Theranostic Potentials of Gold Nanomaterials in Hematological Malignancies.

1. Introduction

Hematological malignancies (HMs) are a heterogeneous group of blood neoplasms that are different from solid tumors, especially because of the presence of bone marrow (BM) suppression or failure symptoms [ 1 ]. In 2020, about 1.3 million people were diagnosed with HMs, while 0.7 million died due to HMs [ 2 ]. HMs comprise about 50% of all malignancies in children and 5%–8% of adult malignancies [ 3 ]. The pathology and physiology of HMs, irrespective of their indolent or aggressive stage, affect patients of all ages [ 4 ]. Therefore, early-diagnosis techniques and effective therapeutic regimes are needed to tackle this deadly disease.

Advanced molecular-biology techniques, including polymerase chain reaction (PCR), flow cytometry (FC), fluorescence in situ hybridization, immunocytochemical, immunophenotyping, karyotype analysis, and next-generation sequencing (NGS), offer a radical improvement in the diagnosis of HMs [ 4 , 5 ]. Among these techniques, NGS, PCR, and FC are the most commonly used to diagnose minimal-residual disease (MRD), a condition when residual HMs are present [ 6 , 7 , 8 ]. For example, PCR and FC techniques can be used to detect B cell immunoglobulin (lg) and its rearrangement to monitor disease progression as well as exosome-based MRD identification [ 9 , 10 ]. Similarly, significant advancement has been achieved in the treatment of HMs [ 11 , 12 , 13 ]. Immunotherapy, radioimmunotherapy, radiotherapy, chemotherapy, hematopoietic-cell transplantation, and BM transplantation improve the survival of patients with HMs [ 13 , 14 , 15 , 16 ]. However, due to the heterogeneity and long-term indolent phase, early diagnosis and treatment of HMs remain a challenging issue [ 12 , 17 , 18 , 19 ]. Additionally, following therapy, accurate diagnosis of MRD sometimes could not be possible due to false-negative or false-positive results from PCR, FC, and NGS tests [ 20 , 21 , 22 ]. Furthermore, false-negative results from FC were reported as false-positive in PCR in the diagnosis of MRD [ 23 ]. Therefore, sensitive and reliable HMs-diagnosis methods are still in demand, especially when a deficient level of MRD biomarker is present in the test sample [ 24 ]. Likewise, novel therapeutic approaches are urgently needed for HMs to overcome drug resistance, prevent cancer relapse, reduce side effects, improve selectivity and efficacy of currently used drugs, and, finally, enhance patient survival and quality of life [ 11 , 19 , 25 , 26 ].

Gold nanomaterials (GNMs) are 1–100 nm-sized nanomaterials of different shapes (e.g., nanorods, nanospheres, and nanocubes) composed of gold ( Figure 1 ) [ 27 , 28 ]. Recently, GNMs have drawn considerable attention as cancer theranostic agents, a term that combines cancer diagnosis with therapy [ 27 , 29 ]. In diagnosis, the binding event between GNMs and analytes can change the physicochemical properties of GNMs, such as magnetic resonance (MR), surface-plasmon resonance (SPR), redox behavior, and conductivity, leading to distinguishable signals [ 30 , 31 ]. Due to the MR and SPR phenomenon, GNMs have become attractive candidates for magnetic-resonance imaging (MRI), colorimetric sensor, electrochemical sensor, and many cancer diagnoses [ 28 , 30 , 32 ]. Similarly, due to their unique properties and high surface area, GNMs function as practical platforms for binding multifunctional therapeutic moieties, including drugs, nucleic acids, peptides, and targeting biomolecules [ 30 , 33 ]. GNMs modified with therapeutic agents can be applied for a range of therapeutic applications including photodynamic therapy (PDT), photothermal therapy (PTT), radiation therapy (RDT), targeted drug delivery, and more [ 27 , 28 ]. Furthermore, GNMs can improve the efficacy and minimize the side effects of chemotherapeutic drugs by selective targeting [ 32 ]. Therefore, GNMs conjugation may improve the selectivity index of chemotherapeutic drugs, making them more biocompatible to normal healthy cells [ 27 , 32 ].

Recently, Huang et al. (2022) [ 34 ] reported on the applications of metal nanomaterials in the diagnosis and treatment of HMs. However, detailed discussions on GNMs were not observed in that review [ 34 ]. In the current review, we included research articles published before February 2021 that covered our topics of interest (i.e., GNMs and HMs). “Gold” and “leukemia”, “leukemias”, “leukaemia”, “leukaemias”, “lymphoma”, “lymphomas”, “myeloma”, “myelofibrosis”, “polycythemia vera”, “thrombocythemia”, “myelodysplastic syndromes”, and “myeloproliferative neoplasms” keywords were searched in the article title from four scientific databases (Google Scholar, Scopus, Web of Science, and PubMed).

In this review, we scrutinized the promise and challenges of using GNMs in the diagnosis and treatment of HMs. As a diagnostic agent, their accuracy, reliability, and sensitivity were investigated along with their therapeutic efficacy, potency, selectivity, mechanism of action(s), biocompatibility, and therapeutic limitations.

2. Hematological Malignancies

HMs are a group of heterogeneous diseases of diverse incidence, etiology, and prognosis [ 36 ]. Based on population-based studies, HMs are grouped into three broad categories: lymphoma, leukemia, and myeloma [ 2 , 37 ]. Among these three classes, lymphoma and leukemia are more prevalent HMs ( Figure 2 ) [ 2 ]. Overall, the incidence of HMs appears to be increasing, but the epidemiology of HMs is unpredictable, mainly in Europe [ 37 , 38 ].

Genetic or epigenetic changes within normal hematopoietic cells turn them into malignant hematopoietic cells through dysregulation of proliferation, differentiation, and self-renewal ( Figure 3 ) [ 41 , 42 , 43 ]. Three types of genes are linked with the etiopathogenesis of HMs: tumor-suppressor genes, oncogenes, and genes that offer genome stability [ 43 ]. Identification of the mutated genes or their molecular changes is helpful in differentiating histoclinical changes, therapeutic target sections, monitoring therapeutic effects, and disease progression [ 43 , 44 ]. Furthermore, the cBioPortal ( https://www.cbioportal.org/ , accessed on 29 January 2022) database [ 45 , 46 ] has shown that gene-mutation frequency varies in different HMs classes. Figure 1 b,c illustrates the top ten mutations in leukemia and lymphoma patients according to the cBioPortal, which calculated the published data on leukemia [ 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 ] and lymphoma [ 57 , 58 , 59 , 60 , 61 , 62 , 63 , 64 , 65 , 66 , 67 , 68 , 69 , 70 ].

3. Gold-Nanomaterial-Based Diagnosis

GNMs-based molecular diagnosis of HMs can be placed into the following categories: (1) detection of leukemia or lymphoma cells based on unique antigen-receptor genes of T- and B-cells, (2) detection of genetic mutation(s), (3) identification of chromosomal deletions, translocations, or duplications, and (4) proteomic changes [ 71 , 72 , 73 , 74 ]. This section will report the accuracy, specificity, and reliability of aptamer, biocompatible polymer, antibody, nucleic acid, or ligand-tuned GNMs in the diagnosis of HMs.

3.1. Detection of Cancer Cells

Haghighi et al., (2020) [ 71 ] reported that gold nanocluster (GNC) modified with Fe3O4 and KH1C12 aptamer selectively diagnosed highly malignant HL-60 human-leukemia cells from a mixture of different cells. This nanoprobe could be used in MRI imaging (T 2 -based) or fluorescent-microscopy-based diagnosis of leukemia cells (as low as 10 cells μL −1 ). The fluorescent signal increased with an increase in nanoprobe concentration, while such an increase in the nanoprobe decreased the T 2 -based contrast. A major limitation of this study was no normal or cancerous cell line of blood origin was used as control. Only HepG2, liver-cancer cells were used as control (KH1C12-negative cells). Additionally, the authors claimed the biocompatibility of this nanoprobe toward both HL-60 and HepG2 compared to doxorubicin (Dox). However, the applied concentration of the nanoprobe was more than 1000 times lower than Dox. Furthermore, as no selectivity index was calculated, therefore, it would not be wise to consider a KH1C12-aptamer-based nanoprobe as a biocompatible probe, based on the current results [ 71 ]. In another study, AuNPs-coated magnetic Fe3O4 nanoparticles (AuIONPs) were used to immobilize thiolated sgc8c aptamer (Apt-AuIONPs). Then, ethidium bromide (EB) was added to intercalate into the stem of the aptamer hairpin. When human acute lymphoblastic leukemia (ALL) CCRF-CEM cells containing solution were placed onto the Apt-AuIONPs, the CCRF-CEM cells disrupted the hairpin structure of the aptamer to release EB, resulting in a decrease in the electrochemical signal. The read-out signal could be amplified by immobilizing nitrogen-doped graphene nanosheets on the electrode surface. The aptasensor reported detecting as low as 10 CCRF-CEM cells/mL under optimal conditions. This aptasensor selectively diagnosed leukemia from control (Romas) cells, a type of human Burkitt’s lymphoma cells [ 73 ]. Moreover, this aptasensor could diagnose 10 leukemia cells at 1000 times diluted condition, compared to Haghighi et al.’s (2020) developed aptamer [ 71 , 73 ]. The selectivity of sgc8c aptamer toward CCRF-CEM cells was also confirmed by Shan et al. (2014) [ 75 ]. AuNPs modified with aminophenyl boronic acid (APBA-AuNPs) were used to immobilize the aptamer, and APBA-AuNPs were also reported to bind with the CCRF-CEM cell membrane. Then, the application of silver metal caused signal enhancement, and a change in signal could be detected by both quartz-crystal microbalance (QCM) and fluorescence microscopy. Like the previous study, this nanoprobe selectively diagnosed CCRF-CEM cells from the Romas cells [ 75 ]. However, the detection limit of 1160 cells/mL indicated that Khoshfetrat et al. (2017) developed a nanoprobe that was more effective in the diagnosis of a small proportion of leukemia cells in the test sample ( Table 1 ) [ 73 , 75 ].

3.2. Detection of Cancer-Associated Biomarkers

3.2.1. Surface-Antigen Detection

Accurate and sensitive detection of ALL antigen (CD10) plays a crucial role in determining the diagnosis and prognosis of hematopoietic tumors (e.g., ALL and follicle center-cell lymphoma) and other malignancies. AuNPs-based label-free immunosensor containing Ab2 antibody detects CD10 by QCM. It should be noted that a higher frequency shift was seen when the CD10 was present alone or in antigen mixture (CD10, CD19, and CD20). This technique could be used in the quantitative detection of CD10 at a concentration range of 1.0 × 10 −8 to 1.0 × 10 −11 M ( Table 1 ) [ 76 ]. Similarly, MacLaughli et al. (2012) [ 79 ] developed AuNPs conjugated with polyethylene glycol (PEG) and CD molecules specific monoclonal antibodies to diagnose chronic lymphocytic leukemia (CLL). CD20 expressed CLL cells were diagnosed using surface-enhanced Raman spectroscopy and dark-field microscopy. This technique could also be used to detect cell surface CD19, CD45, and CD5 after conjugating with their corresponding antibodies [ 79 ]. It should be noted that MacLaughli et al. (2012) and Yan et al. (2015) did not conduct any experimentation using leukemia cells or clinical samples. An analysis using a clinical sample could confirm the sensitivity and reliability of their detection procedure [ 76 , 79 ]. Similarly, Nguyen et al. (2010) [ 80 ] synthesized surface-enhanced Raman-scattering (SERS) AuNPs for selective targeting and diagnosis of CLL. SERS AuNPs were grafted with PEG to prevent aggregation and conjugated with anti-CD19 antibodies (CD19-Ab) for selective targeting of CD19, an overexpressed marker in CCL patients. Raman spectroscopy and dark-field microscopy confirmed that the CD19-Ab functionalized SERS AuNPs diagnosed Giemsa-stained CCL cells (isolated from CLL patients) with reliable accuracy. While staining with anti-CD4, antibody-coated SERS AuNPs neither visualized CCL cells in the dark field nor showed any signs of Raman-fingerprint spectra ( Figure 4 ) [ 80 ].

A similar antibody-based overexpressing marker targeting strategy has been reported in lymphoma diagnosis. AuNPs conjugated with an ACT-1 antibody (AuNPs-ACT-1), which interacted with CD25, a lymphoma biomarker. AuNPs-ACT-1 enhanced the visualization of CD25, expressing Karpas 299 lymphoma cells at 750 nm laser in a multi-photon microscopy system. It is noted that no CD25 negative cell line was used in this study to validate experimental outcomes or to observe antibody cross-reactivity [ 83 ]. Moghiseh et al. (2018) [ 84 ] synthesized rituximab (R-Ab)-conjugated AuNPs (R-Ab-AuNPs) for selective detection of lymphoma using spectral-photon-counting computed tomography (SPCT). R-Ab is a well-known monoclonal antibody that selectively binds with CD20-expressed Raji (lymphoma cancer) cells. SPCT images confirmed that R-Ab-AuNPs-treated Raji cells had a higher volume and brighter hue compared to controls (water, gold chlorides, or trastuzumab-AuNPs), reflecting the presence of AuNPs at higher concentrations. This strategy also displayed similar results in detecting Herceptin 2-positive SKBR3 breast-cancer cells using the trastuzumab (Herceptin 2-targeting antibody) [ 84 ]. Studies using clinical samples could give a precise idea about the diagnostic outcomes.

3.2.2. Detection of Receptor Overexpression

Folic acid (FA) receptor α overexpression occurs in different solid malignancies, for example, breast, ovary, uterus, cervix, colon, kidney, brain, and testicular cancers, while β receptor overexpresses in human leukemia cells [ 85 ]. Ge et al. (2014) [ 81 ] synthesized FA-conjugated porous palladium-gold nanoparticles Pd@AuNPs (FA-Pd@AuNPs) for detection of FA-receptor overexpressed cancer cells. Pd@AuNPs mimic natural peroxidase activity. In the presence of H 2 O 2 , FA-Pd@AuNPs produced hydroxyl radicals (•OH), which interact with 3,3′,5,5′-tetramethylbenzidine to form a blue-color product. Experimentation using K562 (chronic myeloid leukemia), A549 (non-small cell lung cancer), MCF-7 (breast cancer cells), H9c2 (cardiac myocytes), and normal cells confirmed that FA-Pd@AuNPs showed excellent sensitivity and selectivity in the detection of FA antibody) [ 84 ]. Studies using clinical samples could give a precise idea about the diagnostic outcomes.

3.2.3. Detection of Receptor Overexpression

Folic acid (FA) receptor α overexpression occurs in different solid malignancies, for example, breast, ovary, uterus, cervix, colon, kidney, brain, and testicular cancers, while β receptor overexpresses in human leukemia cells [ 85 ]. Ge et al. (2014) [ 81 ] synthesized FA-conjugated porous palladium-gold nanoparticles Pd@AuNPs (FA-Pd@AuNPs) for detection of FA-receptor overexpressed cancer cells. Pd@AuNPs mimic natural peroxidase activity. In the presence of H 2 O 2 , FA-Pd@AuNPs produced hydroxyl radicals (•OH), which interact with 3,3′,5,5′-tetramethylbenzidine to form a blue-color product. Experimentation using K562 (chronic myeloid leukemia), A549 (non-small-cell lung cancer), MCF-7 (breast-cancer cells), H9c2 (cardiac myocytes), and normal cells confirmed that FA-Pd@AuNPs showed excellent sensitivity and selectivity in the detection of FA overexpressed K652 and A549 cells. Detection limit for K652 cells was 28 cells/mL ( Figure 5 a) [ 81 ]. Similarly, Ai et al. (2012) [ 77 ] prepared fluorescein isothiocyanate (FITC)-labeled FA-conjugated AuNPs (FITC-FA-AuNPs) for targeting FA receptors in cancer cells. FITC functions as a fluorescent reporter, and FITC-containing cells emit a green fluorescence signal. Confocal-microscopy images confirmed that FITC-FA-AuNPs were uptaken by both HeLa cells (human epithelial cervical cancer) and CERF-CEM cells ( Figure 5 b). Additionally, the MTT assay showed that FITC-FA-AuNPs were biocompatible with HeLa cells. Experimentation using a normal cell line could confirm the selectivity and reliability of the FITC-FA-AuNPs in leukemia detection [ 77 ].

