ) RT-qPCR analysis showed that the expression of NEAT1 and CTCF was negatively correlated in AML patients. ( B ) RT-qPCR results showed that the expression of NEAT1 and CXCR2 was negatively correlated in AML patients. ( C ) RT-qPCR analysis showed that the expression of CTCF and CXCR2 was positively correlated in AML patients. ( D ) RNA pull-down assay results showed the interaction between NEAT1 and CTCF in AML cells. ( E ) RIP assay results showed the enrichment of NEAT1 and CTCF in AML cells. ( F ) ChIP assay was used to verify the binding of CTCF with CXCR2 promoter. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001

Targeting CTCF abrogated malignant features caused by NEAT1 deletion

Based on previous experimental studies, we transfected AML cells with NC, NEAT1, NEAT1 + si-CTCF, or NEAT1 + pcDNA3.1/CTCF, and subsequently detected the expression of CTCF in the cells by qRT-PCR and Western blot. We were gratified to discover that overexpression of NEAT1 significantly suppressed CTCF expression; that is, both the NEAT1 group and the NEAT1 + si-CTCF group markedly down-regulated CTCF mRNA and protein levels. Conversely, overexpression of CTCF could partially restore the inhibition level of CTCF induced by NEAT1 (Fig. 3 A-B). Further, NEAT1 could negatively target and regulate CTCF. Additionally, astonishingly, knockdown of CTCF could also down-regulate the leukemia-promoting factor C-MYC (Fig. 3 B). This unexpected finding may indirectly suggest that CTCF may also be indirectly reflected as a driving factor in the pathogenesis of AML by regulating MYC, but the specific molecular mechanism in this process requires further exploration. To further investigate the intriguing question of whether targeting CTCF can reverse the malignant biological characteristics caused by NEAT1 deletion, we found that knockdown of CTCF further enhanced the effects of NEAT1 on the proliferative activity and colony-forming ability of AML cells (Fig. 3 C-D), and upregulation of CTCF could diminish the apoptosis effect induced by NEAT1 (Fig. 3 E). Moreover, Western blotting analysis demonstrated that up-regulation of CTCF restored the promotion of Cleaved caspase-3 and Bcl-2 levels induced by NEAT1, and reduced the expression of Bax to a certain extent (Fig. 3 F). Compared with the NEAT1 transfection group, NEAT1 + pcDNA3.1/CTCF co-transfection also had a reversible promoting effect on cell invasion and migration (Fig. 3 G-H). In conclusion, there is likely to be bidirectional regulation between CTCF and NEAT1 in AML cells. Targeted inhibition of CTCF could abrogate and eliminate the malignant phenotype resulting from NEAT1 deficiency, and thereby constrain the malignant biological characteristics of AML.

Fig. 3 Targeting CTCF abrogated the malignant biological characteristics caused by NEAT1 deletion. ( A ) RT-qPCR showed that overexpression of NEAT1 significantly inhibited the expression level of CTCF mRNA and protein. On the contrary, overexpression of CTCF could partially restore NEAT1-induced CTCF inhibition. ( B ) Western blotting results also showed that overexpression of NEAT1 significantly inhibited the expression level of CTCF, and overexpression of CTCF could partially restore the NEAT1-induced inhibition level of CTCF. In addition, knockdown of CTCF could also down-regulate leukemia promoting factor C-MYC. ( C ) knockdown of CTCF further promoted the proliferative activity of NEAT1 against AML cells. ( D ) knockdown of CTCF further promoted the effect of NEAT1 on the colony-forming ability of AML cells. ( E ) Upregulation of CTCF can reduce NEAT1-induced apoptosis. ( F ) Up-regulation of CTCF restored the promotion of Cleaved caspase-3 and Bcl-2 levels induced by NEAT1, and reduced the expression of Bax to a certain extent. ( G-H ) The assessment of AML cells invasion and migration was implemented via transwell assay. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001; compared with the NEAT1 group, & P < 0.05, $ P < 0.01

Knocking out CXCR2 leads to the down-regulation of CTCF and effectively reverses the malignant phenotype caused by the loss of NEAT1

Next, based on the previous results (ChIP) of this study and the bioinformatics tool (hTFtarget), we hypothesize that CTCF is likely to target and regulate CXCR2, that is, the CTCF/CXCR2 regulatory axis might be constituted to participate in the biological behaviors of AML cells. To this end, we employed the CRISPR CAS9 whole genome knockout tool to achieve a complete knockout of CXCR2 in THP-1 cells, which yielded satisfactory results (Fig. 4 A), and verified the reliability of this experiment through PCR and sequencing identification (Fig. 4 B-C). We designated this whole genome knockout cell as CXCR2/Cas9 (KO-CXCR2). Subsequently, we conducted functional experiments and discovered that following the knockout of CXCR2, the proliferation activity of AML cells decreased (Fig. 4 D), while apoptosis was intensified (Fig. 4 E), and surprisingly, the expression of CTCF was also down-regulated (Fig. 4 F). Conversely, to investigate the effect of CTCF on CXCR2 expression, CXCR2/Cas9 was further transfected with pcDNA3.1 or pcDNA3.1/CTCF. We found that the expression of the CTCF protein was up-regulated after the transfection of CTCF, and CXCR2 protein expression level recovered to a certain extent (Fig. 4 G). More importantly, the overexpression of CTCF on the basis of CXCR2/Cas9 restored the level of malignant proliferation inhibition caused by the knockout of CXCR2 (Fig. 4 H). To confirm the deeper regulatory relationship, we continued to add the CXCR2-specific inhibitor SB225002 on the basis of the CXCR2/Cas9. It was found that this step effectively inhibited the activation of the CTCF/CXCR2 regulatory axis (Fig. 4 I) and successfully restricted the effects of malignant proliferation and apoptosis inhibition induced by the NEAT1 deficiency (Fig. 4 J-K). In conclusion, the knockout of CXCR2 down-regulates CTCF and successfully reverses the malignant phenotype caused by the loss of NEAT1.

Fig. 4 CXCR2 knockout down-regulates CTCF and reverses the malignant phenotype caused by NEAT1 deletion. ( A ) Western blotting was employed to detect and verify the effect of CRISPR CAS9 genome-wide knockout of CXCR2. ( B ) PCR was adopted to verify the effect of CRISPR CAS9 genome-wide knockout of CXCR2. ( C ) Verification of the effect of CRISPR CAS9 on whole genome knockout of CXCR2 by sequencing identification. ( D ) Cell proliferation activity was detected by CCK-8 assay. ( E ) The effect of apoptosis was detected by flow cytometry. ( F ) The expression of CTCF was detected by Western blot. ( G ) Western blotting was used to determine the effect of overexpression of CTCF on CXCR2 protein expression. ( H ) The effect of overexpression of CTCF on malignant proliferation of leukemia cells was detected by CCK-8 assay. ( I ) The effect of antagonistic CXCR2 on CTCF expression was verified by Western blot assay. ( J ) The effect of antagonistic CXCR2 on malignant proliferation of leukemia cells was detected by CCK-8 assay. ( K ) The effect of antagonistic CXCR2 on apoptosis of leukemia cells was detected by flow cytometry. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001

Overexpression of CXCR2 maintains malignant phenotype induced by NEAT1 loss

As indicated by our team’s hitherto unpublished findings, CXCR2 has the potential to promote the malignant biological traits of AML cells. To delve deeper into the intriguing and challenging query of whether overexpression of CXCR2 on the human AML cell line could also restore and rescue the phenotype induced by NEAT1, we overexpressed CXCR2 on the human AML cell line, and the transfection efficiency was successfully verified (Fig. 5 A-B). Overexpression of CXCR2 could prevent severe cell morphological alterations and inhibit apoptosis (Fig. 5 C-D), as well as enhance the proliferation and survival of AML cells (Fig. 5 E). Furthermore, it could also rescue the malignant phenotype caused by NEAT1, potentially by up-regulating the expressions of survivin and Bcl-2, down-regulating the expressions of the pro-apoptotic protein Bax and suppressing the hydrolytic activation of Caspase-3, thereby manifesting the corresponding malignant biological characteristics (Fig. 5 F-G).

