The protective and chemotherapeutical role of amygdalin in induced mammary cancer in experimental mice and upregulation of related genes.

Introduction

Breast cancer is a subtype that develops in the breast tissue itself, typically in the ductal carcinoma in situ (DCIS) or lobules that feed the ducts. Sometimes, DCIS develops into an aggressive malignancy, while in others, the cells remain in the ducts and never act deeper or spread to the lymph nodes or other organs 1 . Different from ductal carcinoma in situ, lobular carcinoma in situ is the cause of the second subtype of breast cancer (LCIS). In LCIS, cancer cells grow in milk-producing glands but do not invade the lobular wall. Lobular neoplasia is another name for LCIS. Noninvasive breast cancers include this and ductal carcinoma in situ (DCIS). However, unlike DCIS, it does not appear to progress into an aggressive malignancy if treatment is delayed 2 . Various chemicals have been known as etiological factors in human carcinogenesis. Most of these chemicals are genotoxic in different short-expression assays. Most are metabolically activated to the reactive middle that binds directly to DNA, perhaps leading to genetic damage that results in cancer. Examples of these chemicals are 7,12-dimethyl benz(a)anthrathene 3 . When cancer has spread to other parts of the body (metastatic), various treatments such as chemotherapy, hormonal therapy, or radiation may be used to reduce symptoms, improve quality of life, and extend survival 4 . Thus, tamoxifen, a hormonal treatment, prevents breast cancer by modulating the selective estrogen receptor (SERM) 5 .

Amygdalin was first isolated in 1830 by two French chemists Robiquet and Boutron-Charlard. They discovered amygdalin (which was named “emulsin”) from bitter almonds in 1837 6 . Orally administered amygdalin is thought to be hydrolyzed into prunasin and glucose by human digestive enzymes, and prunasin is further degraded into mandelonitrile in the small intestine. The transformation of mandelonitrile into benzaldehyde and cyanide and the subsequent toxicity are mainly due to gut microflora 7 . Evidence shows that amygdalin can fight free radicals and reduce inflammation 8 . It has anti-inflammatory, antimicrobial, antioxidant, and immunomodulatory properties 9 – 11 . Lea et al. 12 stated in the Journal of the National Cancer Institute (JNCI) that amygdalin inhibits tumor growth. Hydrocyanic acid, which has anti-cancer effects, and benzaldehyde, which has analgesic properties, are the products of amygdalin decomposition. As a result, it can be used to combat cancer and alleviate the pain 13 . Amygdalin’s anti-tumor effect has been a crucial topic in recent years. Amygdalin’s anti-cancer properties are governed by carcinogenic chemicals broken down in the body and kill tumor cells, cutting off cancerous cells’ access to nutrition and halting their growth. It has been processed and used to treat malignancies using conventional medicine in 20 countries, including the US, Italy, Japan, and China 14 . Amygdalin’s benefits have been studied for decades, and the findings have been consistent across various medical illnesses like leprosy, colorectal cancer, asthma, bronchitis, and others 15 , 16 . Its molecular structure includes the analgesic component benzaldehyde 13 . However, more studies are needed to determine how effective its anti-cancer activity is. Hydrocyanic acid emission during enzymatic hydrolysis may be responsible for this capacity 17 . Amygdalin’s toxicity to healthy cells and poor pharmacokinetic qualities have raised doubts about its usefulness as an anti-cancer medication 18 . It is hypothesized that the primary anti-cancer activity is reduced cancer cell proliferation caused by a lack of carcinogenic chemicals. The incidence of many cancers can be reduced by a process known as apoptosis 19 , which involves cutting off cancer cells’ access to nutrients 20 . More efforts have been struggled to realize natural and synthetic anti-tumors with antioxidant efficacy. Therefore, some trials have been conducted, and the results showed a dual synergistic effect between synthetic anti-tumor and natural agent 21 .