3.2.4. Nucleic-Acids Biomarker Detection

Acute myeloid leukemia (AML) cells express Wilm’s tumor (WT1) gene. However, WT1 levels in plasma are extremely low. AML patients carrying MRD release a low amount of WT1 [ 24 ]. Mehn et al. (2014) [ 24 ] developed gold-coated maghemite (γ-Fe 2 O 3 ) nanoparticles functionalized with thiolated single-stranded DNA (ssDNA), complementary to the WT1 sequence, which act as Raman signal amplifiers. The ssDNA-functionalized nanoparticles detected DNA containing a WT1 sequence (XGGGCGTGTGACCGTAGCTTTAACC CTGATTGCGAATAGCG, where X = Amino C6 labeled with malachite green) using surface-enhanced Raman spectroscopy ( Figure 6 a). The major limitations of this approach were no clinical sample was examined, and the clinical sample will need to be labeled with Raman reporter-dye molecules [ 24 ]. Likewise, Ensafi et al. (2011) [ 72 ] constructed a porphobilinogen deaminase (PBGD) gene-detection probe. The PBGD gene is highly associated with CLL. Self-assembled AuNPs were conjugated with a thiol group (–SH)-modified DNA to prepare a PBGD probe that could hybridize with the complementary segment of the target DNA. This electrochemical probe showed reproducible and reliable results (at about 40 °C) in the detection of the target oligonucleotides sequence in human serum, by electrochemical impedance spectroscopy (EIS) ( Figure 6 b). The detection limit of the complementary oligonucleotides-sequence concentrations was 1.0 × 10 −12 mol/L [ 72 ].

Fusion of the Abelson murine leukemia (ABL1) gene located on chromosome nine (9), with the breakpoint cluster region (BCR) gene located on chromosome twenty-two (22), form an aberrant chromosome called Philadelphia chromosome [ 86 ]. Mazloum-Ardakani et al. (2018) developed a DNA electrochemical biosensor using poly(catechol), graphene sheets, AuNPs, and –SH modified ssDNA to detect BCR-ABL gene fusion in ALL. Here, graphene sheets enhanced the conductivity of poly (catechol), while -SH modified ssDNA hybridized with the target DNA sequence. This biosensor could detect the target DNA using different robust methods, including EIS, differential-pulse voltammetry (DPV), chronoamperometry, and cyclic voltammetry ( Table 1 ), with a detection limit that was a 1.0 pM target DNA strand [ 78 ]. In chronic myeloid leukemia (CML), BCR-ABL fusion (e13a2 and e14a2) is one of the most common molecular alterations [ 82 ]. A standard PCR test may provide false-negative results in diagnosing e13a2 BCR-ABL fusion in CML [ 18 ]. Cordeiro et al. (2016) [ 82 ] developed AuNPs-based gold-nano beacons (Au-Nbac), in combination with Förster resonance energy transfer-based spectral codification, to detect e13a2 and e14a2 fusion. Au-Nbac showed high specificity in the detection of e13a2 and e14a2 fusion. A major concern of this strategy is false-positive results, due to cross-reactivity of ABL- or BCR-expressed mRNAs from a healthy donor. Analysis of clinical samples could draw conclusive results regarding the sensitivity and specificity of this technique [ 82 ]. Previously, Lin et al. (2010) used a thiolated hairpin-locked nucleic acids (LNA)-probe immobilized on the gold (Au) electrode (via sulfur Au interaction) to diagnose BCL–ABL fusion in CML. The hybridization reaction on the LNA probe electrode was monitored through DPV, and this strategy showed satisfactory outcomes in the diagnosis of BCL–ABL fusion from clinical samples [ 87 ].

3.2.5. Proteomic Biomarker Detection

In cancer cells, proteomic changes are a common phenomenon and have drawn attention as a cancer biomarker. Magnetite (Fe 2 O 3 ) partially coated with strawberry-like AuNPs (Fe@Au), in combination with mass spectrometry, diagnosed plasma-protease C1 inhibitor and heat-shock protein HSP75 as multiple-myeloma biomarkers. The study was conducted on male multiple-myeloma patients ( n = 5) and these biomarkers were identified, comparing the expression pattern of 53 patient-derived proteins with healthy controls ( n = 2) [ 74 ].

4. Gold-Nanomaterial-Based Treatments in Hematological Malignancies

The conjugation of bio-polymers, nucleic acids, antibodies, peptides, chemotherapeutic drugs, natural-bioactive compounds, or HMs targeting ligands with GNMs enhanced the therapeutic potential of these anticancer agents against HMs. GNMs-based photothermal therapy, photodynamic therapy, radiotherapy, gene therapy, and targeted drug delivery of natural or synthetic anticancer agents not only improved therapeutic outcomes but also helped to overcome drug resistance, reduction in cytotoxicity, and side effects.

4.1. Photothermal Therapy

PTT is a non-invasive therapeutic tool that depends on hyperthermia to eradicate cancer cells with minimum side effects [ 88 , 89 ]. Cells are subjected to the 41–47 °C temperature range at hyperthermic conditions. In this condition, denaturation of protein or cell membrane causes irreversible damage to the cells [ 88 ]. Laser, ultrasound, or microwave-based heating methods can be used to achieve PTT [ 27 ]. GNMs can capture electromagnetic energy and convert it into heat via the photothermal effect, thereby making them a suitable agent for the PTT [ 90 , 91 ]. Due to the higher light absorption and energy-conversion capacity, smaller GNMs are usually preferred for PTT [ 92 ].

Antibody-loaded AuNPs can be used for targeting HMs-specific surface receptors and, thereby, HMs. Lapotko et al. (2005) [ 3 ] used two monoclonal antibodies (primary and secondary) for targeting K562 myeloid cells. K562 cells were treated with primary antibody followed by a secondary antibody (IgG)-loaded AuNPs (AuNPs-IgG)-cluster to select leukemia cells. After that, radiation (at 532 nm) was applied from a wide-beam single-laser pulse at 5 J/cm, which destroyed AuNPs-IgG-treated cells, while cell viability did not change in the AuNPs-treated group. This laser-activated nanothermolysis strategy could be used for leukemia-cell elimination [ 3 ]. Lapotko et al. (2006) [ 93 ] later showed that the AuNPs-based dual antibody-based leukemia targeting is also effective against patient-derived leukemia cells. ALL cells derived from patients ( n = 3) were targeted using CD-10, CD-19, and CD-20 monoclonal antibody (MAB-1), specified for three patients. Then, treatment of secondary antibody (MAB-2)-loaded AuNPs clustered along with laser irradiation (at 532 nm, 0.6 J/cm 2 ) for 10 nanoseconds caused 98.5%–99.9% destruction of ALL cells by photothermally produced microbubbles. On the other hand, the same treatment induced 16%–23% death of normal BM cells derived from healthy individuals ( Figure 7 ) [ 93 ]. Longer-wavelength (650–900 nm) radiations are more compatible with normal RBCs; therefore, AuNPs that absorb longer wavelengths could be used for clinical application [ 3 ].

PEG-modified GNR fabricated with anti-CD33 antibody (anti-CD33-Ab) exhibited about 2 to 2.5-fold higher antiproliferative activity toward HL-60 cells and K562 cells, respectively, at a 500 pM concentration compared to anti-CD33 antibody alone. Interestingly, PEG-GNR displayed excellent biocompatibility against both the cell lines up to 1 nM concentration [ 94 ]. As anti-CD33-Ab-PEG-GNR displayed higher cytotoxic activity toward HL-60 cells, Liopo et al. (2011) [ 94 ] further conducted experimentation by using HL-60 cells. A single high- or low-fluence laser irradiation at 755 nm of wavelength for 45 min, into the CD33-Ab-PEG-GNR (250 pM)-treated HL-60 cells, displayed three- to four-fold more antiproliferative activity compared to the control (laser only) [ 94 ]. It should be noted that the anti-CD33 antibody already got approval for AML treatment [ 95 ]; therefore, CD33-Ab-PEG-GNR could be used to treat AML.

Yang et al. (2014) [ 96 ] loaded anti-CD138 antibody (anti-CD138-Ab) on the surface of PEG-modified hollow AuNPs (anti-CD138-Ab-PEG-AuNPs) that selectively target A20 lymphoma cells. Treatment of female BALB/c mice with anti-CD138-Ab-PEG-AuNPs followed by NIR treatment (after 24 h) significantly decreased lymphoma growth and IgG2a expression at 4 days compared to a control. An increase in IgG2a level corresponds with higher A20 cell proliferation. It should be noted that anti-CD138-Ab exhibited more selectively toward A20 cells than R-Ab, and the tunable band for hollow AuNPs was 520–950 nm. These findings indicated that anti-CD138-Ab-PEG-AuNPs could be used for PTT-based lymphoma treatment [ 96 ].

4.2. Photodynamic Therapy

PDT is another non-invasive therapeutic modality that damages or kills tumor cells through the use of ROS such as •OH, superoxide anion (O 2 •− ), and singlet oxygen ( 1 O 2 ) generated photochemically [ 97 , 98 ]. Upon irradiation of light at specific wavelengths, a photosensitizer (or light-sensitizing agent) may convert endogenous O 2 to 1 O 2 to induce cell necrosis or apoptosis [ 99 ]. Like PTT, PDT offers a localized treatment where the cell destruction is limited to the photosensitizer’s located region. Therefore, PDT shows better selectivity and fewer side effects than conventional chemotherapy [ 97 ]. GNMs transport the hydrophilic photosensitizer to the target cells [ 98 , 100 ].

In PDT, 1 O 2 has a very short lifetime (several microseconds) in aqueous environments [ 101 ] and about 20 nm cellular-diffusion distance [ 102 ]. Moreover, cytotoxic 1 O 2 has a very short radius for action compared to the size of cancer cells (>10 μm) and the intracellular distance [ 101 ]. Sgc8-Aptarmer (Apt) exhibited selectivity toward leukemia cells, as mentioned earlier, and Apt-based selective targeting could effectively deliver the 1 O 2 . Wang et al. (2013) [ 103 ] conjugated hydrophobic chlorin e6 (Ce6) photosensitizer molecules on the surface of Apt-fabricated GNR (Ce6-Apt-GNR). In PDT, irradiation of white light reduced the viability of Ce6-Apt-GNR-targeted CCRF-CEM cells to about 74.5%, hile NIR-laser irradiation (812 nm) for 10 min decreased cell viability to around 63%, due to the PTT killing of CCRF-CEM cells. The combination of white light and NIR-laser irradiation dramatically reduced the cell viability to below 32%. Results indicated that Ce6-Apt-GNR increased the photodestruction efficiency through dual-modal PDT and PTT therapy. PDT, PTT, or PDT/PTT caused a significant reduction in cell viability compared to an untreated control. On the other hand, Ce6-Apt-GNR displayed less phototoxic (cell viability remained at nearly 90%) effects on Ramos cells (non-target) [ 103 ]. As Ce6 shows low toxicity, it could be used as a photosensitizer in HMs treatment. Philchenkov et al. (2014) [ 104 ] later reported that Ce6 conjugation with AuNPs (Ce6-AuNPs) had no photo-enhancement effect toward Jurkat and Jurkat/A4 (subline of Jurkat cells with a multidrug-resistance phenotype) compared to free Ce6. Laser radiation at 633 nm decreased apoptosis by about 10% in Ce6-AuNPs-treated Jurkat/A4 cells compared to free Ce6, while Ce6-AuNPs acted as a potent free Ce6 against Jurkat cells ( Figure 6 ) [ 104 ]. These findings prove that Apt-based targeting is crucial in Ce6 delivery to leukemia cells.

An intermediate of the heme biosynthesis pathway, 5-aminolevulinic acid (5-ALA) is an FDA-approved photosensitizing precursor for PDT in actinic keratosis treatment and as an imaging agent to visualize cancer cells during glioma surgery [ 105 ]. Zhan et al. (2015) [ 106 ] grafted 5-ALA with AuNPs (5-ALA-AuNPs) via electrostatic bonding for PDT. These 5-ALA-AuNPs enhanced 1 O 2 generation and its efficiency depends on the light sources. The viability of K562 cells decreased significantly compared to ALA alone in all three light sources: a 502 nm light-emitting diodes (LEDs), xenon lamp, and 635 nm continuous-wavelength semiconductor laser. Among these three light sources, 5-ALA-AuNPs were highly effective at LEDs in reduction (nearly 70%) in K562 cell viability compared to xenon lamp (~50%) and a 635 nm laser (~56%). AuNPs enhanced K562 cell-killing through its delivery activity of 5-ALA, not by 1 O 2 generation or local-field enhancement [ 106 ].

4.3. Radiation Therapy

Ionizing radiation causes significant lymphocytopenia when administered to target volumes [ 107 ]. To destroy cancer cells, fractionated focal irradiation is often given to cancer patients either singly or in combination with other therapies [ 33 , 108 ]. Local radiation decreased all lymphocyte subsets in the systemic circulation, especially the B-cell and naive T-cell population [ 107 ]. PEG-modified AuNPs (AuNPs-PEG) were uptaken by leukemic HL-60 II (p53 null) and Jurkat cells to a similar extent, although there was no targeting moiety. Interestingly, AuNPs-PEG (15 nm) with 5 Gy external radiation showed a higher sensitivity enhancement ratio against HL-60 II (1.33) compared to Jurkat cells (1.18). While AuNPs-PEG and radiation had no synergistic effects on the Jurkat cells, the combination therapy decreased 3.9% of the s-phase in the HL-60 II cell population compared to radiation alone, indicating combination therapy reduced actively replicating cell percentages. Additionally, these synergetic effects significantly changed the metabolic activity of HL-60 II cells than radiation alone [ 108 ].

4.4. Gene Therapy

Gene therapy is another cancer therapeutics approach, where the gene responsible for cancer development modulates to become silent [ 109 ]. The use of miRNA or siRNA combination in targeting oncogenes could offer dual modulation and inhibition of oncogenes within the same signaling pathway. Furthermore, a combination of many siRNA sequences to modulate cancer may increase therapeutic efficacy [ 110 , 111 ]. AuNPs have become attractive vehicles for carrying gene-silencing moieties, either alone or in combination with other anticancer drugs [ 109 ].

Tyrosine-kinase inhibitors (TKIs) control downstream signaling involved in differentiation arrest, enhanced proliferation, and death resistance [ 112 ]. However, CML patients (over 30%) required an alternative of TKIs to avoid drug resistance, side effects, or tolerance [ 113 ]. Additionally, TKI-based treatment could not eradicate the oncogenic events and etiological cause of CML. The residual BCR/ABL-positive cells remain as “oncogenic-quiescent”, which causes cancer relapse [ 114 ]. A recent study reported that PEG-modified AuNPs grafted with e14a2 antisense hairpin ssDNA oligonucleotide (AuNP-PEG-e14a2) displayed imatinib (IM) equivalent cytotoxic potential toward K562 (positive for BCR-ABL1 e13a2 transcript), while both of them had no cytotoxic effect against THP1 (negative for BCR-ABL1 e13a2 transcript). AuNP-PEG-e14a2 and IM combination treatment were 23% more effective in reducing cell viability compared to IM alone [ 113 ]. AuNP-PEG-e14a2 also caused a more than two-fold change of Bax/Bcl2 ratio, thereby shifting cells from an anti-apoptotic setting to a pro-apoptotic one. Furthermore, this fold changing (of Bax/Bcl2 ratio) was higher than the IM-treated group as well. Like IM, AuNP-PEG-e14a2 significantly increased caspase-3 expression at 48 h ( Figure 8 ). This gene-silencing strategy is in line with European LeukemiaNet’s recent recommendations. It should be mentioned that AuNP-PEG-e14a2 was not effective against BV173 CML cells (e14a2 positive), while IM was effective against BV173 cells [ 113 ]. Therefore, an extensive in vivo study in different leukemia models should be performed before considering AuNP-PEG-e14a2 as an alternative to TKI.

Zaimy et al. (2016) [ 115 ] screened five antisense oligonucleotides (AOs) against BAG1, MDM2, Bcl-2, BIRC5 (survivin), and XIAP genes to target acute myeloid leukemia subtype 2 (AML-M2) cells ( Table 2 ). These genes are considered anti-apoptotic genes, as their respective proteins are directly or indirectly linked with anti-apoptotic activities. AuNPs were functionalized with AOs, one anti-CD33(+)/CD34(+) aptamer, and Dox (FNGs). MTT-assay results confirmed the FNGs were equally potent to Dox. Though the addition of Dox with the FNGs did not improve overall cytotoxic outcome compared to Dox, the FNGs (300 μg/mL) were significantly effective in the downregulation of BCL2, BAG, survivin, and MDM2 expression in AML-M2 cells compared to Dox (300 μg/mL) [ 115 ].