Fig. 5 Overexpression of CXCR2 maintains malignant phenotype induced by NEAT1 loss. ( A ) RT-qPCR was employed to detect and validate the overexpression of CXCR2. ( B ) Western blotting was utilized to detect and confirm the overexpression effect of CXCR2. ( C ) Wright-Giemsa stainning was used to detect morphological changes of AML cells in different transfection groups. ( D ) Flow cytometry was utilized to detect the apoptosis of leukemia cells. ( E ) The proliferative activity of leukemia cells was determined by the CCK-8 method. ( F-G ) Western blot assay was adopted to detect the expression levels of apoptosis and malignant regulatory molecular proteins. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001

NEAT1 loss activates PI3K/AKT signaling pathway by upregulating CXCR2

The tumorigenesis and maintenance of AML are frequently accompanied by the activation of abnormal signaling pathways. Based on the existing results of our study, the NEAT1/CTCF/CXCR2 regulatory axis was verified in AML, further prompting us to search for a more profound and intricate regulatory mechanism. Hence, in this section, luciferase reporter gene detection was carried out using the Cignal Reporter kit to detect the activity of various signaling pathways in AML cells transfected with KO-CXCR2 and OE-NEAT1 (Fig. 6 A), and the intersection was selected as the target signaling pathway. Subsequently, the PI3K/AKT signaling pathway was identified by TOP/FOP tests to be inhibited by NEAT1 overexpression and CXCR2 knockout (Fig. 6 B). Previous studies have demonstrated that LncRNA NEAT1 could alleviate sepsis-related inflammation by reversing the miR-495-3p/STAT3 axis and miR-211/PI3K/AKT axis [ 22 ]. In the realm of leukemia research, CXCR2 could eliminate chronic myeloid leukemia stem cells and overcome drug resistance by suppressing the PI3K/Akt/mTOR pathway [ 23 ]. What is more notable is that our team’s previous studies found that targeting CXCR2 can effectively inhibit the malignant biological characteristics of acute myeloid leukemia through the PI3K/Akt/NF-κB signaling pathway and generate anti-leukemia effects [ 18 ]. At the same time, as CXCR2 is a specific receptor for CXCL8, CXCL8 derived from mesenchymal cells could support the survival and proliferation of AML cells via the PI3K/AKT pathway [ 24 , 25 ]. To this end, we continued to explore the accompanying regulatory mechanisms from qRT-PCR and western blotting, and we found that overexpression of NEAT1 could result in the downregulation of CXCR2 expression at the transcript and protein levels (Fig. 6 C-D), along with a reduction in the phosphorylation of the PI3K/AKT pathway (Fig. 6 E-F). In conclusion, NEAT1 may negatively regulate CXCR2, and the NEAT1 deficiency in AML cells may lead to CXCR2 expression in AML cells and induce aberrant activation of the PI3K/AKT signaling pathway.

Fig. 6 NEAT1 deletion activates the PI3K/AKT signaling pathway by upregulating CXCR2. ( A ) Luciferase reporter assay with Cignal Reporter assay kit was conducted to detect the activities of different signaling pathways in AML cells transfected with pcDNA3.1/NEAT1 and CXCR2/Cas9. ( B ) TOP/FOP assay was applied to measure the activity of PI3K/AKT signaling pathway in cells transfected with pcDNA3.1/NEAT1 and CXCR2/Cas9. ( C ) Level of CXCR2 mRNA in AML cells transfected with pcDNA3.1/NEAT1 was tested by RT-qPCR assay. ( D ) The level of CXCR2 in AML cells transfected with pcDNA3.1/NEAT1 was detected by Western blotting. ( E-F ) Western blotting was utilized to detect the expression level of molecular proteins in PI3K/AKT signaling pathway. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001

Effect of CXCR2 upstream regulatory molecules on the malignant proliferation of AML cells in vivo

To investigate whether expression changes of CXCR2 upstream regulatory molecules mediated by gene-editing technology could alter the malignant biological characteristics of AML cells in vivo, our study successfully established an AML xenograft model using NOD-SCID mice. As illustrated in Fig. 7 , overexpression of NEAT1 (OE-NEAT1) inhibited the growth of transplanted AML tumors compared to the Control group. To some extent, it restricted the dissemination and infiltration of leukemia cells into vital organs, suggesting that NEAT1 acts as a protective factor in AML cells, functioning as a tumor suppressor gene. Overexpression of CTCF (OE-CTCF) significantly promoted the growth of transplanted AML tumors and enhanced the infiltration and dissemination of leukemia cells in vivo, consistent with the in vitro cell experiment results presented earlier in this study. Specifically, CTCF, acting as an oncogene, regulated the proliferation and infiltration of AML cells in vivo, accelerating the mortality of NOD/SCID leukemic mice model. Simultaneously, overexpression of CTCF (NEAT1 + OE-CTCF) on the basis of NEAT1 overexpression partially counteracted and limited the inhibitory effects of NEAT1 as a tumor suppressor gene on the malignant phenotype of leukemia cells, restoring and promoting the growth of AML transplanted tumors and the infiltration and dissemination of leukemia cells. Conversely, further knockdown of CTCF (NEAT1 + si-CTCF) on the basis of NEAT1 overexpression could suppress the proliferation and infiltration of AML cells in vivo, and to a certain extent, improving and prolonging the survival of NOD/SCID leukemic mice model. These differences in malignant proliferation, infiltration, and dissemination among the groups also led to distinct survival and prognostic outcomes.

Fig. 7 Effects of CXCR2 upstream regulatory molecules on the malignant biological characteristics of AML cells in vivo. ( A ) An AML xenograft model using NOD-SCID mice was utilized to verify the tumorigenicity of leukemia cells in each experimental group. ( B ) Comparison of transplanted tumor masses between groups. ( C ) Growth rates of transplanted AML tumors between groups. ( D ) Survival curves of each group of NOD/SCID leukemic mice model. ( E-F ) Hepatomegaly and splenomegaly in each group of NOD/SCID leukemic mice model. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001, ns P >0.05

Discussion

Acute myeloid leukemia (AML) is the most prevalent hematological malignancy among adults and the leukemia subtype with the highest morbidity and mortality [ 26 ]. The devastating and notorious clinical characteristic of AML is the abnormal and infinite proliferation as well as the severe accumulation of immature myeloblasts in the patients’ bone marrow microenvironment, leading to the suppression of normal hematopoiesis, systemic organ infiltration, and serious adverse clinical manifestations such as infection or bleeding, which will induce a series of non-specific but fatal signs and risks for patients [ 27 , 28 ]. Given the rapid progression of AML, patients often confront death within weeks or months if they are not treated promptly [ 29 , 30 ]. In recent years, along with the continuous advancement of molecular biology, genetics, and epigenetics, some encouraging discoveries have been made in the identification of carcinogenic molecules and regulatory pathways of AML, which have enhanced the quality of life and prognosis of patients to a certain extent [ 31 ]. However, the vast majority of AML patients still have to contend with the outcome of relapse and difficult treatment [ 32 , 33 ]. This is undoubtedly a major challenge in the clinical practice of AML treatment. Therefore, to actively explore novel regulatory molecules that play a crucial role in the pathogenesis of AML and to better comprehend the molecular basis of AML and new targeted therapies hold great practical significance for further improving the prognosis and prolonging the survival of AML patients.

Long non-coding RNAs (lncRNAs) are defined as transcripts exceeding 200 nucleotides in length and typically lack the capacity to encode proteins [ 34 ]. They are capable of regulating the activity of gene promoters and participating in post-translational modifications, thereby mediating the emergence of a series of biological characteristics [ 35 ]. To date, lncRNAs have been acknowledged to assume an indispensable position in many human diseases, particularly in malignant tumor disorders [ 36 , 37 ]. For instance, studies have affirmed that lncRNA NEAT1 (NEAT1) is aberrantly highly expressed in breast cancer [ 38 ], gastric cancer [ 39 ], lung cancer [ 40 ], nasopharyngeal cancer [ 41 ], laryngeal cancer [ 42 ], glioma [ 43 ], ovarian cancer [ 44 ], prostate cancer [ 45 ], and other malignant tumors. Moreover, a growing number of studies suggest that NEAT1 might be a significant target for overcoming cancer chemotherapy resistance and promoting chemotherapy sensitization [ 46 ]. Nevertheless, the current research and in-depth mechanism exploration of NEAT1 in hematological malignancies remain conservative. Interestingly, only a few studies have discovered that NEAT1 is conspicuously lowly expressed in leukemia, which contrasts sharply with other solid tumors [ 47 , 48 ]. Paraspeckles are membraneless organelles formed through liquid-liquid phase separation, composed of multiple proteins and RNAs, including NONO, SFPQ, and NEAT1. One study [ 49 ] demonstrated that the histone modifier ASXL1 plays a critical role in paraspeckle formation by forming phase-separated droplets, upregulating NEAT1 expression, and enhancing NONO-NEAT1 interactions via its C-terminal intrinsically disordered region (IDR). In contrast, a pathogenic ASXL1 mutant lacking the IDR (ASXL1-MT) fails to support the proper interaction of paraspeckle components. Furthermore, paraspeckles are disrupted and NONO exhibits aberrant cytoplasmic localization in hematopoietic stem and progenitor cells (HSPCs) derived from ASXL1-MT knockin mice. Depletion of NONO or forced expression of cytoplasmic NONO impairs the repopulating capacity of HSPCs, phenocopying the effects of ASXL1-MT expression. These findings reveal a functional link between ASXL1 and paraspeckle integrity in the maintenance of normal hematopoiesis. Perhaps NEAT1 could be a crucial entry point in the pathogenesis of AML. Additionally, the precise mechanism of action of NEAT1 and its downstream regulatory molecules in the pathogenesis of AML has yet to be clarified and warrants further investigation.