Throughout the ages, people have turned to natural medicines to combat illness. Amygdalin, commonly known as bitter apricot, laetrile, and almond, is a cyanogenic molecule in the aromatic cyanogenic glycoside class; its chemical formula is D-mandelonitrile-D-glucoside-6-glucoside. Amygdalin can be found in the seeds of many different plants, although it is most abundant in rosaceous plants like apricots, peaches, cherries, plums, etc. 22 , 23 . Amygdalin is a vital active medicinal ingredient found in almonds and the seeds of some plants of the Rosaceae family 24 , 25 . It’s a naturally occurring biomolecule that can be discovered in the seeds of many different plants 9 . Therefore, this investigation aimed to examine the anti-tumor effects of the amygdalin molecule against mammalian tissue cancer in mice to examine the in vivo anti-tumor effects of the amygdalin molecule against mammalian tissue cancer in mice and explore the dual synergistic effect between synthetic anti-tumor of tamoxifen and amygdalin which not yet proven.

Materials and Methods

Chemicals

12-Dimethylbenz[a]anthracene

The most commonly utilized chemical carcinogen is DMBA with chemical formula C20H16, molecular weight 256.341 g mol -1 , in powder and dissolved in 100% sesame oil, purchased from Sigma-Aldrich Chemical Co., ID. NO. 24891046, provided by the Egyptian International Center for Import Cairo, Egypt); it is used at an oral dose level (50 mg kg -1 once a week) for 4 weeks 26 .

Tamoxifen (Nolvadex-D) ®

A chemical anti-cancer drug manufactured by (AstraZenica group. AstraZenica©2000, UK limited) in the form of a tablet, and each tablet contains (20 mg). It is dissolved in distilled water with the chemical formula C26H29NO and a molecular weight of 371.515 g mol -1 . Tamoxifen was administered orally at a dose (50 mg kg -1 b.wt/day) for 4 weeks 27 .

Amygdalin

D-Amygdalin was purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA); ID.NO. 24891046; in the form of crystalline powder with chemical formula C20H27NO11, molecular weight 457.44 Dalton. Amygdaline was dissolved in 100% corn oil and administered orally at a dose of (o.6 mg kg -1 b. wt/day) 28 .

Experimental animals

Ninety female albino mice, 4 to 6 weeks of age and weighing 18 to 35 g, were used in this study 29 . Mice were purchased from the Animal Research Center, Faculty of Veterinary Medicine, Benha University. Animals were isolated in metal cages with controlled temperatures and diets for the duration of the study. The animals were fed a steady diet and had access to water ad libdium . Mice were allowed to acclimatize at the animal facility for at least one week before the start of the experiment. The Ethical Committee of the School of Veterinary Medicine at Benha University reviewed and approved all experimental procedures and provided ethical approval No. BUFVTM on 18–01-23. All research was also performed following relevant guidelines and regulations.

Experimental design

Female mice were randomly split into five groups, fifteen in each, housed in separate cages and treated as Group I (Normal control): untreated female mice served as controls for all experimental groups. Group II (carcinogenic induced group): female mice administrated oral DMBA at a dose of (50 mg kg -1 b.wt orally once a week) in sesame oil at 5 weeks of age for 4 weeks 26 . Group III: (Tamoxifen treated group) Female carcinogenic mice received tamoxifen orally at a dose (50 mg kg -1 b.wt/day) dissolved in distilled water for 4 weeks 27 . Group IV: (Amygdalin treated group) female mice administrated with amygdalin (0.6 mg kg -1 b.wt/day) orally in 100% corn oil for 4 weeks 28 Group V: (Tamoxifen + Amygdalin treated group) female carcinogenic mice treated orally with tamoxifen (50 mg kg -1 b.wt/day) dissolved in distilled water 27 and amygdalin (0.6 mg kg -1 b.wt/day) in 100% corn oil for 4 weeks 28 . Group (vi): (Amygdalin protection group), female mice administrated with amygdalin (0.6 mg kg -1 bw/day) dissolved in 100% corn oil orally for 4 weeks 28 then administrated with DMBA (50 mg kg -1 b.wt. orally once a week) in sesame oil at 5 weeks age for 4 weeks 26 along with amygdalin as above. During the whole experiment, the ARRIVE guidelines have been followed.

Sampling

Blood Sampling

Blood samples were taken from mice at the end of the experiment and divided into two parts: one was put in a plain tube to obtain the serum after centrifugation at 3000 rpm for 15 min. The clear serum was collected using an automated pipette, placed in a dry sterile samples tube, and stored in the freezer at -20 °C till carrying the biochemical analysis for tumor markers (carcinoembryonic antigen (CEA), cancer antigen 15.3 (CA15.3) and cancer antigen 125 (CA125)); steroid hormones (prolactin (PRL) and estrogen (E2)); hepatic enzymes such as alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP); and renal functions such as urea and creatinine.