Nucleolin (NCL) is a multifunctional protein highly expressed in the nucleolus. NCL regulates mRNA stability and translation of some genes responsible for tumor progression. AS1411 is a DNA aptamer (26-nucleotide) that specifically interacts with the external NCL domain and has reached phase II clinical development in cancer treatment [ 116 ]. On the other hand, anti-221 is an AO that suppresses miR-221, which is linked with cancer progression [ 117 , 118 ]. Deng et al. (2018) [ 119 ] functionalized AuNPs with a novel nuclear-localization-signal (NLS) peptide, AS1411, and anti-221 (NLS-AS1411-anti-221-AuNPs) that targets NCL, miR-221, nuclear-factor kappa-light-chain-enhancer of activated B-cells (NFkB), and DNA methyltransferase 1 (DNMT1)-positive AML cell lines. Via in vitro experimentation using NLS-AS1411-anti-221-AuNPs against Jurkat, Kasumi-1, K562, HL60, NB4, Thp1, Molt4, C1498, 293T, and U937 cells, Deng et al. (2018) [ 119 ] confirmed that NCL-miR-221-NFkB-DNMT1 signaling is involved in AML. Furthermore, intraperitoneal injection of NLS-AS1411-anti-221-AuNPs (100 μL/mouse) into the BM of C1498 leukemia cells bearing C57BL/6 mice significantly suppressed the expression of miR-221 and DNMT1, while it increased p15INK4B and p27kip1 levels. Moreover, the nanoconjugate extended overall survival rate, decreased WBC count, reversed splenomegaly, inhibited blasts in BM, and lung metastasis in this preclinical AML-induced animal model. Finally, the excellent biocompatibility of NLS-AS1411-anti-221-AuNPs indicated that the nanoconjugate could be used in combination with an NFkB inhibitor (e.g., Bay-11) to attain an optimal anti-leukemic effect with minimal adverse effects [ 119 ]. Later, Deng el al. (2019) [ 120 ] conjugated FA, AS1411, anti-221, and Dox with AuNPs (FA-AS1411-anti-221-Dox-AuNPs) that target the miR-221 network as well as P-gp ( Figure 9 ). FA-AS1411-anti-221-Dox-AuNPs displayed antiproliferative activity toward drug-resistant K562 cells and three AML-patient-derived leukemia cells, along with improved selectivity. Therefore, this multifunctional nanoparticle could overcome multidrug resistance in leukemia [ 120 ].

4.5. Improved Delivery of Chemotherapeutic Drugs, Peptides, Antibodies, or Bioactive Compounds

4.5.1. Delivery of Conventional Drugs

Chemotherapy is widely used in leukemia treatment. Poor bioavailability, shorter half-life, drug resistance, and side effects are the major limitations of chemotherapeutic drugs [ 121 , 122 , 123 , 124 , 125 , 126 ]. Conjugation of chemotherapeutic drugs ( Figure 10 ) with GNMs improved selectivity, efficacy, and potency against HMs.

Dox is an anthracycline group of antibiotics used in cancer chemotherapy [ 127 ]. To improve Dox selectivity and efficacy toward leukemia cells, Dizman et al. (2021) [ 128 ] conjugated Dox with AuNPs (Dox-AuNPs). MTT-assay results showed that Dox-AuNPs (5 μL) were more potent compared to Dox (5 μL) against K562 and HL-60 cells. However, at the same concentration, Dox-AuNPs were about 1.5-fold less cytotoxic compared to Dox, indicating the selectivity of Dox-AuNPs toward leukemia cells [ 128 ]. Daunorubicin (Dau) is another anthracycline group of antibiotics having Dox-like antileukemic effects [ 127 , 129 ]. Clinical applications of Dau have been decreased due to toxicities such as nausea, vomiting, diarrhea, infections, dental ulcer, lower ejection fraction, and myocardial ischemia [ 121 ]. To reduce the adverse effects and increase efficacy, Danesh et al. (2015) [ 130 ] loaded Dau into the surface of sgc8c aptamer (Apt) conjugated AuNPs (Apt-Dau-AuNPs). As mentioned earlier, the Apt selectively targeted ALL cells, and confocal-microscopy results also showed similar results for Apt-Dau-AuNPs. MTT-assay results revealed that Apt-Dau-AuNPs were about 14% more potent in reducing Molt-4 cells (human ALL T-cell, target) than free Dau (0.5 µM). On the other hand, free Dau exhibited nearly 18% higher antiproliferative activity against U266 (B lymphocyte human myeloma, non-target) cells compared to the Apt-Dau-AuNPs. It should be noted that this nanoconjugate released four-fold more Dau at pH 5.5 compared to normal blood pH (7.4). This drug-delivery system could be used in controlled and targeted delivery of Dau into human ALL cells [ 130 ].

Fludarabine Phosphate (FLP) is a commercially available chemotherapeutic drug used in the treatment of HMs. FLP interferes with DNA synthesis in HMs [ 122 , 124 ]. However, FLP has many side effects such as lymphopenia, severe autoimmune hemolytic anemia, gastrointestinal toxicity (nausea, vomiting), hair loss, and more [ 122 , 123 , 124 ]. To improve the selectivity and efficacy of FLP, Song et al. [ 124 ] loaded FLU on FA-conjugated AuNPs (FLP-FA-AuNPs). MTT-assay results showed that FLP-FA-AuNPs (2 mM) displayed 36% to 48% more cytotoxic activity toward KG1 cells (a type of AML cells) compared to FLP alone (2 mM), after 24 h to 48 h. Interestingly, AuNPs alone had no cytotoxic activity at the test concentration [ 124 ].

Phosphatidylinositol 3-kinase (PI3K) and protein kinase B (Akt), the mammalian targets of the rapamycin (mTOR)-signaling pathway (PI3K-Akt-mTOR), are dysregulated in HMs [ 131 ]. Rapamycin (RAP) is a bacterial macrolide, having anticancer and immunosuppressant properties. RAP targets mTOR, which controls cell division, protein biosynthesis, and cell-cycle progression (G1-S phase) [ 131 , 132 ]. T cell immunoglobulin and mucin domain 3 (Tim-3) receptor overexpressed in AML. Tim-3 is involved in the trafficking of galectin-9 protein that protects AML cells against the host immune system [ 26 ]. To improve RAP delivery in AML cells, Yasinska et al. (2017) [ 26 ] loaded RAP on the surface of anti-Tim-3 single-chain antibody (anti-Tim-3-ScAb)-conjugated AuNPs. In THP-1 human AML cells, the nanoconjugates significantly downregulated mTOR-mediated phosphorylation of eukaryotic initiation factor 4E binding protein (eIF4E-BP) [ 26 ]. Phosphorylated eIF4E-BP is overexpressed in HMs and is involved in cancer progression [ 133 ]. Furthermore, the nanoconjugate completely abrogated mTOR activity at a 50-times lower concentration compared to free RAP [ 26 ].

In AML, an initial mutation in nucleophosmin 1, isocitrate dehydrogenase 2, tet methylcytosine dioxygenase 2, or DNA methyltransferase 3 alpha genes provide the survival advantage of the hematopoietic stem cells. After that, a secondary mutation is linked with the actual malignant transformation of the myeloid cell [ 134 ]. Among the secondary mutations, FMS-like tyrosine kinase 3 (FLT3) or FLT3 with an internal tandem duplication (ITD) i.e., FLT3-ITD is reported in about 25% to 30% of the cases of all AML [ 134 , 135 ]. cBioPortal results also showed higher frequencies of the listed genes in leukemia ( Figure 2 b). TKI, for example, midostaurin (MDS), sorafenib (SOR), lestaurtinib (LES), and quizartinib (QUI), are widely used to suppress FLT3 kinase [ 134 , 136 ]. Simon et al. (2015) [ 136 ] loaded MDS into the surface of pluronic-F127-modified AuNPs (MDS-PI-AuNPs) to improve the efficacy of MDS. Dark-field microscopy images showed that MDS-PI-AuNPs internalized into OCI-AML3 and THP1 cells. Drug-release test results confirmed that more than 56% of MDS released from MDS-PI-AuNPs under the simulated cancer-cell condition, which resulted in a significant reduction in the viability of OCI-AML3 and THP1 cells compared to free MDS. Similarly, to improve the efficacy and delivery of sorafenib, lestaurtinib, and quizartinib, Petrushev et al. (2016) [ 134 ] loaded SOR on pluronic-coated AuNPs, and gelatin-coated AuNPs were conjugated with LES or QUI. Dark-field microscopy or TEM images revealed that the nanoconjugates internalized into THP1 and OCI-AML3 cells. At the same time, cell counting or MTT assay assured that these nanoconjugates were more effective in reducing THP1 and OCI-AML3 cells viability compared to their corresponding TKIs alone. Furthermore, the nanoconjugates induced significantly higher apoptosis and FLT3 protein expression than their respective TKIs alone [ 134 ]. Simon et al. (2015) and Petrushev et al. (2016) did not conduct experimentation using normal cells. Therefore, the selectivity of the nanoconjugates could not be calculated and compared with free TKIs [ 134 , 136 ].

In CML, the BCR–ABL1 fusion gene encodes a tyrosine kinase, and its continuous expression leads to uncontrolled cell proliferation [ 86 ]. TKI, IM is used as a first-line treatment for CML with BCR–ABL1 gene fusions [ 137 ]. Ganbold et al. (2013) [ 138 ] conjugated IM, topotecan (Topo), and 4-carboxylic benzoic acid (CBT) on the surface of AuNPs. Topo is a DNA topoisomerase I inhibitor that acts as a fluorescent-reporter molecule, while CBT targets transferrin protein. Raman spectroscopy and dark-field microscopy studies confirmed that the nanoconjugate entered into the K562 cells via the receptor-mediated endocytosis and released the drugs (IM and Topo) after glutathione (2 mM) treatment [ 138 ].

Then, 6-Mercaptopurine (6-MTP) is commonly used to treat human leukemias and some other diseases, including systemic lupus erythematosus, inflammatory bowel disease, and rheumatoid arthritis [ 139 , 140 ]. Short plasma half-life and repaid renal clearance decrease the therapeutic effects of 6-MTP. Podsiadlo et al. (2008) [ 141 ] conjugated 6-MTP with AuNPs (6-MTP-AuNPs) to improve its delivery and thereby efficacy. Such 6-MTP-AuNPs exhibited higher cytotoxic activity toward K562 cells compared to 6-MTP alone, while AuNPs had no antiproliferative activity at the same concentration of 6-MTP-AuNPs or 6-MTP. Higher antiproliferative activity of 6-MTP-AuNPs could be linked with their positive surface charge (+19 mV) that facilities crossing the negatively charged plasma membrane, where 6-MTP is neutral or slightly negative. However, 6-MTP-AuNPs displayed 6-MTP equivalent activities in the induction of apoptosis or necrosis in K562 cells. Therefore, it was hypothesized that 6-MTP-AuNPs will show a 6-MTP-like mechanism of action(s) [ 141 ].

Methotrexate (MTX) is a widely used chemotherapeutic drug used to control cell division in HMs [ 142 ]. Cytopenias, organ toxicity (liver, kidney, and skin), and mucositis are the major side effects of MTX [ 143 ] To improve the selectivity of MTX, Egusa et al. (2014) [ 144 ] conjugated with AuNPs (MTX-AuNPs). MTX-AuNPs exhibited higher antiproliferative activities toward TPH-1 cells compared to MTX alone at the same concentration (1 nM, 2 nM, or 5 nM), while MTX-AuNPs displayed MTX-equivalent cytotoxicity against normal hematopoietic stem/progenitor cells, indicated that AuNPs conjugation enhanced the selectivity of MTX. Similarly, MTX-AuNPs showed higher therapeutic potential compared to MTX in the primary AML cell-bearing non-obese severe diabetic combined with immunodeficiency gamma (NSG) mice following intravenous injection (0.25 mg/kg, twice per week) for 6 weeks. More importantly, MTX-AuNPs displayed excellent biocompatibility and reduced anemia signs, BM, and splenic leukemia burden, compared to MTX alone. These results indicated that AuNPs conjugation enhanced the MTX therapeutic index [ 144 ].

FA-receptor targeting efficiency of FA-conjugated nanoparticles depended on the cell-surface FA-receptor expression level [ 145 ]. Bortezomib (also called Velcade) is a 26S proteasome inhibitor widely used in the treatment of multiple myeloma [ 146 ]. Patra et al. (2008) [ 126 ] reported that conjugation of Velcade (Val) with AuNPs (Val-AuNPs) significantly reduced its apoptotic activity in multiple-myeloma cells (RPMI and U266). On the other hand, functionalization of Val-AuNPs with FA retained the free Val equivalent apoptotic activity in the RPMI and U266 cells. RPMI and U266 cells might express normal cells or plasma cells such as FA receptors, therefore, an increase in apoptotic activities was not observed after Val-FA-AuNPs treatment [ 126 , 145 , 147 ]. In the FA-receptor overexpressed solid-cancer cells, Val-FA-loaded nanoparticles exhibited higher anticancer activities [ 146 ].

Arsenic trioxide (As 2 O 3 ) is a traditional Chinese medicine, known for its anti-cancer effects. Thus, As 2 O 3 has drawn considerable attention in leukemia treatment. Guo et al. (2009) [ 125 ] investigated the antileukemic effects of As 2 O 3 - and As 2 O 3 -conjugated 3-mercaptopropionic acid (MPA)-capped AuNPs (As 2 O 3 -MPA-AuNPs) against drug-sensitive leukemia K562 cells and adriamycin-resistant K562/A02 (KA) cells. MTT-assay results showed that MPA-AuNPs conjugation significantly enhanced antiproliferative activity of As 2 O 3 toward K562 and KA cells. AuNPs increased permeability of K562 and KA cells, thereby facilitating As 2 O 3 uptake into the cancer cells. These in vitro results indicated that AuNPs could inhibit P-gp function, a protein responsible for drug efflux from cancer cells [ 125 ].

4.5.2. Improve Delivery of Antibody Drugs

AuNPs fabricated with polyclonal anti-myeloma antibody (AbMM) decreased the viability of SP2OR multiple-myeloma cells in a concentration-dependent manner (5–25 μg/mL). AbMM-AuNPs exhibited about two-fold higher anticancer activity toward SP2OR cells compared to AbMM alone. AbMM-AuNPs also arrested the SP2OR cells at the G2/M phase or S phase in the mice model. Furthermore, AbMM-AuNPs induced apoptosis by increasing the expression of cyclin-dependent kinase inhibitors (p21 and p27). These results indicated that AbMM-AuNPs could be used to inhibit multiple myeloma growth [ 148 ], while Bhattacharya et al. (2007) [ 149 ] reported that naked AuNPs exhibited remarkable antiproliferative activity toward OPM-1, RPMI-8266, and U-266 myeloma cells. The AuNPs (20 μg) arrested OPM-1, RPMI-8266, and U-266 cells at the G1 phase, by increasing p21 and p27 expression [ 149 ]. These findings indicated that AuNPs alone could have anti-myeloma activity.

Despite the therapeutic advancement in the treatment of CLL, progression to the Richter syndrome or cancer relapse remains an undruggable issue [ 150 ]. R-Ab already got FDA approval in the treatment of lymphoma [ 151 ]. To overcome the current therapeutic limitations of R-Ab, BOCA et al. (2016) [ 150 ] fabricated AuNPs with R-Ab, a monoclonal antibody that selectively targets CD20-expressed lymphoma or CLL cells and induces cell death [ 150 , 152 ]. Dark-field microscopy and TEM results confirmed that the AuNPs-R-Ab nanoconjugate was internalized in both the CLL cells (fibroblast-like HS 505.T cells and malignant lymphocytes CLL-AAT). MTT and cell counting assays showed that AuNPs-R-Ab was more potent in reducing cell number compared to R-Ab. Moreover, AuNPs-R-Ab was significantly effective in apoptosis induction as well as suppressed the expression of membrane-spanning 4-domains, subfamily A, member 1 (MS4A1) gene, or protein in CLL-AAT and HS 505.T cells compared to R-Ab alone. Furthermore, a confocal-microscopy study showed that such changes in MS4A1 expression resulted in a significant decrease in CD20 expression [ 150 ]. Similarly, García BE et al. (2014) [ 153 ] prepared R-Ab-conjugated AuNPs (R-Ab-AuNPs) that target Raji Burkitt’s lymphoma cells. R-Ab-AuNPs significantly downregulated anti-apoptotic Bcl-2 family proteins compared to a control, indicating that R-Ab-AuNPs could induce apoptosis. A flow-cytometry-based apoptotic-cell analysis should be performed to confirm the apoptotic activity of R-Ab-AuNPs [ 153 ]. Previously, the selectivity of R-Ab toward the lymphoma cells was also reported by Weiss et al. (2009) [ 154 ]. R-Ab conjugated on the surface of PEG-modified AuNPs exhibited selective binding and internalization into the Z138 human mantle-cell lymphoma cells (CD20 positive) but had no such activity in the SKBR3 breast-cancer cells (CD20 negative) [ 154 ].

4.5.3. Peptide-Based Anti-Angiogenic Therapy

CML cells with BCR–ABL1 gene fusions trigger many cells and molecular events in BM, which are linked with the disease prognosis and progression [ 155 ]. In the BM-tumor microenvironment of CML patients, paracrine and autocrine communication between BM cells and the malignant cells are crucial for the evolution and modulation of the niche [ 155 , 156 ]. CML cells secrete exosomes that induce new blood-vessel formation in the BM. Roma-Rodrigues et al. (2019) [ 86 ] synthesized antiangiogenic peptide (AP)-functionalized oligo ethylene glycol (OEG)-coated AuNPs (AP-OEG-AuNPs) that impaired K562-induced new blood-vessel creation in the chorioallantoic-membrane model ( Figure 11 ). K562 exosomes (50 μg/mL) did not affect IL8 and VEGFA expression, but they increased VEGFR1 by 200-fold. AP-OEG-AuNPs (16.4 nM) blocked the activity of K562 exosomes by silencing the VEGFR1-mediated signaling pathways [ 86 ]. The exosome-based effects of CML on the molecular pathways could be used to invent potential therapeutic strategies to regulate the patient BM tumor microenvironment.