We initially probed into the expression of NEAT1 in the bone marrow of AML patients at diverse disease stages and in various AML cell lines, and discovered that the expression of NEAT1 in clinical AML patients was conspicuously decreased. Moreover, almost all AML cell lines manifested significantly low expression of NEAT1. While overexpression of NEAT1 could inhibit the malignant biological characteristics of AML cells and promotes programmed death. The aforesaid undoubtedly indicates that the deletion of NEAT1 is prone to result in the malignant biological behaviors of AML cells. The pathogenesis of AML typically consists of a complex regulatory network of signaling molecules, and lncRNAs can specifically bind and interact with downstream target molecules, thereby playing significant biological functions [ 50 ]. Besides, it was identified that NEAT1 could specifically sponge CTCF, and it was also demonstrated that NEAT1 could interact with the CTCF protein. ChIP results indicated that CTCF might interact with the CXCR2 promoter. These findings suggest that NEAT1 may be implicated in mediating the downstream CTCF/CXCR2 axis to exert the regulation of the malignant biological features of AML.

Interestingly, it has been reported that NEAT1 can specifically bind to CTCF to facilitate the performance of cell biology [ 20 ]. At present, CTCF has been affirmed to play a crucial role in breast cancer [ 51 ], colorectal cancer [ 52 ], pancreatic cancer [ 53 ], ovarian cancer [ 54 ], melanoma [ 55 ], and other malignant tumors, yet the role of CTCF in AML remains unresolved. In our study, we found that there is likely a bidirectional regulation between CTCF and NEAT1 in AML cells. Targeted inhibition of CTCF could abrogate the malignant phenotype caused by NEAT1 inactivation, which is shown to inhibit proliferation, colony formation, and invasion while promoting apoptosis. And subsequently restrain the malignant biological characteristics of AML cells.

In recent years, the role of the CXCR family in AML has been gradually elucidated, and CXCR is regarded as an indispensable key player in the pathogenesis, progression, and prognosis of leukemia [ 56 , 57 ]. Among them, CXCR4 is a prevalent molecule in the fundamental research domain of leukemia, and targeted blocking of CXCR4 can effectively prevent AML progression, reduce the tumor burden of leukemia, and improve prognosis, demonstrating certain advantages [ 58 – 60 ]. However, until now, there has been scant research on CXCR2 in the academic circle. Just as the outcomes of previous studies can preliminarily predict, CTCF is likely to target and regulate CXCR2, that is, the regulatory axis of CTCF/CXCR2 may be implicated in the occurrence and development of AML. To this end, we employed the CRISPR CAS9 to carry out CXCR2 gene knockout on AML cells. The results indicated that CXCR2 knockout could diminish the malignant proliferation level of AML cells and promote their apoptosis, accompanied by the downregulation of CTCF expression. A series of reverse phase verification tests or rescue experiments were conducted to further ascertain that, CXCR2 knockout can down-regulate CTCF and successfully reverse the malignant phenotype caused by NEAT1 deletion, while overexpression of CXCR2 can rescue the malignant phenotype caused by NEAT1.

It is worth noting that disease recurrence is one of the most common causes of treatment failure and death in AML patients with FMS-like tyrosine kinase 3 (FLT3) mutations. In order to identify therapeutic targets for the survival and malignant proliferation of FLT3-mutated leukemia myeloblasts after treatment with the second-generation tyrosine kinase inhibitor (TKI) gilteritinib, it have confirmed significantly abnormally high expression of CXCR2 in FLT3-mutated AML patients through proteomic screening and in vitro studies. Targeting the NF-κB2-MIF/CXCLs-CXCR2 axis may be a proven therapeutic strategy to overcome TKI resistance and effectively treat FLT3 mutated AML patients [ 61 ]. In addition, because AML is associated with disease-initiating leukemic stem cells, these malignant hematological stem cells are often not eliminated by conventional therapies. Similarly, parallel transcriptional analysis of highly isolated stem cell and progenitor cell populations in AML and control samples was conducted in another study [ 62 ], and it was discovered that interleukin-8 (IL-8) and its specific receptor CXCR2 may play a crucial role in AML and be a poor prognostic factor for AML, and CXCR2 could be inhibited by knockdown and pharmacological methods, it could induce cell cycle arrest and inhibit the malignant proliferation of leukemic stem cells, which further indicates that CXCR2 is a promising therapeutic target for AML.

The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway is constitutively activated in approximately 60% of AML patients, and it is closely related to poor therapeutic efficacy, short remission periods, and easy recurrence [ 63 , 64 ]. Generally, aberrant activation of the PI3K/AKT pathway is a crucial reference indicator for a poor prognosis in AML patients, and targeting the PI3K/AKT pathway should be the focus and challenge of basic and clinical research on anti-leukemia [ 65 , 66 ]. It should be noted that previous study [ 67 ] have demonstrated that NEAT1 could inhibit the progression of Parkinson’s disease (PD) through the FUS-mediated PI3K/AKT/mTOR signaling pathway. However, in malignant tumors, NEAT1 is aberrantly highly expressed in cholangiocarcinoma (CCA) tissues and cells, and NEAT1 could activate the PI3K/AKT signaling pathway to regulate epithelial-mesenchymal transformation (EMT) [ 68 ]. Additionally, NEAT1 mediates the malignant biological characteristics of gastric cancer cells by influencing the PI3K/AKT/mTOR signaling pathway [ 69 ]. Simultaneously, the high expression of NEAT1 promotes the proliferation of multiple myeloma (MM) cells by activating the PI3K/AKT pathway and participates in the pathogenesis and progression of MM [ 70 ]. On the other hand, small molecule targeted antagonists targeting CXCR2 could also inhibit the malignant biological behaviors of melanoma through the PI3K/AKT pathway [ 71 ]. Interestingly, in this study, we initially detected the activity of different signaling pathways in various transfected AML cells by the Cignal Reporter assay and determined that the PI3K/AKT signaling pathway could be inhibited by NEAT1 overexpression and CXCR2 knockout by the TOP/FOP assay, thereby further confirming that NEAT1 may negatively regulate CXCR2, and the inactivation of NEAT1 in AML cells would be likely to lead to CXCR2 expression in AML cells and induce abnormal activation of the PI3K/AKT signaling pathway. The associated biological activity effects and in-depth molecular regulatory mechanisms need to be further clarified in future studies of our team.

It is noteworthy that this study not only comprehensively and systematically validated and elucidated how CXCR2 upstream regulatory molecules regulate and maintain the malignant biological characteristics of AML cells through in vitro cell experiments but also fully confirmed these findings via in vivo animal experiments. Overexpression of NEAT1 inhibited the growth of transplanted AML tumors and restricted the dissemination and infiltration of leukemia cells into vital organs to a certain extent, indicating that NEAT1 functions as a protective factor for AML cells and serves as a tumor suppressor gene. Consequently, NEAT1 is predominantly inactivated in clinical bone marrow specimens of AML patients. In contrast, overexpression of CTCF significantly promoted the growth of transplanted AML tumors and the infiltration and dissemination of leukemia cells in vivo, consistent with the in vitro cell experiment results presented earlier in this study. Specifically, CTCF, acting as an oncogene, mediates the malignant biological behavior of AML cells and accelerates the mortality of NOD/SCID leukemic mice model. Additionally, overexpression of CTCF on the basis of NEAT1 overexpression counteracted and limited the inhibitory effects of NEAT1 as a tumor suppressor gene on the malignant phenotype of leukemia cells, restoring and promoting the growth of AML transplanted tumors and the infiltration and dissemination of leukemia cells. Furthermore, knockdown of CTCF on the basis of NEAT1 overexpression significantly suppressed the proliferation and infiltration of AML cells in vivo, improving and prolonging the survival of NOD/SCID leukemic mice model.

In summary, the in vivo experiments in this study corroborate the reliability of the conclusions drawn from in vitro cell experiments and further demonstrate that LncRNA NEAT1 inhibits the malignant biological characteristics of acute myeloid leukemia by mediating the CTCF/CXCR2 regulatory axis.

Conclusion

In conclusion, our study reported the aberrant dysregulation of NEAT1 and its downstream target molecule CTCF/CXCR2 axis in AML samples and cell lines from a “basic—clinical—basis” approach. Overexpression of NEAT1 could effectively reduce the malignant biological characteristics of AML cells, and the interaction and combination between NEAT1 and CTCF, CTCF and CXCR were confirmed. There is no doubt that CTCF has been identified as a downstream target molecule of NEAT1 and can also activate CXCR2 expression in AML cells through transcription. Accordingly, in salvage experiments, targeted inhibition of CTCF and CXCR2 knockout successfully reversed the promoting effect of NEAT1 inactivation on AML progression and inhibited the malignant phenotype. Indeed, NEAT1 should be a protective factor for AML, and its inactivation may regulate the malignant biological characteristics of AML cells through the CTCF/CXCR2 signaling axis, and the underlying molecular mechanism may be related to the regulation of the PI3K/AKT signaling pathway. More importantly, the in vivo experiments in this study confirmed the reliability of the aforementioned conclusions.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yanquan Liu and Zuotao Li contributed equally to this work.