Tissue samples (breast tissues):

According to Marquardt et al. 30 , mice were anesthetized using intramuscular injection of ketamine/xylazine hydrochloride mix (80/10 v:v) before being sacrificed when their experimentation time was up, blood samples collected, and then cervically dislocated. The breast tissues were extirpated and cut into 4 parts. 1st part: oxidative stress biomarkers analyses (superoxide dismutase (SOD), and glutathione peroxidase (GPx); 2nd part: gene expression (Caspase-3, Bcl2, TNF-α, and P53); 3rd part: flowcytometric analysis for (CD20, CD44, cell cycle, and apoptosis); and 4th part: the tissue was fixed in 10% neutral buffered formalin till processing histopathological examination. All specimens were kept at—80°C till analysis, except the 4th part.

Assay Methods

Serum biochemical parameters

ALT and AST were carried according to methods described by Young 31 , ALP 32 , urea 33 , and creatinine 34 using JENWAY 6051 Colorimeter U.K device with their specific Spectrum GmbH Company kits (CAT. NO. 264001; 260001; 216001; 318001; 235001, respectively). CEA, CA15.3, CA125, E2, and PRL concentrations were determined using a Chinese instrument, the AutoLumo A1000, and the manufacturer-recommended reagent kits (Autobio Diagnostics Co., LTD), CAT. NO. CL0205-2, CL0210-2, CL0209-2, CL1105-2, and CL1103-2, respectively, as described by Sugarbaker 35 , Geraghty et al. 36 , Haga et al. 37 , Martin and Rotten 38 , and Uotila et al. 39 , respectively.

Tissue oxidative stress biomarkers

Tissues from the mammary gland were collected and washed in phosphate-buffered saline (PBS) containing 0.16 mg ml -1 heparin to eliminate debris such as blood cells and clots. Using a cleaner, a gram of breast tissue was homogenized in 5 mL of cold buffer (i.e., 50 mM potassium phosphate, PH 7.5 1 mM EDTA). Aliquots of tissue homogenates were centrifuged by a cooling centrifuge at 4000rpm for 20 min. The supernatant was removed and stored at -20°C till the oxidative stress biomarkers (SOD and GPx) were determined by Spectro nanodrop with commercial kits Biodiagnostic, Cairo, Egypt; CAT. NO. SD2521 and GP2524, respectively, according to Nishikimi et al. 40 and Paglia and Valentine 41 , using the supernatants from the homogenates centrifuged at 8000 rpm for 20 min at 4 °C.

Gene expressions of caspase-3, BcL-2, P53, and TNF-α

Following the manufacturer’s instructions, total RNA was isolated from the frozen breast tissue using the RNeasy® Mini kit (Qiagen) 42 . Quantitative and qualitative RNA assessments were made using spectrophotometry (SPECTRO star Nano, BMG Labtech Co., Ortenberg, Germany). High-capacity cDNA Reverse Transcription Kits were used to convert 1000 ng of total RNA into single-stranded cDNA following the manufacturer’s instructions (Applied Biosystems). Gene analyses were performed with real-time time-PCR using sense and anti-sense primers (Table 1 ) 43 . PCR reactions for each gene were carried out for each analyzed sample. Each PCR reaction consisted of 1.5 µl of 1µg µl -1 cDNA, 10 µl SYBR Green PCR Master Mix (QuantiTect SYBR Green PCR kit, Qiagen), 1µM of each forward and reverse primer for tested genes while 1µM of forward and 1.5 µM reverse primer for (housekeeping) gene (β-actin) and nuclease-free water to a final volume of 20 µl. Reactions were then analyzed on an applied Biosystem 7500 Fast Real time PCR Detection system under the following conditions: 95°C for 10 min (holding stage) and 40 cycles of 95°C for 15 s (denaturation stage) followed by 60°C for 1 min (annealing and extension stage). Changes in gene expression were calculated from the obtained cycle threshold (Ct) values provided by real-time PCR instrumentation using the comparative CT method to a reference (housekeeping) gene (β-actin) 44 . Table 1 Gene sense and anti-sense primers for real time-PCR. Gene name Primer sequence TNF-α F: AAATGGGCTCCCTCTCATCAGTTC R: TCCGCTTGGTGGTTTGCTACGAC BcL-2 F: TATATGGCCCCAGCATGCGA R: GGGCAGGTTTGTCGACCTCA Caspase-3 F: GTGGAACTGACGATGATATGGC R: CGCAAAGTGACTGGATGAACC P53 F: CTACTAAGGTCGTGAGACGCTGCC R: TCAGCATACAGGTTTCCTTCCACC β-actin F: ACCCCAAAGCCAACAGA R: TCTCAGCTGTGGTGTGAAG