4.5.4. Bioactive Compounds

Biogenic AuNPs (b-AuNPs) synthesized from Boswellia serrata or Lens culinaris displayed cytotoxicity toward Human HL-60/vcr, Murine C1498, and 32D-FLT3-ITD cells, which was comparable to the mitoxantrone. However, b-AuNPs were less cytotoxic toward HUVEC cells compared to mitoxantrone [ 157 , 158 ]. In a 7,12-dimethylbenz[a]anthracene-induced AML mice model, b-AuNPs (1 mg/kg body weight) such as mitoxantrone significantly increased lymphocyte, platelet, RBC parameters, and anti-inflammatory cytokines level (IFNα, IL4, IL5, IL10, and IL13), while decreasing the level of pro-inflammatory cytokines (TNFα, IFNY, IL1, IL6, IL12, and IL18) compared to untreated mice [ 157 , 158 ]. Furthermore, b-AuNPs and mitoxantrone significantly increased the expression of sphingosine-1-phosphate receptor-1 and sphingosine-1-phosphate receptor-5 mRNA compared to the control mice [ 157 , 158 ]. Ahmeda et al. (2020) [ 157 , 158 ] also confirmed that like mitoxantrone, b-AuNPs also significantly decreased the infiltration of leukemic myeloblasts in the spleen and liver compared to the untreated mice. Ahmeda et al. (2020) [ 159 ], Zangeneh et al. (2020) [ 160 ], and Hemmati (2020) [ 161 ] also got similar in vitro and in vivo results from b-AuNPs synthesized from Camellia sinensis , Hibiscus sabdariffa flower, and Hymus vulgaris leaf, respectively. Unlike previous studies, instead of mitoxantrone, Ahmeda (2020) and Zangeneh et al. (2020) used Dau as a control drug, while Hemmati (2020) used Dox as a control drug [ 159 , 160 , 161 ]. These findings indicated that b-AuNPs are more selective toward leukemia cells compared to normal cells, therefore, AuNPs could be considered as a potent therapeutic agent in leukemia treatment.

4.6. Reactive Oxygen Species-Mediated Cytotoxicity

Reactive oxygen species (ROS) are special types of oxygen (O 2 )-carrying reactive molecules, which play crucial roles in many cellular activities, for instance, promoting cell growth at basal level [ 162 ]. ROS plays a crucial role in hematopoiesis by regulating of differentiation, self-renewal, and the balance between quiescence and proliferation of hematopoietic stem cells (HSCs) [ 163 ]. HSCs are found in relatively hypoxic environments where anaerobic metabolism drives HIF1 and FOXO transcription to maintain quiescence and HSC self-renewal [ 164 ]. On the other hand, an elevated ROS level is highlighted as one of the key players that underlie the acquisition of the various hallmarks of cancer, including hematopoietic malignancy [ 165 , 166 ]. ROS, however, could enhance cytotoxic activities at an adequately high concentration, often involving cellular apoptosis or necrosis [ 167 , 168 ]. Vectorized GNMs act as a catalyst in ROS production [ 169 , 170 ]. ROS generated from vectorized GNMs could induce local damage to the cancer cells, while restraining minimum damage to neighboring cells or GNMs-free cells [ 171 ].

GNR, in conjugation with ultra-small platinum nanoparticles (USPN), had shown multienzyme-like activities, which caused fluctuation of intracellular ROS level [ 172 ]. Western blotting results confirmed that 24 h of GNR-USPN (20 pM) treatment significantly upregulated autophagic protein Beclin-1 expression in K562 cells, thereby triggered cellular autophagy. Additionally, beclin-1 downregulated fusion protein BCR-ABL expression, leading to downregulation of AKT and PI3K phosphorylation. Furthermore, the same concentration of GNR-USPN also arrested about 37% of K562 cells at the mitotic phase (G2/M), and this growth retardation had significantly driven CML apoptosis compared to an untreated control. These in vitro findings give the idea that CML cells might be vulnerable to ROS fluctuation triggered by the enzyme-like activities of GNR-USPN. A drawback of this study was all the experiments were carried out in only one cell line. Therefore, its effects on normal cells could help to understand the selectivity of GNR-USPN [ 172 ]. Minai et al. (2013) [ 171 ] tagged R-Ab to a gold nanosphere (GNHs) surface for selective targeting of BJAB cells (Burkitt lymphoma B-cells). Time-lapse microscopy studies using some fluorescent markers confirmed that irradiation of femtosecond pulses (at 550 nm) causes a significant increase in intracellular ROS in the targeted cells. While co-culture experimentation using K562 and BJAB cells showed that the nanoconjugate could not induce a noticeable ROS level in the non-targeted K562 cells. Six femtosecond pulses increased the intracellular ROS level about 27% in the BJAB cells. It should be noted that ROS-mediated damage in the targeted cancer cells was directly proportionate with the number of femtosecond pulses ( Table 3 ) [ 171 ].

4.7. Induction of Apoptosis

AuNPs modified with PEG (AuNPs-PEG) exhibited antiproliferative activity against K562 cells. AuNPs-PEG gathered into cytoplasmic vacuoles and significantly decreased mitochondrial-membrane potential, resulting in apoptotic changes. Morphological characteristics of the apoptotic cells, such as fragmented nuclei, membrane blebbing, and apoptotic bodies, were observed under the light microscope after 24–72 h of treatment. Furthermore, AuNPs-PEG significantly arrested about 15%–75% of K562 cells at 24–72 h. Together the data indicated that AuNPs-PEG-induced apoptosis in the K562 cells by controlling mitochondrial intrinsic apoptotic pathway [ 173 ]. Similarly, 25 μg of anti-VEGF antibody (VF-Ab) conjugated AuNPs (VF-Ab-AuNPs) that exhibited significantly higher apoptosis (40%–60%) toward patients ( n = 7) with derived CLL B (B-chronic lymphocytic leukemia) cells, compared to the same concentration of VF-Ab. Western blotting results showed that VF-Ab-AuNPs (25 μg) treatment resulted in PARP cleavage, while no such responses were observed after VF-Ab treatment. PARP cleavage was associated with a decrease in caspase 3, Mcl-1, and Bcl-2 expression. As no densitometry studies were conducted, the level of significance could not be calculated from the Western blotting results [ 174 ].

Verbascoside (VER) is a hydrophobic drug candidate derived from Banchunmaxianhao, reported to have strong anticancer activities [ 175 , 176 ]. Co-treatment of VER with poly (N-isopropyl acrylamide) (PNM)-modified gold nanoshells (GNSs) (PNM-GNSs) displayed synergetic activity toward drug-resistant KA leukemia cells. DNA fragmentation and apoptotic bodies were visualized under microscopic examination after VER and PNM-GNSs treatment. This co-treatment significantly increased the apoptotic activities in KA cells by modulating the caspase 3, 8, and 9 signaling pathways and reduced tumor volume in KA-tumor-bearing female nude mice. Results indicated that VER-loaded PNM-GNSs could be used in leukemia treatment [ 176 ].

It is well known that CpG oligodeoxynucleotides (CpGs) uniquely induce cytotoxicity toward lymphoma. To improve the efficacy of CpGs, Lin et al. (2020) [ 177 ] conjugated tri-ethylene-modified CpG (class B and class C) with AuNP (tmCpG-AuNP) to target lymphomas. Both classes of tmCpG-AuNPs were more potent toward RC (high-grade B lymphoma), JeKo-1 (mantle-cell lymphoma, TP53 deficient), Mino (mantle-cell lymphoma, TP53 mutated), and REC-1 (mantle-cell lymphoma, TP53 proficient) cells compared with free CpGs, while both the tmCpG-AuNPs were not toxic against dendritic cells. An annexin V-PI apoptosis assay using mouse lymphoma A20 cells confirmed that tmCpG-AuNPs were 4.6-fold more potent in inducing apoptosis compared to free CpGs. Moreover, tmCpG-AuNPs increased CD19, CD20, and CD47 protein expression on the lymphoma cells, thereby enhanced the anti-lymphoma effects. Finally, in the A20-tumor-bearing BALB/c mice, both the tmCpG-AuNPs reduced tumor volume at the injection site. However, only class B tmCpG-AuNPs significantly enhanced survival time compared to free CpGs [ 177 ].

b-AuNPs prepared from Sargassum muticum water extract displayed antiproliferative activity toward K562, Jurkat, HL-60, and CEM-ss cells (acute lymphocytic leukemia). MTT-assay results indicated that the b-AuNPs displayed higher antiproliferative activity toward K562 cells compared to Jurkat, HL-60, and CEM-ss cells ( Table 4 ). The b-AuNPs induced significantly arrest K562 cells at the sub-G0/G1 and G2/M phases of the cell cycle after 12 h as well as induced early and late apoptosis after 6 h, compared to a control. Additionally, K562 cells displayed the typical features of apoptosis including cell shrinkage, membrane blebbing, chromatin condensation, and apoptotic body formation after 24–72 h of b-AuNPs (4.22 μg/mL) treatment. Furthermore, the same treatment significantly increased the expression of caspase-3 and -9 after 24 h. These findings indicated that the mitochondrial intrinsic pathway was activated to produce the apoptogenic responses [ 178 ]. Using an MTT assay, Gautam et al. (2017) reported that b-AuNPs prepared from Ocimum sanctum leaf extract displayed cytotoxicity toward Dalton’s lymphoma (DL) cells. b-AuNPs decreased mitochondrial-membrane potential (ΔΨm) and, thereby, induced apoptosis through the mitochondrial pathway. A DNA-fragmentation assay also confirmed that b-AuNPs (100 μg) treatment caused higher nuclear condensation and DNA fragmentation (at 50 bp, 500 bp, 750 bp, and 1000 bp) compared to the untreated control. Additionally, b-AuNPs (100 μg) significantly arrested about 8.4% of DL cells at the G0/G1 phase. A limitation of this study was only one cell line was used to validate the experimental results. Experimentation using a normal cell line could report the selectivity of the b-AuNPs [ 179 ]. Shahriari et al. (2016) [ 180 ] prepared hydroxyl-capped b-AuNPs using Camellia sinensis leaf extract and conjugated b-AuNPs with asparagine (Asn). MTT-assay results showed that Asn-b-AuNPs displayed concentration-dependent (3–300 μg/mL) antiproliferative activity toward CCRF-CEM cells at 39 °C. A similar concentration-dependent trend in apoptosis induction was also seen under the same condition. Asn-b-AuNPs (30 μg/mL) induced 45% apoptosis in CCRF-CEM cells compared to the untreated control. While Asn-b-AuNPs (300 μg/mL) significantly decreased expression of matrix metalloproteinase 2 (MMP-2) [ 180 ]. MMP-2 induces cell growth, invasiveness, migration, and angiogenesis in leukemia [ 181 ]. At a higher concentration (300 μg/mL), the proportion of necrotic cells also increased. Therefore, it would not be wise to use the higher concentration of this nanoconjugate. Shahriari and co-workers did not examine Asn-b-AuNPs effects on other cells, including normal cells, under the mild hyperthermic condition. Therefore, selectivity of this nanoconjugate is still an issue for biomedical applications [ 180 ].

As mentioned earlier, FA receptor β-overexpressed in human leukemia cells [ 85 ]. GNR conjugated with silica and folic acid (F-Si-GNRs) showed higher selectivity toward EL4s lymphoblastic leukemia cells compared to spermatogonial cells (SSCs) with an IC 50 value of <75 μM and >75 μM, respectively. Furthermore, an annexin V-FITC/PI-based flow-cytometry assay confirmed that F-Si-GNRs (100 μM) significantly increased apoptosis in EL4s cells (51.1% ± 6%) compared to SSCs cells (32.9% ± 2%). Microscopic examination showed that upon internalization, F-Si-GNRs caused mitochondrial damage to active apoptosis signaling [ 182 ].

5. Challenges of Using GNMs in HMs from Pharmacological and Toxicological Point of View

GNMs have already reached clinical trials in solid-cancer therapy [ 183 ]. This achievement draws the attention of scientists for their usage in HMs. Though GNMs have shown promise in HMs as a theranostic agent, overcoming the following challenges and concerns could pave the way for their clinical applications in HMs.

5.1. Selectivity of Gold Nanomaterials

A fundamental issue of cancer drugs is their low therapeutic index and poor selectivity toward cancer cells compared to normal cells. The anticancer agents with poor selectivity destroy cancer and normal cells, thereby posing adverse effects that limit the efficacy and safety of treatment [ 144 ]. Calculation of a selectivity index helps to understand the selectivity of an anticancer agent [ 184 ]. The selectivity of some GNMs toward HMs could not be calculated from some of the reported studies, as experimentation was conducted only against the cancer cells. Therefore, the effects of the GNMs on the normal cells remain a major concern despite the promising results against HMs. Experimentations on the normal cells could give an idea about their selectivity toward HMs.

5.2. Preclinical Experimentation in a Complex System

Many of the reported studies related to GNMs-based treatments were performed in the 2D-cell-culture systems. This system lacks the complexity of the cancer microenvironment. Experimentation using 3D co-cultures with supporting cells (e.g., BM cells), or organ-on-a-chip technologies that mimic the in vivo system, could be considered as a better reflection of experimental results. These advanced-culture systems offer better cell-to-cell interactions and paracrine interactions with the cancer cells that, more importantly, mimic the BM microenvironment [ 156 ]. However, many important aspects, including immunomodulatory activity, vascularization, perfusions, and effects on the other major organs, are still lacking in the 3D-culture models [ 156 , 185 ]. Therefore, extensive in vivo studies using theranostic GNMs should be conducted to unveil the key questions such as effects on the immune system, absorption, distribution, efficacy, and safety.

5.3. Immunomodulatory Effects

Immunosuppression is a common phenomenon in HMs; therefore, therapeutic agents having immunostimulatory effects could offer benefit to patients with HMs [ 25 , 186 , 187 , 188 , 189 , 190 ]. Undesirable interactions of GMNs with plasma, red blood cells, white blood cells, or platelets may pose an immediate threat to the biodistribution, efficacy, and biocompatibility of GMNs as cancer nanomedicine [ 191 ]. Many factors contribute to the immunomodulatory effects of GMNs, including surface chemistry, composition, shape, size, protein-binding ability, individual difference, dosage, and route of administration [ 192 , 193 ]. The literature showed that GMNs depending on these factors displayed both immunostimulatory and immunosuppressing activities [ 192 , 193 , 194 ]. Simpson et al. (2010) reported that mixed monolayer AuNPs (<5 nm) surprisingly increased the WBC count in female BALB/c mice at concentrations higher than 30 μM [ 195 ]. As most of the studies (discussed in Section 4 ) reported that the therapeutic benefits of GMs in HMs were performed only in the in vitro model, their dose-dependent immunomodulatory effects in the in vivo system could not be understood from these results.

5.4. Safety and Biodistribution

In vitro experimentation of nanoparticle safety does not always reflect in vivo findings, as nanomaterials metabolized in one organ may have toxic effects [ 185 , 192 ]. Studies in the whole organism may reflect similar findings in the clinical results, as an organism is more complex than a single cell [ 192 ]. The size, surface area, number, shape, and clearance of GNMs play a crucial role in biodistribution, accumulation, and toxicity [ 192 , 196 ].

GNMs are rapidly cleared from the systemic circulations and deposited in all the major organs, though the highest accumulation has been reported in the liver and spleen [ 192 , 197 ]. Higher clearance of GNMs occurs through urine and bile [ 196 ]. Hainfeld et al. [ 198 ] reported that about 77.5% AuNPs (1.9 ± 0.1 nm) cleared from the body of CD1 male or female mice after 5 h of intravenous injection. Moreover, the acute and chronic toxicity of the GNMs depends on the route of administration, test organism, sex, surface-coating agents, dosage, and size [ 33 , 199 , 200 ]. Zhang et al. (2010) reported that AuNPs (13.5 nm) reduced splenic index, red blood-cell counts, and body weight of male ICR mice at 2200 μg/kg dose. Among the three administration routes (oral, intraperitoneal, and intravenous), the intravenous route showed the lowest toxicity [ 199 ], while Rambanapasi et al. (2016) concluded that 14 nm AuNPs did not cause any acute or chronic toxicity in male Sprague Dawley rats at 90 μg/kg dose [ 200 ]. Additionally, In vivo results confirmed that smaller (3–5 nm) and larger (50–100 nm) GNMs are less toxic compared to intermediate-size (8–37 nm) nanoparticles, while some in vitro studies reported that intermediate-size GNMs are safe as well. Furthermore, larger GNMs (>500 nm) enter into the cells through phagocytosis, while smaller nanoparticles (<100 nm) enter via receptor-mediated endocytosis [ 192 ]. More importantly, Alkilany et al. (2010) [ 192 ] concluded that the number of active gold particles varies with the size, since the reactivity of smaller (~3) GNMs is higher than larger GNMs (>~5 nm). In another study, using an MTT assay, Mateo et al. (2015) [ 201 ] reported that 30 nm, 50 nm, and 90 nm GNMs displayed size-dependent cytotoxicity toward NHDF normal-human dermal fibroblasts cells with IC 50 values of 17.9 mg/mL, 18.0 mg/mL, and 19.3 mg/mL, respectively. Similar dose-dependent cytotoxic activity was also observed in the LDH assay results, and GNMs drove ROS production that was linked with cytotoxicity [ 201 ], while Shuka et al. (2005) [ 202 ] concluded that GNMs reduced the ROS level in RAW264.7 macrophage cells and did not elicit proinflammatory cytokines that release TNF-α and IL1-β. It was hypothesized that GNMs were uptaken via endocytosis decreased the ROS level and were nontoxic. Recently, Balfourier et al. (2020) [ 203 ] reported that GNMs (4–22 nm) are surprisingly degraded in vitro by cells, via rapid degradation of the smallest size of GNMs. Transcriptomics studies assured that lysosomes play an active role in GNMs biodissolution ( Figure 12 ). Future studies in other cell lines and in vivo models could unveil the possible mechanism of GNMs degradation and clearance [ 203 ]. These findings consolidated that the biocompatibility, clearance, and mechanism action(s) of GNMs is still a controversial issue [ 33 , 202 , 203 ], therefore, extensive studies are needed to clarify these controversial points.