Acknowledgements

We would like to thank the friends from Guangdong Medical University, Fujian Institute of Hematology, and the First Affiliated Hospital of Gannan Medical University for their scientific assistance and technical support in this study. More importantly, we are very grateful to Dr. Zeng Minjuan from the School of Basic Medicine, Guangdong Medical University for her statistical analysis and discussion of the clinical and experimental data in our research.

Author contributions

Yanquan Liu: conceptualization, data curation, formal analysis, investigation, methodology, software, validation, visualization, writing – original draft, writing – review and editing. Zuotao Li: conceptualization, resources, supervision, validation, writing – review and editing. Jingdong Zhang: conceptualization, formal analysis, methodology, resources, supervision, writing – review and editing. Jianzhen Shen: conceptualization, formal analysis, methodology, resources, supervision, validation, writing – review and editing. Hehui Zhang: conceptualization, data curation, formal analysis, investigation, validation. Yue Yin: conceptualization, investigation, supervision, validation. Lei Sun: conceptualization, investigation, validation. Huanwen Tang: conceptualization, funding acquisition, investigation, methodology, project administration, resources, supervision, writing – original draft, writing – review and editing.

Funding

This work was supported by the Science and Technology Plan Fund of Jiangxi Provincial Administration of Traditional Chinese Medicine (2023A0351), the Science and Technology Research Project of Jiangxi Provincial Department of Education (GJJ2401318) and the Opening Fund of Jiangxi Health Commission Key Laboratory of Leukemia (2025-001).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Ethical approval

This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Gannan Medical University and Fujian Medical University Union Hospital (approval number: LLSC-2023247 and 2019KY092, respectively).

Informed consent

Not applicable.

References

1. Qin Y Pu X Hu D Yang M Machine learning-based biomarker screening for acute myeloid leukemia prognosis and therapy from diverse cell-death patterns Sci Rep 2024 14 1 17874 10.1038/s41598-024-68755-3 39090256 PMC11294352 Qin Y, Pu X, Hu D, Yang M. Machine learning-based biomarker screening for acute myeloid leukemia prognosis and therapy from diverse cell-death patterns. Sci Rep. 2024;14(1):17874. 10.1038/s41598-024-68755-3. 39090256 10.1038/s41598-024-68755-3 PMC11294352

2. Solomon Y Berhan A Almaw A Long non-coding RNA as potential diagnostic markers for acute myeloid leukemia: A systematic review and meta-analysis Cancer Med 2024 13 11 e7376 10.1002/cam4.7376 38864480 PMC11167611 Solomon Y, Berhan A, Almaw A, et al. Long non-coding RNA as potential diagnostic markers for acute myeloid leukemia: A systematic review and meta-analysis. Cancer Med. 2024;13(11):e7376. 10.1002/cam4.7376. 38864480 10.1002/cam4.7376 PMC11167611

3. Ilyas M Aamir KM Manzoor S Linear programming based computational technique for leukemia classification using gene expression profile PLoS ONE 2023 18 10 e0292172 10.1371/journal.pone.0292172 37812613 PMC10561850 Ilyas M, Aamir KM, Manzoor S, et al. Linear programming based computational technique for leukemia classification using gene expression profile. PLoS ONE. 2023;18(10):e0292172. 10.1371/journal.pone.0292172. 37812613 10.1371/journal.pone.0292172 PMC10561850

4. Zhou Y Huang G Cai X Liu Y Qian B Li D Global, regional, and National burden of acute myeloid leukemia, 1990–2021: a systematic analysis for the global burden of disease study 2021 Biomark Res 2024 12 1 101 10.1186/s40364-024-00649-y 39256810 PMC11389310 Zhou Y, Huang G, Cai X, Liu Y, Qian B, Li D. Global, regional, and National burden of acute myeloid leukemia, 1990–2021: a systematic analysis for the global burden of disease study 2021. Biomark Res. 2024;12(1):101. 10.1186/s40364-024-00649-y. 39256810 10.1186/s40364-024-00649-y PMC11389310

5. Iqbal A Dubey M Randhawa AS Improved treatment outcomes with modified induction therapy in acute myeloid leukemia (AML): A retrospective observational study from a regional cancer center Cureus 2024 16 1 e53303 10.7759/cureus.53303 38435958 PMC10905208 Iqbal A, Dubey M, Randhawa AS, et al. Improved treatment outcomes with modified induction therapy in acute myeloid leukemia (AML): A retrospective observational study from a regional cancer center. Cureus. 2024;16(1):e53303. 10.7759/cureus.53303. 38435958 10.7759/cureus.53303 PMC10905208

6. Zhai Y Wang Q Ji L Clinical characteristics and prognostic factors analysis of core binding factor acute myeloid leukemia in real world Cancer Med 2023 12 24 21592 604 10.1002/cam4.6693 38062912 PMC10757144 Zhai Y, Wang Q, Ji L, et al. Clinical characteristics and prognostic factors analysis of core binding factor acute myeloid leukemia in real world. Cancer Med. 2023;12(24):21592–604. 10.1002/cam4.6693. 38062912 10.1002/cam4.6693 PMC10757144

7. Liu ZY Tang JM Yang MQ The role of LncRNA-mediated autophagy in cancer progression Front Cell Dev Biol 2024 12 1348894 10.3389/fcell.2024.1348894 38933333 PMC11199412 Liu ZY, Tang JM, Yang MQ, et al. The role of LncRNA-mediated autophagy in cancer progression. Front Cell Dev Biol. 2024;12:1348894. 10.3389/fcell.2024.1348894. 38933333 10.3389/fcell.2024.1348894 PMC11199412

8. Peng X Zhang K Ma L The role of long Non-Coding RNAs in thyroid cancer Front Oncol 2020 10 941 10.3389/fonc.2020.00941 32596158 PMC7300266 Peng X, Zhang K, Ma L, et al. The role of long Non-Coding RNAs in thyroid cancer. Front Oncol. 2020;10:941. 10.3389/fonc.2020.00941. 32596158 10.3389/fonc.2020.00941 PMC7300266

9. Gasic V Karan-Djurasevic T Pavlovic D Zukic B Pavlovic S Tosic N Diagnostic and therapeutic implications of long Non-Coding RNAs in leukemia Life (Basel) 2022 12 11 1770 10.3390/life12111770 36362925 PMC9695865 Gasic V, Karan-Djurasevic T, Pavlovic D, Zukic B, Pavlovic S, Tosic N. Diagnostic and therapeutic implications of long Non-Coding RNAs in leukemia. Life (Basel). 2022;12(11):1770. 10.3390/life12111770. 36362925 10.3390/life12111770 PMC9695865

10. Guan X Sun Y Zhang C LncRNAs in blood cells: roles in cell development and potential pathogenesis in hematological malignancies Crit Rev Oncol Hematol 2022 180 103849 10.1016/j.critrevonc.2022.103849 36261116 Guan X, Sun Y, Zhang C. LncRNAs in blood cells: roles in cell development and potential pathogenesis in hematological malignancies. Crit Rev Oncol Hematol. 2022;180:103849. 10.1016/j.critrevonc.2022.103849. 36261116 10.1016/j.critrevonc.2022.103849

11. Smith NE Spencer-Merris P Fox AH Petersen J Michael MZ The long and the short of it: NEAT1 and cancer cell metabolism Cancers (Basel) 2022 14 18 4388 10.3390/cancers14184388 36139550 PMC9497099 Smith NE, Spencer-Merris P, Fox AH, Petersen J, Michael MZ. The long and the short of it: NEAT1 and cancer cell metabolism. Cancers (Basel). 2022;14(18):4388. 10.3390/cancers14184388. 36139550 10.3390/cancers14184388 PMC9497099

12. Huang K Jia J Wu C Ribosomal RNA gene transcription mediated by the master genome regulator protein CCCTC-binding factor (CTCF) is negatively regulated by the condensin complex J Biol Chem 2013 288 36 26067 77 10.1074/jbc.M113.486175 23884423 PMC3764810 Huang K, Jia J, Wu C, et al. Ribosomal RNA gene transcription mediated by the master genome regulator protein CCCTC-binding factor (CTCF) is negatively regulated by the condensin complex. J Biol Chem. 2013;288(36):26067–77. 10.1074/jbc.M113.486175. 23884423 10.1074/jbc.M113.486175 PMC3764810

13. Qiu Y Xu M Huang S Long noncoding rnas: emerging regulators of normal and malignant hematopoiesis Blood 2021 138 23 2327 36 10.1182/blood.2021011992 34482397 PMC8662076 Qiu Y, Xu M, Huang S. Long noncoding rnas: emerging regulators of normal and malignant hematopoiesis. Blood. 2021;138(23):2327–36. 10.1182/blood.2021011992. 34482397 10.1182/blood.2021011992 PMC8662076

14. Zha J Lai Q Deng M Shi P Zhao H Chen Q Wu H Xu B Disruption of CTCF boundary at HOXA locus promote BET inhibitors’ therapeutic sensitivity in acute myeloid leukemia Stem Cell Rev Rep 2020 16 6 1280 91 10.1007/s12015-020-10057-y 33057942 Zha J, Lai Q, Deng M, Shi P, Zhao H, Chen Q, Wu H, Xu B. Disruption of CTCF boundary at HOXA locus promote BET inhibitors’ therapeutic sensitivity in acute myeloid leukemia. Stem Cell Rev Rep. 2020;16(6):1280–91. 10.1007/s12015-020-10057-y. 33057942 10.1007/s12015-020-10057-y

15. Mulet-Lazaro R van Herk S Nuetzel M Sijs-Szabo A Díaz N Kelly K Erpelinck-Verschueren C Schwarzfischer-Pfeilschifter L Stanewsky H Ackermann U Glatz D Raithel J Fischer A Pohl S Rijneveld A Vaquerizas JM Thiede C Plass C Wouters BJ Delwel R Rehli M Gebhard C Epigenetic alterations affecting hematopoietic regulatory networks as drivers of mixed myeloid/lymphoid leukemia Nat Commun 2024 15 1 5693 10.1038/s41467-024-49811-y 38972954 PMC11228033 Mulet-Lazaro R, van Herk S, Nuetzel M, Sijs-Szabo A, Díaz N, Kelly K, Erpelinck-Verschueren C, Schwarzfischer-Pfeilschifter L, Stanewsky H, Ackermann U, Glatz D, Raithel J, Fischer A, Pohl S, Rijneveld A, Vaquerizas JM, Thiede C, Plass C, Wouters BJ, Delwel R, Rehli M, Gebhard C. Epigenetic alterations affecting hematopoietic regulatory networks as drivers of mixed myeloid/lymphoid leukemia. Nat Commun. 2024;15(1):5693. 10.1038/s41467-024-49811-y. 38972954 10.1038/s41467-024-49811-y PMC11228033

16. Wu T Yang W Sun A The role of CXC chemokines in cancer progression Cancers (Basel) 2022 15 1 167 10.3390/cancers15010167 36612163 PMC9818145 Wu T, Yang W, Sun A, et al. The role of CXC chemokines in cancer progression. Cancers (Basel). 2022;15(1):167. 10.3390/cancers15010167. 36612163 10.3390/cancers15010167 PMC9818145

17. Liu YQ Zeng MJ Yin Y Abnormal expression and clinical significance of CXC chemokine receptor 1/2 in acute leukemia Acad J Chin PLA Med Sch 2023 44 3 213 9 10.3969/j.issn.2095-5227.2023.03.002 Liu YQ, Zeng MJ, Yin Y, et al. Abnormal expression and clinical significance of CXC chemokine receptor 1/2 in acute leukemia. Acad J Chin PLA Med Sch. 2023;44(3):213–9. 10.3969/j.issn.2095-5227.2023.03.002.

18. Liu YQ Shen JZ Yin Y The effects and regulatory mechanism of targeting CXC chemokine receptor 1/2 combined with Ara-C on the malignant biological behaviors of U937 cells of acute myeloid leukemia J Exp Hematol 2023 31 2 364 76 10.19746/j.cnki.issn.1009-2137.2023.02.009 37096507 Liu YQ, Shen JZ, Yin Y, et al. The effects and regulatory mechanism of targeting CXC chemokine receptor 1/2 combined with Ara-C on the malignant biological behaviors of U937 cells of acute myeloid leukemia. J Exp Hematol. 2023;31(2):364–76. 10.19746/j.cnki.issn.1009-2137.2023.02.009. 10.19746/j.cnki.issn.1009-2137.2023.02.009 37096507

19. Arber DA Orazi A Hasserjian R The 2016 revision to the world health organization classification of myeloid neoplasms and acute leukemia Blood 2016 127 20 2391 405 10.1182/blood-2016-03-643544 27069254 Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the world health organization classification of myeloid neoplasms and acute leukemia. Blood. 2016;127(20):2391–405. 10.1182/blood-2016-03-643544. 27069254 10.1182/blood-2016-03-643544

20. Geng J Cui C Yin Y Zhao Y Zhang C LncRNA NEAT1 affects endometrial receptivity by regulating HOXA10 promoter activity Cell Cycle 2022 21 18 1932 44 10.1080/15384101.2022.2075198 35574918 PMC9415530 Geng J, Cui C, Yin Y, Zhao Y, Zhang C. LncRNA NEAT1 affects endometrial receptivity by regulating HOXA10 promoter activity. Cell Cycle. 2022;21(18):1932–44. 10.1080/15384101.2022.2075198. 35574918 10.1080/15384101.2022.2075198 PMC9415530

21. Ma DB Zhang H Wang XL Wu QG METTL3 aggravates cell damage induced by Streptococcus pneumoniae via the NEAT1/CTCF/MUC19 axis Kaohsiung J Med Sci 2024 40 8 722 31 10.1002/kjm2.12843 38757482 PMC11895658 Ma DB, Zhang H, Wang XL, Wu QG. METTL3 aggravates cell damage induced by Streptococcus pneumoniae via the NEAT1/CTCF/MUC19 axis. Kaohsiung J Med Sci. 2024;40(8):722–31. 10.1002/kjm2.12843. 38757482 10.1002/kjm2.12843 PMC11895658

22. Xia D Yao R Zhou P LncRNA NEAT1 reversed the hindering effects of miR-495-3p/STAT3 axis and miR-211/PI3K/AKT axis on sepsis-relevant inflammation Mol Immunol 2020 117 168 79 10.1016/j.molimm.2019.10.009 31812793 Xia D, Yao R, Zhou P, et al. LncRNA NEAT1 reversed the hindering effects of miR-495-3p/STAT3 axis and miR-211/PI3K/AKT axis on sepsis-relevant inflammation. Mol Immunol. 2020;117:168–79. 10.1016/j.molimm.2019.10.009. 31812793 10.1016/j.molimm.2019.10.009

23. Kim JH Kang KW Park Y CXCR2 Inhibition overcomes Ponatinib intolerance by eradicating chronic myeloid leukemic stem cells through PI3K/Akt/mTOR and dipeptidylpeptidase Ⅳ (CD26) Heliyon 2023 9 11 e22091 10.1016/j.heliyon.2023.e22091 38045173 PMC10692791 Kim JH, Kang KW, Park Y, et al. CXCR2 Inhibition overcomes Ponatinib intolerance by eradicating chronic myeloid leukemic stem cells through PI3K/Akt/mTOR and dipeptidylpeptidase Ⅳ (CD26). Heliyon. 2023;9(11):e22091. 10.1016/j.heliyon.2023.e22091. 38045173 10.1016/j.heliyon.2023.e22091 PMC10692791

24. Cheng J Li Y Liu S CXCL8 derived from mesenchymal stromal cells supports survival and proliferation of acute myeloid leukemia cells through the PI3K/AKT pathway FASEB J 2019 33 4 4755 64 10.1096/fj.201801931R 30592634 Cheng J, Li Y, Liu S, et al. CXCL8 derived from mesenchymal stromal cells supports survival and proliferation of acute myeloid leukemia cells through the PI3K/AKT pathway. FASEB J. 2019;33(4):4755–64. 10.1096/fj.201801931R. 30592634 10.1096/fj.201801931R

25. Vermeersch G Proost P Struyf S CXCL8 and its cognate receptors CXCR1/CXCR2 in primary myelofibrosis Haematologica 2024 109 7 2060 72 10.3324/haematol.2023.284921 38426279 PMC11215396 Vermeersch G, Proost P, Struyf S, et al. CXCL8 and its cognate receptors CXCR1/CXCR2 in primary myelofibrosis. Haematologica. 2024;109(7):2060–72. 10.3324/haematol.2023.284921. 38426279 10.3324/haematol.2023.284921 PMC11215396

26. Konstantinidis I Tsokkou S Grigoriadis S Cardiotoxicity in acute myeloid leukemia in adults: A scoping study Cancers (Basel) 2024 16 13 2474 10.3390/cancers16132474 39001536 PMC11240574 Konstantinidis I, Tsokkou S, Grigoriadis S, et al. Cardiotoxicity in acute myeloid leukemia in adults: A scoping study. Cancers (Basel). 2024;16(13):2474. 10.3390/cancers16132474. 39001536 10.3390/cancers16132474 PMC11240574