5.5. Adverse Effects

Among the three administration routes, GNMs administration through the oral and intraperitoneal routes showed higher adverse effects compared to the tail-vein injection [ 199 ]. Adverse effects of GNMs include damage of cytoplasmic organelle or DNA, oxidative stress, mutagenesis, and alteration of protein expression [ 192 ]. More importantly, vectorized GNMs may cause irreversible damage to the normal cells through excessive ROS generation [ 32 ]. Consequences of such changes include a decrease in body weight, spleen index, alteration of hematocrit level, and red blood-cell counts [ 199 ]. Furthermore, Peng et al. (2019) [ 204 ] reported that GNMs could damage the endothelial cells, leading to higher extravasation and intravasation of cancer cells, thereby exacerbating cancer metastasis [ 204 ]. Breaking of the endothelial barrier could enhance the metastasis of HMs and increase the risk of secondary-tumor development [ 205 , 206 , 207 ]. Therefore, to enlighten future use of GNMs in cancer treatment, the properties of the GNMs that increase endothelial leakiness need to be determined [ 208 ]. Additionally, to resolve this issue, GNMs could be coated with bioactive compounds (e.g., polyphenols) that improve endothelial dysfunction [ 209 ]. Finally, as there is no in vivo model system to investigate endothelial leakage, in vitro studies using human endothelial cell monolayers should be performed to examine endothelial permeability and vascular leakage [ 210 ].

6. Conclusions

GNMs illuminate the diagnosis of HMs, metastasis of HMs, and MRD, with reliable accuracy and specificity. As only a few studies were conducted using clinical samples, future experimentations using clinical samples are still in demand, while GNMs-based PTT, PDT, radiotherapy, gene therapy, and advanced drug delivery enhanced the antiproliferative activity of conventional therapeutic agents and showed promise to overcome drug resistance and minimize the side effects. These findings indicated that GNMs-based therapies could be considered as an alternative to current treatment modalities. Additionally, tuning of GNMs size, surface modification with biocompatible photosensitizers, probes, targeting ligands, and HMs specific drug or drug candidates could improve theranostic efficiency. Furthermore, nanozyme activity of GNMs in combination with another metallic nanoparticle should be explored in the future, to diagnose and treat HMs [ 172 , 211 ]. One of the limitations of the many reported studies is that the testing experimentations were conducted in secondary cell lines in a 2D cell-culture environment. Additionally, testing diagnostic accuracy, reliability, and sensitivity using clinical samples, while examining the therapeutic efficacy in a 3D cell-culture model or patient-derived xenograft model, could better reflect clinical outcomes [ 212 , 213 , 214 ]. Moreover, the biocompatibility and safety of GNMs remain controversial issues. To reduce to the toxic effects, size-dependent effects should be monitored following conjugation with suitable bioactive molecules, biopolymers, or other theranostic agents. Lastly, before clinical trials, extensive preclinical studies in the in vivo model should be performed to determine the therapeutic index, selectivity, organ distribution, clearance, and mechanism action(s) of GNMs.

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Author Contributions

Conceptualization, M.S.S. and M.A.I.; writing—original draft preparation, M.S.S., M.S.N. and K.M.M.; writing—review and editing, M.S.S., M.A.I. and M.A.K.; project administration, M.S.S. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

Data reported in Figure 2 are available via the cBioportal database ( https://www.cbioportal.org/ , 29 January 2022).

Conflicts of Interest

The authors declare no conflict of interest.

References

1. Button E. Chan R.J. Chambers S. Butler J. Yates P. A systematic review of prognostic factors at the end of life for people with a hematological malignancy BMC Cancer 2017 17 213 10.1186/s12885-017-3207-7 28335744 PMC5364562

2. Sung H. Ferlay J. Siegel R.L. Laversanne M. Soerjomataram I. Jemal A. Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J. Clin. 2021 71 209 249 10.3322/caac.21660 33538338

3. Lapotko D. Lukianova E. Shnip A. Zheltov G. Potapnev M. Savitsky V. Klimovich O. Oraevsky A. Laser activated nanothermolysis of leukemia cells monitored by photothermal microscopy Proceedings of the Photons Plus Ultrasound: Imaging and Sensing 2005: The Sixth Conference on Biomedical Thermoacoustics, Optoacoustics, and Acousto-Optics San Jose, CA, USA 25 April 2005 82 89

4. Koutsi A. Vervesou E.C. Diagnostic molecular techniques in haematology: Recent advances Ann. Transl. Med. 2018 6 242 10.21037/atm.2018.05.30 30069444 PMC6046288

5. Morgan G. Pratt G. Modern molecular diagnostics and the management of haematological malignancies Clin. Lab. Haematol. 1998 20 135 141 10.1046/j.1365-2257.1998.00141.x 9681227

6. Sánchez R. Ayala R. Martínez-López J. Minimal Residual Disease Monitoring with Next-Generation Sequencing Methodologies in Hematological Malignancies Int. J. Mol. Sci. 2019 20 2832 10.3390/ijms20112832 31185671 PMC6600313

7. Jółkowska J. Derwich K. Dawidowska M. Methods of minimal residual disease (MRD) detection in childhood haematological malignancies J. Appl. Genet. 2007 48 77 83 10.1007/BF03194661 17272865

8. Flanders A. Stetler-Stevenson M. Landgren O. Minimal residual disease testing in multiple myeloma by flow cytometry: Major heterogeneity Blood 2013 122 1088 1089 10.1182/blood-2013-05-506170 23929839 PMC3739032

9. Mimmi S. Maisano D. Nisticò N. Vecchio E. Chiurazzi F. Ferrara K. Iannalfo M. D’Ambrosio A. Fiume G. Iaccino E. Detection of chronic lymphocytic leukemia subpopulations in peripheral blood by phage ligands of tumor immunoglobulin B cell receptors Leukemia 2021 35 610 614 10.1038/s41375-020-0885-y 32483301 PMC7862058

10. Iaccino E. Mimmi S. Dattilo V. Marino F. Candeloro P. Di Loria A. Marimpietri D. Pisano A. Albano F. Vecchio E. Monitoring multiple myeloma by idiotype-specific peptide binders of tumor-derived exosomes Mol. Cancer 2017 16 159 10.1186/s12943-017-0730-8 29029605 PMC5640902

11. Klener P. Klanova M. Drug Resistance in Non-Hodgkin Lymphomas Int. J. Mol. Sci. 2020 21 2081 10.3390/ijms21062081 32197371 PMC7139754

12. Tanaka H. Introduction by the Guest Editor: Recent advances in biology and treatment of multiple myeloma Int. J. Hematol. 2020 111 494 495 10.1007/s12185-020-02830-z 31984452

13. Palanca-Wessels M.C. Press O.W. Advances in the treatment of hematologic malignancies using immunoconjugates Blood 2014 123 2293 2301 10.1182/blood-2013-10-492223 24578502 PMC3983610

14. Wildes T.M. Stirewalt D.L. Medeiros B. Hurria A. Hematopoietic stem cell transplantation for hematologic malignancies in older adults: Geriatric principles in the transplant clinic J. Natl. Compr. Canc. Netw. 2014 12 128 136 10.6004/jnccn.2014.0010 24453296 PMC4010196

15. Santos G.W. Bone marrow transplantation in hematologic malignancies. Current status Cancer 1990 65 786 791 10.1002/1097-0142(19900201)65:3+<786::AID-CNCR2820651326>3.0.CO;2-H 2406002

16. Allegra A.G. Mannino F. Innao V. Musolino C. Allegra A. Radioprotective Agents and Enhancers Factors. Preventive and Therapeutic Strategies for Oxidative Induced Radiotherapy Damages in Hematological Malignancies Antioxidants 2020 9 1116 10.3390/antiox9111116 PMC7696711 33198328

17. Bogaert D.J. Laureys G. Naesens L. Mazure D. De Bruyne M. Hsu A.P. Bordon V. Wouters E. Tavernier S.J. Lambrecht B.N. GATA2 deficiency and haematopoietic stem cell transplantation: Challenges for the clinical practitioner Br. J. Haematol. 2020 188 768 773 10.1111/bjh.16247 31710708

18. Jurcek T. Razga F. Jeziskova I. Dvorakova D. Zackova D. Tomasikova L. Oltova A. Mayer J. Failure of molecular diagnostics in chronic myeloid leukemia: An aberrant form of e13a2 BCR-ABL transcript causing false-negative results by standard polymerase chain reaction Leuk. Lymphoma 2010 51 558 561 10.3109/10428190903572219 20148758

19. Allart-Vorelli P. Porro B. Baguet F. Michel A. Cousson-Gélie F. Haematological cancer and quality of life: A systematic literature review Blood Cancer J. 2015 5 e305 10.1038/bcj.2015.29 25909835 PMC4450328

20. Kotrova M. van der Velden V.H.J. van Dongen J.J.M. Formankova R. Sedlacek P. Brüggemann M. Zuna J. Stary J. Trka J. Fronkova E. Next-generation sequencing indicates false-positive MRD results and better predicts prognosis after SCT in patients with childhood ALL Bone Marrow Transpl. 2017 52 962 968 10.1038/bmt.2017.16 28244980

21. Rocha J.M.C. Xavier S.G. Souza M.E.L. Murao M. de Oliveira B.M. Comparison between flow cytometry and standard PCR in the evaluation of MRD in children with acute lymphoblastic leukemia treated with the GBTLI LLA—2009 protocol Pediatr. Hematol. Oncol. 2019 36 287 301 10.1080/08880018.2019.1636168 31287348

22. Pfeifer H. Cazzaniga G. van der Velden V.H.J. Cayuela J.M. Schäfer B. Spinelli O. Akiki S. Avigad S. Bendit I. Borg K. Standardisation and consensus guidelines for minimal residual disease assessment in Philadelphia-positive acute lymphoblastic leukemia (Ph + ALL) by real-time quantitative reverse transcriptase PCR of e1a2 BCR-ABL1 Leukemia 2019 33 1910 1922 10.1038/s41375-019-0413-0 30858550

23. Denys B. van der Sluijs-Gelling A.J. Homburg C. van der Schoot C.E. de Haas V. Philippé J. Pieters R. van Dongen J.J. van der Velden V.H. Improved flow cytometric detection of minimal residual disease in childhood acute lymphoblastic leukemia Leukemia 2013 27 635 641 10.1038/leu.2012.231 22945774

24. Mehn D. Morasso C. Vanna R. Schiumarini D. Bedoni M. Ciceri F. Gramatica F. Surface enhanced Raman spectroscopy-based method for leukemia biomarker detection using magnetic core@ gold shell nanoparticles Bionanoscience 2014 4 119 127 10.1007/s12668-014-0134-9

25. Hallett W.H. Jing W. Drobyski W.R. Johnson B.D. Immunosuppressive effects of multiple myeloma are overcome by PD-L1 blockade Biol. Blood Marrow Transpl. 2011 17 1133 1145 10.1016/j.bbmt.2011.03.011 21536144

26. Yasinska I.M. Ceccone G. Ojea-Jimenez I. Ponti J. Hussain R. Siligardi G. Berger S.M. Fasler-Kan E. Bardelli M. Varani L. Highly specific targeting of human acute myeloid leukaemia cells using pharmacologically active nanoconjugates Nanoscale 2018 10 5827 5833 10.1039/C7NR09436A 29538473

27. Yang X. Yang M. Pang B. Vara M. Xia Y. Gold Nanomaterials at Work in Biomedicine Chem. Rev. 2015 115 10410 10488 10.1021/acs.chemrev.5b00193 26293344

28. Hu X. Zhang Y. Ding T. Liu J. Zhao H. Multifunctional Gold Nanoparticles: A Novel Nanomaterial for Various Medical Applications and Biological Activities Front. Bioeng. Biotechnol. 2020 8 990 10.3389/fbioe.2020.00990 32903562 PMC7438450

29. Sasidharan A. Monteiro-Riviere N.A. Biomedical applications of gold nanomaterials: Opportunities and challenges Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2015 7 779 796 10.1002/wnan.1341 25808787

30. Kumar A. Mazinder Boruah B. Liang X.-J. Gold Nanoparticles: Promising Nanomaterials for the Diagnosis of Cancer and HIV/AIDS J. Nanomater. 2011 2011 202187 10.1155/2011/202187

31. Yeh Y.C. Creran B. Rotello V.M. Gold nanoparticles: Preparation, properties, and applications in bionanotechnology Nanoscale 2012 4 1871 1880 10.1039/C1NR11188D 22076024 PMC4101904

32. Niloy M.S. Shakil M.S. Hossen M.S. Alam M. Rosengren R.J. Promise of gold nanomaterials as a lung cancer theranostic agent: A systematic review Int. Nano Lett. 2021 11 93 111 10.1007/s40089-021-00332-2

33. Khandker S.S. Shakil M. Hossen M. Gold Nanoparticles; Potential Nanotheranostic Agent in Breast Cancer: A Comprehensive Review with Systematic Search Strategy Curr. Drug Metab. 2020 21 579 598 10.2174/1389200221666200610173724 32520684

34. Huang X. Mahmudul H.M. Li Z. Deng X. Su X. Xiao Z. Zhao L. Liu T. Li H. Noble metal nanomaterials for the diagnosis and treatment of hematological malignancies Front. Biosci. 2022 27 40 10.31083/j.fbl2702040 35226983

35. De Berardis B. Marchetti M. Risuglia A. Ietto F. Fanizza C. Superti F. Exposure to airborne gold nanoparticles: A review of current toxicological data on the respiratory tract J. Nanoparticle Res. 2021 22 235 10.1007/s11051-020-04966-9

36. Sant M. Allemani C. Tereanu C. De Angelis R. Capocaccia R. Visser O. Marcos-Gragera R. Maynadié M. Simonetti A. Lutz J.M. Incidence of hematologic malignancies in Europe by morphologic subtype: Results of the HAEMACARE project Blood 2010 116 3724 3734 10.1182/blood-2010-05-282632 20664057

37. Rodriguez-Abreu D. Bordoni A. Zucca E. Epidemiology of hematological malignancies Ann. Oncol. 2007 18 (Suppl. S1) i3 i8 10.1093/annonc/mdl443 17311819

38. Batista J.L. Birmann B.M. Epstein M.M. Epidemiology of Hematologic Malignancies Pathology and Epidemiology of Cancer Loda M. Mucci L.A. Mittelstadt M.L. Van Hemelrijck M. Cotter M.B. Springer International Publishing Cham, Switzerland 2017 543 569

39. cBioPortal Leukemia Available online: https://bit.ly/3uz1IM4 (accessed on 29 January 2022)

40. cBioPortal Lymphoma Available online: https://bit.ly/3usTDbt (accessed on 29 January 2022)

41. Méndez-Ferrer S. Bonnet D. Steensma D.P. Hasserjian R.P. Ghobrial I.M. Gribben J.G. Andreeff M. Krause D.S. Bone marrow niches in haematological malignancies Nat. Rev. Cancer 2020 20 285 298 10.1038/s41568-020-0245-2 32112045 PMC9912977

42. Yang L. Rau R. Goodell M.A. DNMT3A in haematological malignancies Nat. Rev. Cancer 2015 15 152 165 10.1038/nrc3895 25693834 PMC5814392

43. Szymczyk A. Macheta A. Podhorecka M. Abnormal microRNA expression in the course of hematological malignancies Cancer Manag. Res. 2018 10 4267 4277 10.2147/CMAR.S174476 30349361 PMC6183594

44. Haas M. Lonial S. Targeted therapy for haematological malignancies: Clinical update from the American Society of Hematology, 2004 Expert. Opin. Investig. Drugs 2005 14 1161 1169 10.1517/13543784.14.9.1161 16144500

45. Cerami E. Gao J. Dogrusoz U. Gross B.E. Sumer S.O. Aksoy B.A. Jacobsen A. Byrne C.J. Heuer M.L. Larsson E. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data Cancer Discov. 2012 2 401 404 10.1158/2159-8290.CD-12-0095 22588877 PMC3956037