27. Li Q Wang M Liu L The role of exosomes in the stemness maintenance and progression of acute myeloid leukemia Biochem Pharmacol 2023 212 115539 10.1016/j.bcp.2023.115539 37024061 Li Q, Wang M, Liu L. The role of exosomes in the stemness maintenance and progression of acute myeloid leukemia. Biochem Pharmacol. 2023;212:115539. 10.1016/j.bcp.2023.115539. 37024061 10.1016/j.bcp.2023.115539

28. Liu YQ Yin Y Zeng MJ The mechanisms of Piceatannol in inhibiting the malignant biological characteristics of acute myeloid leukemia cells J Exp Hematol 2023 31 4 985 91 10.19746/j.cnki.issn.1009-2137.2023.04.009 37551466 Liu YQ, Yin Y, Zeng MJ, et al. The mechanisms of Piceatannol in inhibiting the malignant biological characteristics of acute myeloid leukemia cells. J Exp Hematol. 2023;31(4):985–91. 10.19746/j.cnki.issn.1009-2137.2023.04.009. 10.19746/j.cnki.issn.1009-2137.2023.04.009 37551466

29. Percival ME Tao L Medeiros BC Clarke CA Improvements in the early death rate among 9380 patients with acute myeloid leukemia after initial therapy: A SEER database analysis Cancer 2015 121 12 2004 12 10.1002/cncr.29319 25739348 PMC4465209 Percival ME, Tao L, Medeiros BC, Clarke CA. Improvements in the early death rate among 9380 patients with acute myeloid leukemia after initial therapy: A SEER database analysis. Cancer. 2015;121(12):2004–12. 10.1002/cncr.29319. 25739348 10.1002/cncr.29319 PMC4465209

30. Bug G Anargyrou K Tonn T Impact of leukapheresis on early death rate in adult acute myeloid leukemia presenting with hyperleukocytosis Transfusion 2007 47 10 1843 50 10.1111/j.1537-2995.2007.01406.x 17880610 Bug G, Anargyrou K, Tonn T, et al. Impact of leukapheresis on early death rate in adult acute myeloid leukemia presenting with hyperleukocytosis. Transfusion. 2007;47(10):1843–50. 10.1111/j.1537-2995.2007.01406.x. 17880610 10.1111/j.1537-2995.2007.01406.x

31. Kowalczyk A Zarychta J Lejman M Latoch E Zawitkowska J Clinical implications of isocitrate dehydrogenase mutations and targeted treatment of acute myeloid leukemia with mutant isocitrate dehydrogenase Inhibitors-Recent Advances, challenges and future prospects Int J Mol Sci 2024 25 14 7916 10.3390/ijms25147916 39063158 PMC11276768 Kowalczyk A, Zarychta J, Lejman M, Latoch E, Zawitkowska J. Clinical implications of isocitrate dehydrogenase mutations and targeted treatment of acute myeloid leukemia with mutant isocitrate dehydrogenase Inhibitors-Recent Advances, challenges and future prospects. Int J Mol Sci. 2024;25(14):7916. 10.3390/ijms25147916. 39063158 10.3390/ijms25147916 PMC11276768

32. Ngo D Tinajero J Li S Treatment of relapsed or refractory FLT-3 acute myelogenous leukemia with a triplet regimen of hypomethylating agent, venetoclax, and gilteritinib Leuk Lymphoma 2024 65 3 372 7 10.1080/10428194.2023.2292473 38164785 Ngo D, Tinajero J, Li S, et al. Treatment of relapsed or refractory FLT-3 acute myelogenous leukemia with a triplet regimen of hypomethylating agent, venetoclax, and gilteritinib. Leuk Lymphoma. 2024;65(3):372–7. 10.1080/10428194.2023.2292473. 38164785 10.1080/10428194.2023.2292473

33. Gurska L Gritsman K Unveiling T cell evasion mechanisms to immune checkpoint inhibitors in acute myeloid leukemia Cancer Drug Resist 2023 6 3 674 87 10.20517/cdr.2023.39 37842238 PMC10571054 Gurska L, Gritsman K. Unveiling T cell evasion mechanisms to immune checkpoint inhibitors in acute myeloid leukemia. Cancer Drug Resist. 2023;6(3):674–87. 10.20517/cdr.2023.39. 37842238 10.20517/cdr.2023.39 PMC10571054

34. Zhang A Pi W Wang Y Update on functional analysis of long non-coding RNAs in common crops Front Plant Sci 2024 15 1389154 10.3389/fpls.2024.1389154 38872885 PMC11169716 Zhang A, Pi W, Wang Y, et al. Update on functional analysis of long non-coding RNAs in common crops. Front Plant Sci. 2024;15:1389154. 10.3389/fpls.2024.1389154. 38872885 10.3389/fpls.2024.1389154 PMC11169716

35. Han S Chen LL Long non-coding RNAs in the nucleolus: Biogenesis, regulation, and function Curr Opin Struct Biol 2024 87 102866 10.1016/j.sbi.2024.102866 38909586 Han S, Chen LL. Long non-coding RNAs in the nucleolus: Biogenesis, regulation, and function. Curr Opin Struct Biol. 2024;87:102866. 10.1016/j.sbi.2024.102866. 38909586 10.1016/j.sbi.2024.102866

36. Zhang J Wu L Wang C Xie X Han Y Research progress of long Non-Coding RNA in tumor drug resistance: A new paradigm Drug Des Devel Ther 2024 18 1385 98 10.2147/DDDT.S448707 38689609 PMC11060174 Zhang J, Wu L, Wang C, Xie X, Han Y. Research progress of long Non-Coding RNA in tumor drug resistance: A new paradigm. Drug Des Devel Ther. 2024;18:1385–98. 10.2147/DDDT.S448707. 38689609 10.2147/DDDT.S448707 PMC11060174

37. Syed RU Afsar S Aboshouk NAM LncRNAs in necroptosis: Deciphering their role in cancer pathogenesis and therapy Pathol Res Pract 2024 256 155252 10.1016/j.prp.2024.155252 38479121 Syed RU, Afsar S, Aboshouk NAM, et al. LncRNAs in necroptosis: Deciphering their role in cancer pathogenesis and therapy. Pathol Res Pract. 2024;256:155252. 10.1016/j.prp.2024.155252. 38479121 10.1016/j.prp.2024.155252

38. Knutsen E Harris AL Perander M Expression and functions of long non-coding RNA NEAT1 and isoforms in breast cancer Br J Cancer 2022 126 4 551 61 10.1038/s41416-021-01588-3 34671127 PMC8854383 Knutsen E, Harris AL, Perander M. Expression and functions of long non-coding RNA NEAT1 and isoforms in breast cancer. Br J Cancer. 2022;126(4):551–61. 10.1038/s41416-021-01588-3. 34671127 10.1038/s41416-021-01588-3 PMC8854383

39. Zhang Y Wen Y The role of LncRNA NEAT1 in gastric cancer: tumor development and potential therapeutic target Curr Pharm Des 2023 29 28 2213 22 10.2174/0113816128257113230921035222 37779403 Zhang Y, Wen Y. The role of LncRNA NEAT1 in gastric cancer: tumor development and potential therapeutic target. Curr Pharm Des. 2023;29(28):2213–22. 10.2174/0113816128257113230921035222. 37779403 10.2174/0113816128257113230921035222

40. Hussain MS Afzal O Gupta G Unraveling NEAT1’s complex role in lung cancer biology: a comprehensive review EXCLI J 2024 23 34 52 10.17179/excli2023-6553 38343745 PMC10853633 Hussain MS, Afzal O, Gupta G, et al. Unraveling NEAT1’s complex role in lung cancer biology: a comprehensive review. EXCLI J. 2024;23:34–52. 10.17179/excli2023-6553. 38343745 10.17179/excli2023-6553 PMC10853633

41. Liu Z Wu K Wu J NEAT1 is a potential prognostic biomarker for patients with nasopharyngeal carcinoma J Cell Biochem 2019 120 6 9831 8 10.1002/jcb.28263 30618186 Liu Z, Wu K, Wu J, et al. NEAT1 is a potential prognostic biomarker for patients with nasopharyngeal carcinoma. J Cell Biochem. 2019;120(6):9831–8. 10.1002/jcb.28263. 30618186 10.1002/jcb.28263

42. Wang P Li QY Sun YN Wang JT Liu M Long Noncoding RNA NEAT1: A potential biomarker in the progression of laryngeal squamous cell carcinoma ORL J Otorhinolaryngol Relat Spec 2021 83 6 464 70 10.1159/000515228 33831864 Wang P, Li QY, Sun YN, Wang JT, Liu M, Long Noncoding. RNA NEAT1: A potential biomarker in the progression of laryngeal squamous cell carcinoma. ORL J Otorhinolaryngol Relat Spec. 2021;83(6):464–70. 10.1159/000515228. 33831864 10.1159/000515228

43. Liang J Liu C Xu D Xie K Li A LncRNA NEAT1 facilitates glioma progression via stabilizing PGK1 J Transl Med 2022 20 1 80 10.1186/s12967-022-03273-2 35123484 PMC8818213 Liang J, Liu C, Xu D, Xie K, Li A. LncRNA NEAT1 facilitates glioma progression via stabilizing PGK1. J Transl Med. 2022;20(1):80. 10.1186/s12967-022-03273-2. 35123484 10.1186/s12967-022-03273-2 PMC8818213

44. Liu Y Liu G Targeting NEAT1 affects the sensitivity to PARPi in serous ovarian cancer by regulating the homologous recombination repair pathway J Cancer 2024 15 5 1397 413 10.7150/jca.91896 38356722 PMC10861825 Liu Y, Liu G. Targeting NEAT1 affects the sensitivity to PARPi in serous ovarian cancer by regulating the homologous recombination repair pathway. J Cancer. 2024;15(5):1397–413. 10.7150/jca.91896. 38356722 10.7150/jca.91896 PMC10861825

45. Xu W Wu Y Zhang G NEAT1 promotes the progression of prostate cancer by targeting the miR-582-5p/EZH2 regulatory axis Cytotechnology 2024 76 2 231 46 10.1007/s10616-023-00612-z 38495291 PMC10940559 Xu W, Wu Y, Zhang G. NEAT1 promotes the progression of prostate cancer by targeting the miR-582-5p/EZH2 regulatory axis. Cytotechnology. 2024;76(2):231–46. 10.1007/s10616-023-00612-z. 38495291 10.1007/s10616-023-00612-z PMC10940559

46. Long F Li X Pan J The role of LncRNA NEAT1 in human cancer chemoresistance Cancer Cell Int 2024 24 1 236 10.1186/s12935-024-03426-x 38970092 PMC11227196 Long F, Li X, Pan J, et al. The role of LncRNA NEAT1 in human cancer chemoresistance. Cancer Cell Int. 2024;24(1):236. 10.1186/s12935-024-03426-x. 38970092 10.1186/s12935-024-03426-x PMC11227196

47. Rostami M Kharajo RS Parsa-Kondelaji M Ayatollahi H Sheikhi M Keramati MR Altered expression of NEAT1 variants and P53, PTEN, and BCL-2 genes in patients with acute myeloid leukemia Leuk Res 2022 115 106807 10.1016/j.leukres.2022.106807 35231756 Rostami M, Kharajo RS, Parsa-Kondelaji M, Ayatollahi H, Sheikhi M, Keramati MR. Altered expression of NEAT1 variants and P53, PTEN, and BCL-2 genes in patients with acute myeloid leukemia. Leuk Res. 2022;115:106807. 10.1016/j.leukres.2022.106807. 35231756 10.1016/j.leukres.2022.106807

48. Yan H Wang Z Sun Y Hu L Bu P Cytoplasmic NEAT1 suppresses AML stem cell Self-Renewal and leukemogenesis through inactivation of Wnt signaling Adv Sci (Weinh) 2021 8 22 e2100914 10.1002/advs.202100914 34609794 PMC8596104 Yan H, Wang Z, Sun Y, Hu L, Bu P. Cytoplasmic NEAT1 suppresses AML stem cell Self-Renewal and leukemogenesis through inactivation of Wnt signaling. Adv Sci (Weinh). 2021;8(22):e2100914. 10.1002/advs.202100914. 34609794 10.1002/advs.202100914 PMC8596104

49. Yamamoto K Goyama S Asada S Fujino T Yonezawa T Sato N Takeda R Tsuchiya A Fukuyama T Tanaka Y Yokoyama A Toya H Kon A Nannya Y Onoguchi-Mizutani R Nakagawa S Hirose T Ogawa S Akimitsu N Kitamura T A histone modifier, ASXL1, interacts with NONO and is involved in paraspeckle formation in hematopoietic cells Cell Rep 2021 36 8 109576 10.1016/j.celrep.2021.109576 34433054 Yamamoto K, Goyama S, Asada S, Fujino T, Yonezawa T, Sato N, Takeda R, Tsuchiya A, Fukuyama T, Tanaka Y, Yokoyama A, Toya H, Kon A, Nannya Y, Onoguchi-Mizutani R, Nakagawa S, Hirose T, Ogawa S, Akimitsu N, Kitamura T. A histone modifier, ASXL1, interacts with NONO and is involved in paraspeckle formation in hematopoietic cells. Cell Rep. 2021;36(8):109576. 10.1016/j.celrep.2021.109576. 34433054 10.1016/j.celrep.2021.109576

50. Li G Gao Y Li K Lin A Jiang Z Genomic analysis of biomarkers related to the prognosis of acute myeloid leukemia Oncol Lett 2020 20 2 1824 34 10.3892/ol.2020.11700 32724426 PMC7377096 Li G, Gao Y, Li K, Lin A, Jiang Z. Genomic analysis of biomarkers related to the prognosis of acute myeloid leukemia. Oncol Lett. 2020;20(2):1824–34. 10.3892/ol.2020.11700. 32724426 10.3892/ol.2020.11700 PMC7377096

51. Kakani P Dhamdhere SG Pant D Hypoxia-induced CTCF promotes EMT in breast cancer Cell Rep 2024 43 7 114367 10.1016/j.celrep.2024.114367 38900639 Kakani P, Dhamdhere SG, Pant D, et al. Hypoxia-induced CTCF promotes EMT in breast cancer. Cell Rep. 2024;43(7):114367. 10.1016/j.celrep.2024.114367. 38900639 10.1016/j.celrep.2024.114367

52. Lai Q Li Q He C CTCF promotes colorectal cancer cell proliferation and chemotherapy resistance to 5-FU via the P53-Hedgehog axis Aging 2020 12 16 16270 93 10.18632/aging.103648 32688344 PMC7485712 Lai Q, Li Q, He C, et al. CTCF promotes colorectal cancer cell proliferation and chemotherapy resistance to 5-FU via the P53-Hedgehog axis. Aging. 2020;12(16):16270–93. 10.18632/aging.103648. 32688344 10.18632/aging.103648 PMC7485712

53. Liu Y Qi W Yin J High CTCF expression mediated by FGD5-AS1/miR-19a-3p axis is associated with immunosuppression and pancreatic cancer progression Heliyon 2023 9 12 e22584 10.1016/j.heliyon.2023.e22584 38144356 PMC10746436 Liu Y, Qi W, Yin J, et al. High CTCF expression mediated by FGD5-AS1/miR-19a-3p axis is associated with immunosuppression and pancreatic cancer progression. Heliyon. 2023;9(12):e22584. 10.1016/j.heliyon.2023.e22584. 38144356 10.1016/j.heliyon.2023.e22584 PMC10746436

54. Zhao L Yang Y Yin S CTCF promotes epithelial ovarian cancer metastasis by broadly controlling the expression of metastasis-associated genes Oncotarget 2017 8 37 62217 30 10.18632/oncotarget.19216 28977939 PMC5617499 Zhao L, Yang Y, Yin S, et al. CTCF promotes epithelial ovarian cancer metastasis by broadly controlling the expression of metastasis-associated genes. Oncotarget. 2017;8(37):62217–30. 10.18632/oncotarget.19216. 28977939 10.18632/oncotarget.19216 PMC5617499

55. Sivapragasam S Stark B Albrecht AV CTCF binding modulates UV damage formation to promote mutation hot spots in melanoma EMBO J 2021 40 20 e107795 10.15252/embj.2021107795 34487363 PMC8521319 Sivapragasam S, Stark B, Albrecht AV, et al. CTCF binding modulates UV damage formation to promote mutation hot spots in melanoma. EMBO J. 2021;40(20):e107795. 10.15252/embj.2021107795. 34487363 10.15252/embj.2021107795 PMC8521319

56. Lu C Zhu J Chen X Risk stratification in acute myeloid leukemia using CXCR gene signatures: A bioinformatics analysis Front Oncol 2020 10 584766 10.3389/fonc.2020.584766 33381455 PMC7769120 Lu C, Zhu J, Chen X, et al. Risk stratification in acute myeloid leukemia using CXCR gene signatures: A bioinformatics analysis. Front Oncol. 2020;10:584766. 10.3389/fonc.2020.584766. 33381455 10.3389/fonc.2020.584766 PMC7769120

57. Korbecki J Kupnicka P Barczak K The role of CXCR1, CXCR2, CXCR3, CXCR5, and CXCR6 ligands in molecular cancer processes and clinical aspects of acute myeloid leukemia (AML) Cancers (Basel) 2023 15 18 4555 10.3390/cancers15184555 37760523 PMC10526350 Korbecki J, Kupnicka P, Barczak K, et al. The role of CXCR1, CXCR2, CXCR3, CXCR5, and CXCR6 ligands in molecular cancer processes and clinical aspects of acute myeloid leukemia (AML). Cancers (Basel). 2023;15(18):4555. 10.3390/cancers15184555. 37760523 10.3390/cancers15184555 PMC10526350