46. Gao J. Aksoy B.A. Dogrusoz U. Dresdner G. Gross B. Sumer S.O. Sun Y. Jacobsen A. Sinha R. Larsson E. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal Sci. Signal 2013 6 pl1 10.1126/scisignal.2004088 23550210 PMC4160307

47. Holmfeldt L. Wei L. Diaz-Flores E. Walsh M. Zhang J. Ding L. Payne-Turner D. Churchman M. Andersson A. Chen S.C. The genomic landscape of hypodiploid acute lymphoblastic leukemia Nat. Genet. 2013 45 242 252 10.1038/ng.2532 23334668 PMC3919793

48. Welch J.S. Petti A.A. Miller C.A. Fronick C.C. O’Laughlin M. Fulton R.S. Wilson R.K. Baty J.D. Duncavage E.J. Tandon B. TP53 and Decitabine in Acute Myeloid Leukemia and Myelodysplastic Syndromes N. Engl. J. Med. 2016 375 2023 2036 10.1056/NEJMoa1605949 27959731 PMC5217532

49. Tyner J.W. Tognon C.E. Bottomly D. Wilmot B. Kurtz S.E. Savage S.L. Long N. Schultz A.R. Traer E. Abel M. Functional genomic landscape of acute myeloid leukaemia Nature 2018 562 526 531 10.1038/s41586-018-0623-z 30333627 PMC6280667

50. TCGA, Firehose Legacy Acute Myeloid Leukemia Available online: https://bit.ly/3vPyg4p (accessed on 29 January 2022)

51. TARGET Pediatric Acute Myeloid Leukemia Available online: https://bit.ly/3tA7cow (accessed on 29 January 2022)

52. Diamond E.L. Durham B.H. Ulaner G.A. Drill E. Buthorn J. Ki M. Bitner L. Cho H. Young R.J. Francis J.H. Efficacy of MEK inhibition in patients with histiocytic neoplasms Nature 2019 567 521 524 10.1038/s41586-019-1012-y 30867592 PMC6438729

53. Yoshida K. Sanada M. Shiraishi Y. Nowak D. Nagata Y. Yamamoto R. Sato Y. Sato-Otsubo A. Kon A. Nagasaki M. Frequent pathway mutations of splicing machinery in myelodysplasia Nature 2011 478 64 69 10.1038/nature10496 21909114

54. Papaemmanuil E. Gerstung M. Bullinger L. Gaidzik V.I. Paschka P. Roberts N.D. Potter N.E. Heuser M. Thol F. Bolli N. Genomic Classification and Prognosis in Acute Myeloid Leukemia N. Engl. J. Med. 2016 374 2209 2221 10.1056/NEJMoa1516192 27276561 PMC4979995

55. Papaemmanuil E. Gerstung M. Malcovati L. Tauro S. Gundem G. Van Loo P. Yoon C.J. Ellis P. Wedge D.C. Pellagatti A. Clinical and biological implications of driver mutations in myelodysplastic syndromes Blood 2013 122 3616 3627 quiz 3699 10.1182/blood-2013-08-518886 24030381 PMC3837510

56. Nangalia J. Massie C.E. Baxter E.J. Nice F.L. Gundem G. Wedge D.C. Avezov E. Li J. Kollmann K. Kent D.G. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2 N. Engl. J. Med. 2013 369 2391 2405 10.1056/NEJMoa1312542 24325359 PMC3966280

57. Andersson A.K. Ma J. Wang J. Chen X. Gedman A.L. Dang J. Nakitandwe J. Holmfeldt L. Parker M. Easton J. The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias Nat. Genet. 2015 47 330 337 10.1038/ng.3230 25730765 PMC4553269

58. Zhang J. McCastlain K. Yoshihara H. Xu B. Chang Y. Churchman M.L. Wu G. Li Y. Wei L. Iacobucci I. Deregulation of DUX4 and ERG in acute lymphoblastic leukemia Nat. Genet. 2016 48 1481 1489 10.1038/ng.3691 27776115 PMC5144107

59. Landau D.A. Carter S.L. Stojanov P. McKenna A. Stevenson K. Lawrence M.S. Sougnez C. Stewart C. Sivachenko A. Wang L. Evolution and impact of subclonal mutations in chronic lymphocytic leukemia Cell 2013 152 714 726 10.1016/j.cell.2013.01.019 23415222 PMC3575604

60. Landau D.A. Tausch E. Taylor-Weiner A.N. Stewart C. Reiter J.G. Bahlo J. Kluth S. Bozic I. Lawrence M. Böttcher S. Mutations driving CLL and their evolution in progression and relapse Nature 2015 526 525 530 10.1038/nature15395 26466571 PMC4815041

61. TARGET Pediatric Acute Lymphoid Leukemia—Phase II Available online: https://bit.ly/3h9oZjw (accessed on 29 January 2022)

62. Puente X.S. Beà S. Valdés-Mas R. Villamor N. Gutiérrez-Abril J. Martín-Subero J.I. Munar M. Rubio-Pérez C. Jares P. Aymerich M. Non-coding recurrent mutations in chronic lymphocytic leukaemia Nature 2015 526 519 524 10.1038/nature14666 26200345

63. Quesada V. Conde L. Villamor N. Ordóñez G.R. Jares P. Bassaganyas L. Ramsay A.J. Beà S. Pinyol M. Martínez-Trillos A. Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia Nat. Genet. 2011 44 47 52 10.1038/ng.1032 22158541

64. Da Silva Almeida A.C. Abate F. Khiabanian H. Martinez-Escala E. Guitart J. Tensen C.P. Vermeer M.H. Rabadan R. Ferrando A. Palomero T. The mutational landscape of cutaneous T cell lymphoma and Sézary syndrome Nat. Genet. 2015 47 1465 1470 10.1038/ng.3442 26551667 PMC4878831

65. Chapuy B. Stewart C. Dunford A.J. Kim J. Kamburov A. Redd R.A. Lawrence M.S. Roemer M.G.M. Li A.J. Ziepert M. Molecular subtypes of diffuse large B cell lymphoma are associated with distinct pathogenic mechanisms and outcomes Nat. Med. 2018 24 679 690 10.1038/s41591-018-0016-8 29713087 PMC6613387

66. Lohr J.G. Stojanov P. Lawrence M.S. Auclair D. Chapuy B. Sougnez C. Cruz-Gordillo P. Knoechel B. Asmann Y.W. Slager S.L. Discovery and prioritization of somatic mutations in diffuse large B-cell lymphoma (DLBCL) by whole-exome sequencing Proc. Natl. Acad. Sci. USA 2012 109 3879 3884 10.1073/pnas.1121343109 22343534 PMC3309757

67. Reddy A. Zhang J. Davis N.S. Moffitt A.B. Love C.L. Waldrop A. Leppa S. Pasanen A. Meriranta L. Karjalainen-Lindsberg M.L. Genetic and Functional Drivers of Diffuse Large B Cell Lymphoma Cell 2017 171 481 494.e415 10.1016/j.cell.2017.09.027 28985567 PMC5659841

68. TCGA, PanCancer Atlas Diffuse Large B-Cell Lymphoma Available online: https://bit.ly/2REehXx (accessed on 29 January 2022)

69. Morin R.D. Mungall K. Pleasance E. Mungall A.J. Goya R. Huff R.D. Scott D.W. Ding J. Roth A. Chiu R. Mutational and structural analysis of diffuse large B-cell lymphoma using whole-genome sequencing Blood 2013 122 1256 1265 10.1182/blood-2013-02-483727 23699601 PMC3744992

70. TCGA, Firehose Legacy Lymphoid Neoplasm Diffuse Large B-cell Lymphoma Available online: https://bit.ly/3uvhass (accessed on 29 January 2022)

71. Haghighi F.H. Binaymotlagh R. Mirahmadi-Zare S.Z. Hadadzadeh H. Aptamer/magnetic nanoparticles decorated with fluorescent gold nanoclusters for selective detection and collection of human promyelocytic leukemia (HL-60) cells from a mixture Nanotechnology 2020 31 025605 10.1088/1361-6528/ab484a 31557732

72. Ensafi A.A. Taei M. Rahmani H. Khayamian T. Sensitive DNA impedance biosensor for detection of cancer, chronic lymphocytic leukemia, based on gold nanoparticles/gold modified electrode Electrochim. Acta 2011 56 8176 8183 10.1016/j.electacta.2011.05.124

73. Khoshfetrat S.M. Mehrgardi M.A. Amplified detection of leukemia cancer cells using an aptamer-conjugated gold-coated magnetic nanoparticles on a nitrogen-doped graphene modified electrode Bioelectrochemistry 2017 114 24 32 10.1016/j.bioelechem.2016.12.001 27992855

74. Araújo J.E. Lodeiro C. Capelo J.L. Rodríguez-González B. Dos Santos A.A. Santos H.M. Fernández-Lodeiro J. Novel nanocomposites based on a strawberry-like gold-coated magnetite (Fe@ Au) for protein separation in multiple myeloma serum samples Nano Res. 2015 8 1189 1198 10.1007/s12274-014-0599-4

75. Shan W. Pan Y. Fang H. Guo M. Nie Z. Huang Y. Yao S. An aptamer-based quartz crystal microbalance biosensor for sensitive and selective detection of leukemia cells using silver-enhanced gold nanoparticle label Talanta 2014 126 130 135 10.1016/j.talanta.2014.03.056 24881543

76. Yan Z. Yang M. Wang Z. Zhang F. Xia J. Shi G. Xia L. Li Y. Xia Y. Xia L. A label-free immunosensor for detecting common acute lymphoblastic leukemia antigen (CD10) based on gold nanoparticles by quartz crystal microbalance Sens. Actuators B Chem. 2015 210 248 253 10.1016/j.snb.2014.12.104

77. Ai J. Xu Y. Li D. Liu Z. Wang E. Folic acid as delivery vehicles: Targeting folate conjugated fluorescent nanoparticles to tumors imaging Talanta 2012 101 32 37 10.1016/j.talanta.2012.07.075 23158287

78. Mazloum-Ardakani M. Barazesh B. Khoshroo A. Moshtaghiun M. Sheikhha M.H. A new composite consisting of electrosynthesized conducting polymers, graphene sheets and biosynthesized gold nanoparticles for biosensing acute lymphoblastic leukemia Bioelectrochemistry 2018 121 38 45 10.1016/j.bioelechem.2017.12.010 29367018

79. MacLaughlin C. Parker E.P. Walker G. Wang C. Polymer-Coated Surface Enhanced Raman Scattering (SERS) Gold Nanoparticles for Multiplexed Labeling of Chronic Lymphocytic Leukemia Cells SPIE San Francisco, CA, USA 2012 8212 821203

80. Nguyen C.T. Nguyen J.T. Rutledge S. Zhang J. Wang C. Walker G.C. Detection of chronic lymphocytic leukemia cell surface markers using surface enhanced Raman scattering gold nanoparticles Cancer Lett. 2010 292 91 97 10.1016/j.canlet.2009.11.011 20042272

81. Ge S. Liu F. Liu W. Yan M. Song X. Yu J. Colorimetric assay of K-562 cells based on folic acid-conjugated porous bimetallic Pd@Au nanoparticles for point-of-care testing Chem. Commun. 2014 50 475 477 10.1039/C3CC47622G 24257545

82. Cordeiro M. Giestas L. Lima J.C. Baptista P.M. BioCode gold-nanobeacon for the detection of fusion transcripts causing chronic myeloid leukemia J. Nanobiotechnol. 2016 14 38 10.1186/s12951-016-0192-y 27185032 PMC4869199

83. Qu X. Wang J. Yao C. Zhang Z. Two-photon imaging of lymphoma cells targeted by gold nanoparticles Chin. Opt. Lett. 2008 6 879 881

84. Moghiseh M. Lowe C. Lewis J.G. Kumar D. Butler A. Anderson N. Raja A. Spectral Photon-Counting Molecular Imaging for Quantification of Monoclonal Antibody-Conjugated Gold Nanoparticles Targeted to Lymphoma and Breast Cancer: An In Vitro Study Contrast Media Mol. Imaging 2018 2018 2136840 10.1155/2018/2136840 30662379 PMC6312585

85. Sosnik A. Chapter 1—From the “Magic Bullet” to Advanced Nanomaterials for Active Targeting in Diagnostics and Therapeutics Biomedical Applications of Functionalized Nanomaterials Sarmento B. das Neves J. Elsevier Amsterdam, The Netherlands 2018 1 32

86. Roma-Rodrigues C. Fernandes A.R. Baptista P.V. Counteracting the effect of leukemia exosomes by antiangiogenic gold nanoparticles Int. J. Nanomed. 2019 14 6843 6854 10.2147/IJN.S215711 PMC6716571 31692567

87. Lin L. Chen J. Lin Q. Chen W. Chen J. Yao H. Liu A. Lin X. Chen Y. Electrochemical biosensor based on nanogold-modified poly-eriochrome black T film for BCR/ABL fusion gene assay by using hairpin LNA probe Talanta 2010 80 2113 2119 10.1016/j.talanta.2009.11.017 20152460

88. Svaasand L.O. Gomer C.J. Morinelli E. On the physical rationale of laser induced hyperthermia Lasers Med. Sci. 1990 5 121 128 10.1007/BF02031373

89. Ahmad R. Fu J. He N. Li S. Advanced Gold Nanomaterials for Photothermal Therapy of Cancer J. Nanosci. Nanotechnol. 2016 16 67 80 10.1166/jnn.2016.10770 27398434

90. Shao J. Cao S. Williams D.S. Abdelmohsen L. van Hest J.C.M. Photoactivated Polymersome Nanomotors: Traversing Biological Barriers Angew. Chem. Int. Ed. Engl. 2020 59 16918 16925 10.1002/anie.202003748 32533754 PMC7540338

91. Rengan A.K. Bukhari A.B. Pradhan A. Malhotra R. Banerjee R. Srivastava R. De A. In vivo analysis of biodegradable liposome gold nanoparticles as efficient agents for photothermal therapy of cancer Nano Lett. 2015 15 842 848 10.1021/nl5045378 25554860

92. Huang X. El-Sayed M.A. Gold nanoparticles: Optical properties and implementations in cancer diagnosis and photothermal therapy J. Adv. Res. 2010 1 13 28 10.1016/j.jare.2010.02.002

93. Lapotko D.O. Lukianova E. Oraevsky A.A. Selective laser nano-thermolysis of human leukemia cells with microbubbles generated around clusters of gold nanoparticles Lasers Surg. Med. 2006 38 631 642 10.1002/lsm.20359 16736503

94. Liopo A. Conjusteau A. Konopleva M. Andreeff M. Oraevsky A. Photothermal therapy of acute leukemia cells in the near-infrared region using gold nanorods CD-33 conjugates Optical Interactions with Tissue and Cells XXII SPIE San Francisco, CA, USA 2011 789710

95. O’Reilly M.K. Paulson J.C. Siglecs as targets for therapy in immune-cell-mediated disease Trends Pharmacol. Sci. 2009 30 240 248 10.1016/j.tips.2009.02.005 19359050 PMC2830709

96. Yang L. Meng H. Zong Y. Qian J. Jing Y. Tang J. Zou J. An G. Song H. Zhang X. Photothermal Targetting therapy of A20 Mouse Lymphoma model using Anti CD-138 Antibody conjugated Gold Nanospheres J. Hematol. Thromboembolic Dis. 2014 2 137 10.4172/2329-8790.1000137

97. Chen J. Fan T. Xie Z. Zeng Q. Xue P. Zheng T. Chen Y. Luo X. Zhang H. Advances in nanomaterials for photodynamic therapy applications: Status and challenges Biomaterials 2020 237 119827 10.1016/j.biomaterials.2020.119827 32036302

98. Kuo W.S. Chang Y.T. Cho K.C. Chiu K.C. Lien C.H. Yeh C.S. Chen S.J. Gold nanomaterials conjugated with indocyanine green for dual-modality photodynamic and photothermal therapy Biomaterials 2012 33 3270 3278 10.1016/j.biomaterials.2012.01.035 22289264

99. Lu F. Doane T.L. Zhu J.-J. Burda C. Gold nanoparticles for diagnostic sensing and therapy Inorg. Chim. Acta 2012 393 142 153 10.1016/j.ica.2012.05.038

100. Lkhagvadulam B. Kim J.H. Yoon I. Shim Y.K. Size-dependent photodynamic activity of gold nanoparticles conjugate of water soluble purpurin-18-N-methyl-d-glucamine Biomed. Res. Int. 2013 2013 720579 10.1155/2013/720579 23533998 PMC3591214

101. Moan J. Berg K. The photodegradation of porphyrins in cells can be used to estimate the lifetime of singlet oxygen Photochem. Photobiol. 1991 53 549 553 10.1111/j.1751-1097.1991.tb03669.x 1830395

102. Spikes J.D. Chlorins as photosensitizers in biology and medicine J. Photochem. Photobiol. B 1990 6 259 274 10.1016/1011-1344(90)85096-F 2120404

103. Wang J. You M. Zhu G. Shukoor M.I. Chen Z. Zhao Z. Altman M.B. Yuan Q. Zhu Z. Chen Y. Photosensitizer-gold nanorod composite for targeted multimodal therapy Small 2013 9 3678 3684 10.1002/smll.201202155 23661612 PMC4133987