58. Rombouts EJ Pavic B Löwenberg B Ploemacher RE Relation between CXCR-4 expression, Flt3 mutations, and unfavorable prognosis of adult acute myeloid leukemia Blood 2004 104 2 550 7 10.1182/blood-2004-02-0566 15054042 Rombouts EJ, Pavic B, Löwenberg B, Ploemacher RE. Relation between CXCR-4 expression, Flt3 mutations, and unfavorable prognosis of adult acute myeloid leukemia. Blood. 2004;104(2):550–7. 10.1182/blood-2004-02-0566. 15054042 10.1182/blood-2004-02-0566

59. Yang J Zhang P Mao Y CXCR4-Mediated codelivery of FLT3 and BCL-2 inhibitors for enhanced targeted combination therapy of FLT3-ITD acute myeloid leukemia Biomacromolecules 2024 25 7 4569 80 10.1021/acs.biomac.4c00561 38869359 Yang J, Zhang P, Mao Y, et al. CXCR4-Mediated codelivery of FLT3 and BCL-2 inhibitors for enhanced targeted combination therapy of FLT3-ITD acute myeloid leukemia. Biomacromolecules. 2024;25(7):4569–80. 10.1021/acs.biomac.4c00561. 38869359 10.1021/acs.biomac.4c00561

60. Jia Y Zhang W Basyal M FLT3 inhibitors upregulate CXCR4 and E-selectin ligands via ERK suppression in AML cells and CXCR4/E-selectin Inhibition enhances anti-leukemia efficacy of FLT3-targeted therapy in AML Leukemia 2023 37 6 1379 83 10.1038/s41375-023-01897-x 37085610 PMC10244167 Jia Y, Zhang W, Basyal M, et al. FLT3 inhibitors upregulate CXCR4 and E-selectin ligands via ERK suppression in AML cells and CXCR4/E-selectin Inhibition enhances anti-leukemia efficacy of FLT3-targeted therapy in AML. Leukemia. 2023;37(6):1379–83. 10.1038/s41375-023-01897-x. 37085610 10.1038/s41375-023-01897-x PMC10244167

61. Cao H Tadros V Hiramoto B Targeting TKI-Activated NFKB2-MIF/CXCLs-CXCR2 signaling pathways in FLT3 mutated acute myeloid leukemia reduced blast viability Biomedicines 2022 10 5 1038 10.3390/biomedicines10051038 35625776 PMC9138861 Cao H, Tadros V, Hiramoto B, et al. Targeting TKI-Activated NFKB2-MIF/CXCLs-CXCR2 signaling pathways in FLT3 mutated acute myeloid leukemia reduced blast viability. Biomedicines. 2022;10(5):1038. 10.3390/biomedicines10051038. 35625776 10.3390/biomedicines10051038 PMC9138861

62. Schinke C Giricz O Li W IL8-CXCR2 pathway Inhibition as a therapeutic strategy against MDS and AML stem cells Blood 2015 125 20 3144 52 10.1182/blood-2015-01-621631 25810490 PMC4432009 Schinke C, Giricz O, Li W, et al. IL8-CXCR2 pathway Inhibition as a therapeutic strategy against MDS and AML stem cells. Blood. 2015;125(20):3144–52. 10.1182/blood-2015-01-621631. 25810490 10.1182/blood-2015-01-621631 PMC4432009

63. Täger M Horn S Latuske E SHIP1, but not an AML-derived SHIP1 mutant, suppresses myeloid leukemia growth in a xenotransplantation mouse model Gene Ther 2017 24 11 749 53 10.1038/gt.2017.88 29143813 Täger M, Horn S, Latuske E, et al. SHIP1, but not an AML-derived SHIP1 mutant, suppresses myeloid leukemia growth in a xenotransplantation mouse model. Gene Ther. 2017;24(11):749–53. 10.1038/gt.2017.88. 29143813 10.1038/gt.2017.88

64. Gorji M Farsani MA Kargar M Garavand J Mohammadi MH Investigating the multifaceted Cooperation of autophagy, PI3K/AKT signaling pathways, and INPP4B gene in de Novo acute myeloid leukemia patients Curr Res Transl Med 2024 72 2 103429 10.1016/j.retram.2023.103429 38246071 Gorji M, Farsani MA, Kargar M, Garavand J, Mohammadi MH. Investigating the multifaceted Cooperation of autophagy, PI3K/AKT signaling pathways, and INPP4B gene in de Novo acute myeloid leukemia patients. Curr Res Transl Med. 2024;72(2):103429. 10.1016/j.retram.2023.103429. 38246071 10.1016/j.retram.2023.103429

65. Estruch M Vittori C Montesinos TM Reckzeh K Theilgaard-Mönch K Targeting of PI3K/AKT signaling and DNA damage response in acute myeloid leukemia: a novel therapeutic strategy to boost chemotherapy response and overcome resistance Cancer Drug Resist 2021 4 4 984 95 10.20517/cdr.2021.76 35582388 PMC8992442 Estruch M, Vittori C, Montesinos TM, Reckzeh K, Theilgaard-Mönch K. Targeting of PI3K/AKT signaling and DNA damage response in acute myeloid leukemia: a novel therapeutic strategy to boost chemotherapy response and overcome resistance. Cancer Drug Resist. 2021;4(4):984–95. 10.20517/cdr.2021.76. 35582388 10.20517/cdr.2021.76 PMC8992442

66. Gu H Chen C Hou ZS PI3Kγ maintains the self-renewal of acute myeloid leukemia stem cells by regulating the Pentose phosphate pathway Blood 2024 143 19 1965 79 10.1182/blood.2023022202 38271660 PMC11103183 Gu H, Chen C, Hou ZS, et al. PI3Kγ maintains the self-renewal of acute myeloid leukemia stem cells by regulating the Pentose phosphate pathway. Blood. 2024;143(19):1965–79. 10.1182/blood.2023022202. 38271660 10.1182/blood.2023022202 PMC11103183

67. Wang Y Li Z Li J Sun C LncRNA NEAT1 promotes MPP + induced injury of PC12 cells and accelerates the progression of parkinson’s disease in mice through FUS mediated Inhibition of PI3K/AKT/mTOR signalling pathway Exp Gerontol 2024 191 112436 10.1016/j.exger.2024.112436 38636570 Wang Y, Li Z, Li J, Sun C. LncRNA NEAT1 promotes MPP + induced injury of PC12 cells and accelerates the progression of parkinson’s disease in mice through FUS mediated Inhibition of PI3K/AKT/mTOR signalling pathway. Exp Gerontol. 2024;191:112436. 10.1016/j.exger.2024.112436. 38636570 10.1016/j.exger.2024.112436

68. Li O Jiang B Yi WM LncRNA NEAT1 promotes cell proliferation, migration, and invasion via the miR-186-5p/PTP4A1 axis in cholangiocarcinoma Kaohsiung J Med Sci 2021 37 5 379 91 10.1002/kjm2.12354 33502823 PMC11896218 Li O, Jiang B, Yi WM, et al. LncRNA NEAT1 promotes cell proliferation, migration, and invasion via the miR-186-5p/PTP4A1 axis in cholangiocarcinoma. Kaohsiung J Med Sci. 2021;37(5):379–91. 10.1002/kjm2.12354. 33502823 10.1002/kjm2.12354 PMC11896218

69. Wu D Li H Wang J LncRNA NEAT1 promotes gastric cancer progression via miR-1294/AKT1 axis Open Med (Wars) 2020 15 1 1028 38 10.1515/med-2020-0218 33336058 PMC7718639 Wu D, Li H, Wang J, et al. LncRNA NEAT1 promotes gastric cancer progression via miR-1294/AKT1 axis. Open Med (Wars). 2020;15(1):1028–38. 10.1515/med-2020-0218. 33336058 10.1515/med-2020-0218 PMC7718639

70. Xu H Li J Zhou ZG NEAT1 promotes cell proliferation in multiple myeloma by activating PI3K/AKT pathway Eur Rev Med Pharmacol Sci 2018 22 19 6403 11 10.26355/eurrev_201810_16053 30338809 Xu H, Li J, Zhou ZG. NEAT1 promotes cell proliferation in multiple myeloma by activating PI3K/AKT pathway. Eur Rev Med Pharmacol Sci. 2018;22(19):6403–11. 10.26355/eurrev_201810_16053. 30338809 10.26355/eurrev_201810_16053

71. Shang FM Li J A small-molecule antagonist of CXCR1 and CXCR2 inhibits cell proliferation, migration and invasion in melanoma via PI3K/AKT pathway Med Clin (Barc) 2019 152 11 425 30 10.1016/j.medcli.2018.08.006 30340844 Shang FM, Li J. A small-molecule antagonist of CXCR1 and CXCR2 inhibits cell proliferation, migration and invasion in melanoma via PI3K/AKT pathway. Med Clin (Barc). 2019;152(11):425–30. 10.1016/j.medcli.2018.08.006. 30340844 10.1016/j.medcli.2018.08.006