104. Philchenkov A.A. Shishko E.D. Zavelevich M.P. Kuiava L.M. Miura K. Blokhin D.Y. Shton I.O. Gamaleia N.F. Photodynamic responsiveness of human leukemia Jurkat/A4 cells with multidrug resistant phenotype Exp. Oncol. 2014 36 241 245 25537217

105. Mahmoudi K. Garvey K.L. Bouras A. Cramer G. Stepp H. Jesu Raj J.G. Bozec D. Busch T.M. Hadjipanayis C.G. 5-aminolevulinic acid photodynamic therapy for the treatment of high-grade gliomas J. Neurooncol. 2019 141 595 607 10.1007/s11060-019-03103-4 30659522 PMC6538286

106. Zhang Z. Wang S. Xu H. Wang B. Yao C. Role of 5-aminolevulinic acid-conjugated gold nanoparticles for photodynamic therapy of cancer J. Biomed. Opt. 2015 20 51043 10.1117/1.JBO.20.5.051043 26021715

107. Belka C. Ottinger H. Kreuzfelder E. Weinmann M. Lindemann M. Lepple-Wienhues A. Budach W. Grosse-Wilde H. Bamberg M. Impact of localized radiotherapy on blood immune cells counts and function in humans Radiother. Oncol. 1999 50 199 204 10.1016/S0167-8140(98)00130-3 10368044

108. Coughlin B.P. Lawrence P.T. Lui I. Luby C.J. Spencer D.J. Sykes E.C.H. Mace C.R. Evidence for biological effects in the radiosensitization of leukemia cell lines by PEGylated gold nanoparticles J. Nanoparticle Res. 2020 22 53 10.1007/s11051-020-4765-1

109. Mendes R. Fernandes A.R. Baptista P.V. Gold Nanoparticle Approach to the Selective Delivery of Gene Silencing in Cancer-The Case for Combined Delivery? Genes 2017 8 94 10.3390/genes8030094 PMC5368698 28257109

110. Xu X. Ho W. Zhang X. Bertrand N. Farokhzad O. Cancer nanomedicine: From targeted delivery to combination therapy Trends Mol. Med. 2015 21 223 232 10.1016/j.molmed.2015.01.001 25656384 PMC4385479

111. Lam J.K. Chow M.Y. Zhang Y. Leung S.W. siRNA Versus miRNA as Therapeutics for Gene Silencing Mol. Ther. Nucleic Acids 2015 4 e252 10.1038/mtna.2015.23 26372022 PMC4877448

112. Quintás-Cardama A. Cortes J. Molecular biology of bcr-abl1-positive chronic myeloid leukemia Blood 2009 113 1619 1630 10.1182/blood-2008-03-144790 18827185 PMC3952549

113. Vinhas R. Fernandes A.R. Baptista P.V. Gold Nanoparticles for BCR-ABL1 Gene Silencing: Improving Tyrosine Kinase Inhibitor Efficacy in Chronic Myeloid Leukemia Mol. Ther. Nucleic Acids 2017 7 408 416 10.1016/j.omtn.2017.05.003 28624216 PMC5436101

114. Vuelta E. García-Tuñón I. Hernández-Carabias P. Méndez L. Sánchez-Martín M. Future Approaches for Treating Chronic Myeloid Leukemia: CRISPR Therapy Biology 2021 10 118 10.3390/biology10020118 33557401 PMC7915349

115. Zaimy M.A. Jebali A. Bazrafshan B. Mehrtashfar S. Shabani S. Tavakoli A. Hekmatimoghaddam S.H. Sarli A. Azizi H. Izadi P. Coinhibition of overexpressed genes in acute myeloid leukemia subtype M2 by gold nanoparticles functionalized with five antisense oligonucleotides and one anti-CD33(+)/CD34(+) aptamer Cancer Gene Ther. 2016 23 315 320 10.1038/cgt.2016.33 27514505

116. Rosenberg J.E. Bambury R.M. Van Allen E.M. Drabkin H.A. Lara P.N. Harzstark A.L. Wagle N. Figlin R.A. Smith G.W. Garraway L.A. A phase II trial of AS1411 (a novel nucleolin-targeted DNA aptamer) in metastatic renal cell carcinoma Investig. New Drugs 2014 32 178 187 10.1007/s10637-013-0045-6 24242861 PMC4560460

117. Gullà A. Di Martino M.T. Gallo Cantafio M.E. Morelli E. Amodio N. Botta C. Pitari M.R. Lio S.G. Britti D. Stamato M.A. A 13 mer LNA-i-miR-221 Inhibitor Restores Drug Sensitivity in Melphalan-Refractory Multiple Myeloma Cells Clin. Cancer Res. 2016 22 1222 1233 10.1158/1078-0432.CCR-15-0489 26527748 PMC4775414

118. Pineau P. Volinia S. McJunkin K. Marchio A. Battiston C. Terris B. Mazzaferro V. Lowe S.W. Croce C.M. Dejean A. miR-221 overexpression contributes to liver tumorigenesis Proc. Natl. Acad. Sci. USA 2010 107 264 269 10.1073/pnas.0907904107 20018759 PMC2806773

119. Deng R. Shen N. Yang Y. Yu H. Xu S. Yang Y.W. Liu S. Meguellati K. Yan F. Targeting epigenetic pathway with gold nanoparticles for acute myeloid leukemia therapy Biomaterials 2018 167 80 90 10.1016/j.biomaterials.2018.03.013 29554483

120. Deng R. Ji B. Yu H. Bao W. Yang Z. Yu Y. Cui Y. Du Y. Song M. Liu S. Multifunctional Gold Nanoparticles Overcome MicroRNA Regulatory Network Mediated-Multidrug Resistant Leukemia Sci. Rep. 2019 9 5348 10.1038/s41598-019-41866-y 30926883 PMC6440980

121. Liu Q.G. Zhao X. Xu N. Wu L.H. Li S.Z. Mi Y.C. Organ toxicity and efficacy of high-dose daunorubicin-based chemotherapy in the treatment of acute leukemia Zhonghua Xue Ye Xue Za Zhi 2013 34 587 590 23906451 10.3760/cma.j.issn.0253-2727.2013.07.006

122. Jackson G. Taylor P. Smith G.M. Marcus R. Smith A. Chu P. Littlewood T.J. Duncombe A. Hutchinson M. Mehta A.B. A multicentre, open, non-comparative phase II study of a combination of fludarabine phosphate, cytarabine and granulocyte colony-stimulating factor in relapsed and refractory acute myeloid leukaemia and de novo refractory anaemia with excess of blasts in transformation Br. J. Haematol. 2001 112 127 137 11167793 10.1046/j.1365-2141.2001.02551.x

123. Janssens A. Boogaerts M. Verhoef G. Development of fludarabine formulations in the treatment of chronic lymphocytic leukemia Drug Des. Devel. Ther. 2009 3 241 252 10.2147/DDDT.S5603 20054443 PMC2802124

124. Song S. Hao Y. Yang X. Patra P. Chen J. Using Gold Nanoparticles as Delivery Vehicles for Targeted Delivery of Chemotherapy Drug Fludarabine Phosphate to Treat Hematological Cancers J. Nanosci. Nanotechnol. 2016 16 2582 2586 10.1166/jnn.2016.12349 27455673

125. Guo D. Wu C. Song W. Jiang H. Wang X. Chen B. Effect of colloidal gold nanoparticles on cell interface and their enhanced intracellular uptake of arsenic trioxide in leukemia cancer cells J. Nanosci. Nanotechnol. 2009 9 4611 4617 10.1166/jnn.2009.221 19928125

126. Patra C.R. Verma R. Kumar S. Greipp P.R. Mukhopadhyay D. Mukherjee P. Fabrication of gold nanoparticle for potential application in multiple myeloma J. Biomed. Nanotechnol. 2008 4 499 507 10.1166/jbn.2008.015

127. Aubel-Sadron G. Londos-Gagliardi D. Daunorubicin and doxorubicin, anthracycline antibiotics, a physicochemical and biological review Biochimie 1984 66 333 352 10.1016/0300-9084(84)90018-X 6380596

128. Dizman H.M. Eroglu G.O. Kuruca S.E. Arsu N. Photochemically prepared monodisperse gold nanoparticles as doxorubicin carrier and its cytotoxicity on leukemia cancer cells Appl. Nanosci. 2021 11 309 320 10.1007/s13204-020-01589-3

129. Escherich G. Zimmermann M. Janka-Schaub G. Doxorubicin or daunorubicin given upfront in a therapeutic window are equally effective in children with newly diagnosed acute lymphoblastic leukemia. A randomized comparison in trial CoALL 07-03 Pediatr. Blood Cancer 2013 60 254 257 10.1002/pbc.24273 22948968

130. Danesh N.M. Lavaee P. Ramezani M. Abnous K. Taghdisi S.M. Targeted and controlled release delivery of daunorubicin to T-cell acute lymphoblastic leukemia by aptamer-modified gold nanoparticles Int. J. Pharm. 2015 489 311 317 10.1016/j.ijpharm.2015.04.072 25936625

131. Shi P.-J. Xu L.-H. Lin K.-Y. Weng W.-j. Fang J.-P. Synergism between the mTOR inhibitor rapamycin and FAK down-regulation in the treatment of acute lymphoblastic leukemia J. Hematol. Oncol. 2016 9 12 10.1186/s13045-016-0241-x 26892465 PMC4757994

132. Brown V.I. Fang J. Alcorn K. Barr R. Kim J.M. Wasserman R. Grupp S.A. Rapamycin is active against B-precursor leukemia in vitro and in vivo, an effect that is modulated by IL-7-mediated signaling Proc. Natl. Acad. Sci. USA 2003 100 15113 15118 10.1073/pnas.2436348100 14657335 PMC299917

133. Musa J. Orth M.F. Dallmayer M. Baldauf M. Pardo C. Rotblat B. Kirchner T. Leprivier G. Grünewald T.G.P. Eukaryotic initiation factor 4E-binding protein 1 (4E-BP1): A master regulator of mRNA translation involved in tumorigenesis Oncogene 2016 35 4675 4688 10.1038/onc.2015.515 26829052

134. Petrushev B. Boca S. Simon T. Berce C. Frinc I. Dima D. Selicean S. Gafencu G.A. Tanase A. Zdrenghea M. Gold nanoparticles enhance the effect of tyrosine kinase inhibitors in acute myeloid leukemia therapy Int. J. Nanomed. 2016 11 641 660 10.2147/IJN.S94064 PMC4760658 26929621

135. Daver N. Schlenk R.F. Russell N.H. Levis M.J. Targeting FLT3 mutations in AML: Review of current knowledge and evidence Leukemia 2019 33 299 312 10.1038/s41375-018-0357-9 30651634 PMC6365380

136. Simon T. Tomuleasa C. Bojan A. Berindan-Neagoe I. Boca S. Astilean S. Design of FLT3 Inhibitor—Gold Nanoparticle Conjugates as Potential Therapeutic Agents for the Treatment of Acute Myeloid Leukemia Nanoscale Res. Lett. 2015 10 466 10.1186/s11671-015-1154-2 26625890 PMC4666845

137. Vinhas R. Cordeiro M. Pedrosa P. Fernandes A.R. Baptista P.V. Current trends in molecular diagnostics of chronic myeloid leukemia Leuk. Lymphoma 2017 58 1791 1804 10.1080/10428194.2016.1265116 27919203

138. Ganbold E.O. Byun J. Lee S. Joo S.W. Raman spectroscopy of combinatory anticancer drug release from gold nanoparticles inside a single leukemia cell J. Raman Spectrosc. 2013 44 675 679 10.1002/jrs.4266

139. Elion G.B. The purine path to chemotherapy Science 1989 244 41 47 10.1126/science.2649979 2649979

140. Cheok M.H. Evans W.E. Acute lymphoblastic leukaemia: A model for the pharmacogenomics of cancer therapy Nat Rev Cancer 2006 6 117 129 10.1038/nrc1800 16491071

141. Podsiadlo P. Sinani V.A. Bahng J.H. Kam N.W. Lee J. Kotov N.A. Gold nanoparticles enhance the anti-leukemia action of a 6-mercaptopurine chemotherapeutic agent Langmuir 2008 24 568 574 10.1021/la702782k 18052300

142. Koźmiński P. Halik P.K. Chesori R. Gniazdowska E. Overview of Dual-Acting Drug Methotrexate in Different Neurological Diseases, Autoimmune Pathologies and Cancers Int. J. Mol. Sci. 2020 21 3483 10.3390/ijms21103483 PMC7279024 32423175

143. Mandal P. Samaddar S. Chandra J. Parakh N. Goel M. Adverse effects with intravenous methotrexate in children with acute lymphoblastic leukemia/lymphoma: A retrospective study Indian J. Hematol. Blood Transfus. 2020 36 498 504 10.1007/s12288-019-01245-z 32647424 PMC7326748

144. Egusa S. Ebrahem Q. Mahfouz R.Z. Saunthararajah Y. Ligand exchange on gold nanoparticles for drug delivery and enhanced therapeutic index evaluated in acute myeloid leukemia models Exp. Biol. Med. 2014 239 853 861 10.1177/1535370214536648 24879424

145. Bhattacharya R. Patra C.R. Earl A. Wang S. Katarya A. Lu L. Kizhakkedathu J.N. Yaszemski M.J. Greipp P.R. Mukhopadhyay D. Attaching folic acid on gold nanoparticles using noncovalent interaction via different polyethylene glycol backbones and targeting of cancer cells Nanomed. Nanotechnol. Biol. Med. 2007 3 224 238 10.1016/j.nano.2007.07.001

146. Soe Z.C. Poudel B.K. Nguyen H.T. Thapa R.K. Ou W. Gautam M. Poudel K. Jin S.G. Jeong J.H. Ku S.K. Folate-targeted nanostructured chitosan/chondroitin sulfate complex carriers for enhanced delivery of bortezomib to colorectal cancer cells Asian J. Pharm. Sci. 2019 14 40 51 10.1016/j.ajps.2018.09.004 32104437 PMC7032194

147. Greipp P. Cascino G. Kimlinger T. Rajkumar V. Prendergast F.G. Fonseca R. Bergsagel P.L. Low P.S. Greipp P.R. Plasma Cell Folate Receptor Overexpression Differentiates Multiple Myeloma from Monoclonal Gammopathy of Undetermined Significance and Smoldering Myeloma Blood 2004 104 3649 10.1182/blood.V104.11.3649.3649

148. Abdalla M. Sharada H. Mostafa K. Azzam E. Ali E. Abdel-Ghany I. Ayad E. Therapeutic effect of antimyeloma antibodies conjugated with gold nanoparticles on the growth of myeloma cell line Int. Multidiscip. Res. J. 2012 2 64 70

149. Bhattacharya R. Patra C.R. Verma R. Kumar S. Greipp P.R. Mukherjee P. Gold nanoparticles inhibit the proliferation of multiple myeloma cells Adv. Mater. 2007 19 711 716 10.1002/adma.200602098

150. Boca S. Lucan C. Frinc I. Petrushev B. SIMON T. Berce C. Gafencu G.-A. Dima D. Tanase A. Selicean S. Gold nanoparticles conjugated with rituximab for the treatment of chronic lymphocytic leukaemia Farmacia 2016 64 688 698

151. Cherukuri P. Glazer E.S. Curley S.A. Targeted hyperthermia using metal nanoparticles Adv. Drug Deliv. Rev. 2010 62 339 345 10.1016/j.addr.2009.11.006 19909777 PMC2827640

152. Plosker G.L. Figgitt D.P. Rituximab: A review of its use in non-Hodgkin’s lymphoma and chronic lymphocytic leukaemia Drugs 2003 63 803 843 10.2165/00003495-200363080-00005 12662126

153. Ocampo García B. Miranda Olvera R. Santos Cuevas C. García Becerra R. Azorín Vega E. Ordaz Rosado D. In vitro decrease of the BCL-2 protein levels in lymphoma cells induced by gold nanoparticles and gold nanoparticles-anti-CD20 Nanosci. Technol. 2014 1 1 6

154. Weiss A. Preston T.C. Popov J. Li Q. Wu S. Chou K.C. Burt H.M. Bally M.B. Signorell R. Selective recognition of rituximab-functionalized gold nanoparticles by lymphoma cells studied with 3D imaging J. Phys. Chem. C 2009 113 20252 20258 10.1021/jp907423z

155. Korkolopoulou P. Viniou N. Kavantzas N. Patsouris E. Thymara I. Pavlopoulos P.M. Terpos E. Stamatopoulos K. Plata E. Anargyrou K. Clinicopathologic correlations of bone marrow angiogenesis in chronic myeloid leukemia: A morphometric study Leukemia 2003 17 89 97 10.1038/sj.leu.2402769 12529665

156. Deshantri A.K. Varela Moreira A. Ecker V. Mandhane S.N. Schiffelers R.M. Buchner M. Fens M. Nanomedicines for the treatment of hematological malignancies J. Control Release 2018 287 194 215 10.1016/j.jconrel.2018.08.034 30165140

157. Ahmeda A. Zangeneh M.M. Novel green synthesis of Boswellia serrata leaf aqueous extract conjugated gold nanoparticles with excellent anti-acute myeloid leukemia property in comparison to mitoxantrone in a leukemic mice model: Introducing a new chemotherapeutic drug Appl. Organomet. Chem. 2020 34 e5344 10.1002/aoc.5344

158. Ahmeda A. Zangeneh M.M. Zangeneh A. Green formulation and chemical characterization of Lens culinaris seed aqueous extract conjugated gold nanoparticles for the treatment of acute myeloid leukemia in comparison to mitoxantrone in a leukemic mouse model Appl. Organomet. Chem. 2020 34 e5369 10.1002/aoc.5369

159. Ahmeda A. Zangeneh A. Zangeneh M.M. Green synthesis and chemical characterization of gold nanoparticle synthesized using Camellia sinensis leaf aqueous extract for the treatment of acute myeloid leukemia in comparison to daunorubicin in a leukemic mouse model Appl. Organomet. Chem. 2020 34 e5290 10.1002/aoc.5290

160. Zangeneh M.M. Zangeneh A. Novel green synthesis of Hibiscus sabdariffa flower extract conjugated gold nanoparticles with excellent anti-acute myeloid leukemia effect in comparison to daunorubicin in a leukemic rodent model Appl. Organomet. Chem. 2020 34 e5271 10.1002/aoc.5271

161. Hemmati S. Joshani Z. Zangeneh A. Zangeneh M.M. Green synthesis and chemical characterization of Thymus vulgaris leaf aqueous extract conjugated gold nanoparticles for the treatment of acute myeloid leukemia in comparison to doxorubicin in a leukemic mouse model Appl. Organomet. Chem. 2020 34 e5267 10.1002/aoc.5267

162. Burdon R.H. Superoxide and hydrogen peroxide in relation to mammalian cell proliferation Free Radic. Biol. Med. 1995 18 775 794 10.1016/0891-5849(94)00198-S 7750801

163. Samimi A. Khodayar M.J. Alidadi H. Khodadi E. The Dual Role of ROS in Hematological Malignancies: Stem Cell Protection and Cancer Cell Metastasis Stem Cell Rev. Rep. 2020 16 262 275 10.1007/s12015-019-09949-5 31912368

164. Sillar J.R. Germon Z.P. DeIuliis G.N. Dun M.D. The Role of Reactive Oxygen Species in Acute Myeloid Leukaemia Int. J. Mol. Sci. 2019 20 6003 10.3390/ijms20236003 31795243 PMC6929020

165. Kwon S. Ko H. You D.G. Kataoka K. Park J.H. Nanomedicines for Reactive Oxygen Species Mediated Approach: An Emerging Paradigm for Cancer Treatment Acc. Chem. Res. 2019 52 1771 1782 10.1021/acs.accounts.9b00136 31241894

166. Prieto-Bermejo R. Romo-González M. Pérez-Fernández A. Ijurko C. Hernández-Hernández Á. Reactive oxygen species in haematopoiesis: Leukaemic cells take a walk on the wild side J. Exp. Clin. Cancer Res. CR 2018 37 125 10.1186/s13046-018-0797-0 29940987 PMC6019308

167. Fiers W. Beyaert R. Declercq W. Vandenabeele P. More than one way to die: Apoptosis, necrosis and reactive oxygen damage Oncogene 1999 18 7719 7730 10.1038/sj.onc.1203249 10618712

168. Matés J.M. Segura J.A. Alonso F.J. Márquez J. Intracellular redox status and oxidative stress: Implications for cell proliferation, apoptosis, and carcinogenesis Arch. Toxicol. 2008 82 273 299 10.1007/s00204-008-0304-z 18443763

169. Higashi Y. Mazumder J. Yoshikawa H. Saito M. Tamiya E. Chemically Regulated ROS Generation from Gold Nanoparticles for Enzyme-Free Electrochemiluminescent Immunosensing Anal. Chem. 2018 90 5773 5780 10.1021/acs.analchem.8b00118 29637777

170. Choi B.J. Jung K.O. Graves E.E. Pratx G. A gold nanoparticle system for the enhancement of radiotherapy and simultaneous monitoring of reactive-oxygen-species formation Nanotechnology 2018 29 504001 10.1088/1361-6528/aae272 30229748 PMC6264885

171. Minai L. Yeheskely-Hayon D. Yelin D. High levels of reactive oxygen species in gold nanoparticle-targeted cancer cells following femtosecond pulse irradiation Sci. Rep. 2013 3 2146 10.1038/srep02146 23828378 PMC3701901

172. Wen T. Yang A. Wang T. Jia M. Lai X. Meng J. Liu J. Han B. Xu H. Ultra-small platinum nanoparticles on gold nanorods induced intracellular ROS fluctuation to drive megakaryocytic differentiation of leukemia cells Biomater. Sci. 2020 8 6204 6211 10.1039/D0BM01547D 33078787

173. Huang Y.C. Yang Y.C. Yang K.C. Shieh H.R. Wang T.Y. Hwu Y. Chen Y.J. Pegylated gold nanoparticles induce apoptosis in human chronic myeloid leukemia cells Biomed. Res. Int. 2014 2014 182353 10.1155/2014/182353 24790990 PMC3984874

174. Mukherjee P. Bhattacharya R. Bone N. Lee Y.K. Patra C.R. Wang S. Lu L. Secreto C. Banerjee P.C. Yaszemski M.J. Potential therapeutic application of gold nanoparticles in B-chronic lymphocytic leukemia (BCLL): Enhancing apoptosis J. Nanobiotechnol. 2007 5 4 10.1186/1477-3155-5-4 17488514 PMC1876244

175. Deepak M. Handa S.S. Antiinflammatory activity and chemical composition of extracts of Verbena officinalis Phytother. Res. 2000 14 463 465 10.1002/1099-1573(200009)14:6<463::AID-PTR611>3.0.CO;2-G 10960904

176. Ma Z. Zhao X. Jiang C. Yu J. Wu J. Zeng X. Gold nanoshells with verbascoside induce the apoptosis of drug-resistant leukemia cells through caspases pathway and inhibit tumor growth J. Nanosci. Nanotechnol. 2016 16 7118 7124 10.1166/jnn.2016.11357

177. Lin A.Y. Rink J.S. Karmali R. Xu J. Kocherginsky M. Thaxton C.S. Gordon L.I. Tri-ethylene glycol modified class B and class C CpG conjugated gold nanoparticles for the treatment of lymphoma Nanomedicine 2020 30 102290 10.1016/j.nano.2020.102290 32798731

178. Namvar F. Rahman H.S. Mohamad R. Rasedee A. Yeap S.K. Chartrand M.S. Azizi S. Tahir P.M. Apoptosis induction in human leukemia cell lines by gold nanoparticles synthesized using the green biosynthetic approach J. Nanomater. 2016 16 330 10.1155/2015/642621

179. Gautam P. Kumar S. Tomar M. Singh R. Acharya A. Biologically Synthesized Gold Nanoparticles using Ocimum sanctum (Tulsi Leaf Extract) Induced Anti-Tumor Response in a T Cell Daltons Lymphoma J. Cell Sci. Ther. 2017 8 2 10.4172/2157-7013.1000278

180. Shahriari S. Bakhshi M. Shahverdi A.R. Berahmeh A. Safavifar F. Khorramizadeh M.R. Targeted Intracellular Heat Transfer in Cancer Therapy: Assessment of Asparagine-laminated Gold Nanoparticles in Cell Model of T cell Leukemia Iran J. Public Health 2017 46 357 367 28435822 PMC5395532

181. Amin Asnafi A. Bagheri M. Zibara K. Maleki Behzad M. Shahrabi S. Expression and Activity of Matrix Metalloproteinases in Leukemia J. Pediatr. Hematol. Oncol. 2019 41 87 95 10.1097/MPH.0000000000001386 30557170

182. Eslahi N. Shakeri-Zadeh A. Ashtari K. Pirhajati-Mahabadi V. Tohidi Moghadam T. Shabani R. Kamrava K. Madjd Z. Maki C. Asgari H.R. In Vitro Cytotoxicity of Folate-Silica-Gold Nanorods on Mouse Acute Lymphoblastic Leukemia and Spermatogonial Cells Cell J. 2019 21 14 26 30507084 10.22074/cellj.2019.5691 PMC6275430

183. Anselmo A.C. Mitragotri S. Nanoparticles in the clinic: An update Bioeng. Transl. Med. 2019 4 e10143 10.1002/btm2.10143 31572799 PMC6764803

184. Shakil M.S. Parveen S. Rana Z. Walsh F. Movassaghi S. Söhnel T. Azam M. Shaheen M.A. Jamieson S.M.F. Hanif M. High Antiproliferative Activity of Hydroxythiopyridones over Hydroxypyridones and Their Organoruthenium Complexes Biomedicines 2021 9 123 10.3390/biomedicines9020123 33513800 PMC7912191

185. Shakil M.S. Hasan M.A. Uddin M.F. Islam A. Nahar A. Das H. Khan M.N.I. Dey B.P. Rokeya B. Hoque S.M. In Vivo Toxicity Studies of Chitosan-Coated Cobalt Ferrite Nanocomplex for Its Application as MRI Contrast Dye ACS Appl. Bio Mater. 2020 3 7952 7964 10.1021/acsabm.0c01069 35019535

186. Arruga F. Gyau B.B. Iannello A. Vitale N. Vaisitti T. Deaglio S. Immune Response Dysfunction in Chronic Lymphocytic Leukemia: Dissecting Molecular Mechanisms and Microenvironmental Conditions Int. J. Mol. Sci. 2020 21 1825 10.3390/ijms21051825 32155826 PMC7084946

187. Riches J.C. Ramsay A.G. Gribben J.G. Immune reconstitution in chronic lymphocytic leukemia Curr. Hematol. Malig. Rep. 2012 7 13 20 10.1007/s11899-011-0106-x 22231031 PMC4533917

188. Lamble A.J. Kosaka Y. Laderas T. Maffit A. Kaempf A. Brady L.K. Wang W. Long N. Saultz J.N. Mori M. Reversible suppression of T cell function in the bone marrow microenvironment of acute myeloid leukemia Proc. Natl. Acad. Sci. USA 2020 117 14331 14341 10.1073/pnas.1916206117 32513686 PMC7321988

189. MacKenzie P. Kamili Q.U. Menter A. Cooper B. Lymphoma and immunosuppression: A report of a case associated with efalizumab therapy Clin. Lymphoma Myeloma Leuk. 2010 10 E14 E16 10.3816/CLML.2010.n.011 20223722

190. Jacobson D.R. Zolla-Pazner S. Immunosuppression and infection in multiple myeloma Semin. Oncol. 1986 13 282 290 3532328

191. Lazarovits J. Chen Y.Y. Sykes E.A. Chan W.C. Nanoparticle-blood interactions: The implications on solid tumour targeting Chem. Commun. 2015 51 2756 2767 10.1039/C4CC07644C 26829150

192. Alkilany A.M. Murphy C.J. Toxicity and cellular uptake of gold nanoparticles: What we have learned so far? J. Nanoparticle Res. 2010 12 2313 2333 10.1007/s11051-010-9911-8 PMC2988217 21170131

193. Jiao Q. Li L. Mu Q. Zhang Q. Immunomodulation of nanoparticles in nanomedicine applications Biomed. Res. Int. 2014 2014 426028 10.1155/2014/426028 24949448 PMC4052466

194. Hannon G. Lysaght J. Liptrott N.J. Prina-Mello A. Immunotoxicity Considerations for Next Generation Cancer Nanomedicines Adv. Sci. 2019 6 1900133 10.1002/advs.201900133 31592123 PMC6774033

195. Simpson C.A. Huffman B.J. Gerdon A.E. Cliffel D.E. Unexpected toxicity of monolayer protected gold clusters eliminated by PEG-thiol place exchange reactions Chem. Res. Toxicol. 2010 23 1608 1616 10.1021/tx100209t 20715858 PMC2989342

196. Abdelhalim M.A.K. Uptake of Gold Nanoparticles in Several Rat Organs after Intraperitoneal Administration In Vivo: A Fluorescence Study BioMed Res. Int. 2013 2013 353695 10.1155/2013/353695 23956977 PMC3730147

197. Bailly A.-L. Correard F. Popov A. Tselikov G. Chaspoul F. Appay R. Al-Kattan A. Kabashin A.V. Braguer D. Esteve M.-A. In vivo evaluation of safety, biodistribution and pharmacokinetics of laser-synthesized gold nanoparticles Sci. Rep. 2019 9 12890 10.1038/s41598-019-48748-3 31501470 PMC6734012

198. Hainfeld J.F. Slatkin D.N. Focella T.M. Smilowitz H.M. Gold nanoparticles: A new X-ray contrast agent Br. J. Radiol. 2006 79 248 253 10.1259/bjr/13169882 16498039

199. Zhang X.D. Wu H.Y. Wu D. Wang Y.Y. Chang J.H. Zhai Z.B. Meng A.M. Liu P.X. Zhang L.A. Fan F.Y. Toxicologic effects of gold nanoparticles in vivo by different administration routes Int. J. Nanomed. 2010 5 771 781 10.2147/IJN.S8428 PMC2962273 21042423

200. Rambanapasi C. Zeevaart J.R. Buntting H. Bester C. Kotze D. Hayeshi R. Grobler A. Bioaccumulation and Subchronic Toxicity of 14 nm Gold Nanoparticles in Rats Molecules 2016 21 763 10.3390/molecules21060763 PMC6273121 27294904

201. Mateo D. Morales P. Ávalos A. Haza A.I. Comparative cytotoxicity evaluation of different size gold nanoparticles in human dermal fibroblasts J. Exp. Nanosci. 2015 10 1401 1417 10.1080/17458080.2015.1014934

202. Shukla R. Bansal V. Chaudhary M. Basu A. Bhonde R.R. Sastry M. Biocompatibility of gold nanoparticles and their endocytotic fate inside the cellular compartment: A microscopic overview Langmuir 2005 21 10644 10654 10.1021/la0513712 16262332

203. Balfourier A. Luciani N. Wang G. Lelong G. Ersen O. Khelfa A. Alloyeau D. Gazeau F. Carn F. Unexpected intracellular biodegradation and recrystallization of gold nanoparticles Proc. Natl. Acad. Sci. USA 2020 117 103 113 10.1073/pnas.1911734116 31852822 PMC6955300

204. Peng F. Setyawati M.I. Tee J.K. Ding X. Wang J. Nga M.E. Ho H.K. Leong D.T. Nanoparticles promote in vivo breast cancer cell intravasation and extravasation by inducing endothelial leakiness Nat. Nanotechnol. 2019 14 279 286 10.1038/s41565-018-0356-z 30692675

205. Ghobrial I.M. Myeloma as a model for the process of metastasis: Implications for therapy Blood 2012 120 20 30 10.1182/blood-2012-01-379024 22535658 PMC3390959

206. Trendowski M. The inherent metastasis of leukaemia and its exploitation by sonodynamic therapy Crit. Rev. Oncol. Hematol. 2015 94 149 163 10.1016/j.critrevonc.2014.12.013 25604499

207. Aoudjit F. Potworowski E.F. St-Pierre Y. The metastatic characteristics of murine lymphoma cell lines in vivo are manifested after target organ invasion Blood 1998 91 623 629 10.1182/blood.V91.2.623 9427718

208. Malinova T.S. Huveneers S. Opening the vascular gate Nat. Nanotechnol. 2019 14 195 196 10.1038/s41565-019-0372-7 30692674

209. Auger C. Said A. Nguyen P.N. Chabert P. Idris-Khodja N. Schini-Kerth V.B. Potential of Food and Natural Products to Promote Endothelial and Vascular Health J. Cardiovasc. Pharmacol. 2016 68 11 18 10.1097/FJC.0000000000000382 26974893

210. Lindstrom A.L. Erlandsen S.L. Kersey J.H. Pennell C.A. An in vitro model for toxin-mediated vascular leak syndrome: Ricin toxin A chain increases the permeability of human endothelial cell monolayers Blood 1997 90 2323 2334 10.1182/blood.V90.6.2323 9310483

211. Wang K. Wu C. Wang F. Liao M. Jiang G. Bimetallic nanoparticles decorated hollow nanoporous carbon framework as nanozyme biosensor for highly sensitive electrochemical sensing of uric acid Biosens. Bioelectron. 2020 150 111869 10.1016/j.bios.2019.111869 31735624

212. Conte N. Mason J.C. Halmagyi C. Neuhauser S. Mosaku A. Yordanova G. Chatzipli A. Begley D.A. Krupke D.M. Parkinson H. PDX Finder: A portal for patient-derived tumor xenograft model discovery Nucleic Acids Res. 2019 47 D1073 D1079 10.1093/nar/gky984 30535239 PMC6323912

213. MMHCdb Patient Derived Xenograft Search Results Available online: https://bit.ly/2RKS1vT (accessed on 29 January 2022)

214. PDX-Finder Hematopoietic and Lymphoid System Cancer Available online: https://bit.ly/3oYTH0N (accessed on 29 January 2022)