Tissue flowcytometric analysis for CD44, CD20, cell cycle, apoptosis

Before the flowcytometric analysis, fresh tissue specimens were preserved in isotonic saline and consequently prepared. The tissue specimens were washed with isotone Tris EDTA buffer, 3.029 gm of 0.1 M Tris (hydroxymethylaminomethane, 1.022 gm of 0.07 M sodium chloride (ADWIC), and 0.47 gm of 0.005 M EDTA then, dissolved in 250 ml of distilled water and adjusted the pH to 7.5 by using 1 N HCl. Cell suspension was centrifuged at 1800 rpm for 10 min, where the supernatant was aspirated. After centrifugation and aspiration of the supernatant, the cells were fixed in ice-cold 96–100% ethanol in approximately (1 ml for each sample). Flow cytometry was used to examine the expression of CD20 and CD44 in breast tissue using fluorescently labeled mouse anti-human antibodies (BD PharmingenTM, PE mouse anti-human CD20, and PE mouse anti-human CD44, respectively), as well as the cell cycle using Propidium Iodide (Sigma Aldrich, St. Louis, USA) and Annexin V (BD PharmingenTM, FITC Apoptosis Kit, Cat no 556547, BD Biosciences) 45 . The computer program for mathematical analysis was modified to examine cell distribution histograms and estimate cells at different stages of the cell cycle 46 .

Histopathological examination

The mice were slaughtered, their breasts removed, and the tissue was immediately collected in a 10% formalin solution and treated using the paraffin procedure. Paraffin beeswax tissue blocks were prepared for cutting at 4 µm by sliding microtome. After microtome sectioning, the tissue sections were deparaffinized and immediately stained with hematoxylin–eosin (H&E). The stained sections were diagnosed for histopathological alterations in breast architecture, and their photomicrographs were taken according to Banchroft and Gamble 47 . Subsequently, the results of undefined experimental groups were re-diagnosed by two pathologists to confirm the observation of the result.

Statistical analysis

The statistical package for social science (SPSS, 22.0 software) was performed according to Steel et al. 48 , and values of p < 0.05 were considered significant. The results were analyzed statistically using one-way analysis of variance (ANOVA), then Tukey’s multiple test was applied, and data were presented as mean ± SE.

Results

Effect on hepatic enzymes and renal functions

Results revealed that DMBA-induced breast cancer caused a significant increase in hepatic enzymes, in which AST was increased by 57% and ALP by 29% compared to the control group. Still, Amygdalin administration as a treatment improved hepatic enzymes by AST, which improved by 27%, ALT enhanced by 15%, and ALP improved by 5% compared to the DMBA group. They revealed a significant increase in renal functions, wherein urea was increased by 41% and creatinine by 61% compared to the control, while Amygdalin administration as a protection improved renal functions by urea, which decreased by 11% and creatinine decreased by 31% in compared to DMBA group., Table 2 . Table 2 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on hepatic and renal functions in DMBA-induced tumor mice. Groups AST U L -1 ALT U L -1 ALP U L -1 Urea mg dl -1 Creatinine mg dl -1 Control 35.00 ± 0.58 d 19.00 ± 1.15 bc 27.43 ± 0.97 d 39.52 ± 1.26 c 0.93 ± 0.03 d DMBA 55.67 ± 2.03 a 19.00 ± 1.15 bc 35.87 ± 2.17 b 45.71 ± 0.83 a 1.53 ± 0.09 a Tamoxifen Therapy 35.00 ± 0.58 d 17.33 ± 0.88 bc 29.33 ± 1.24 cd 42.80 ± 0.00 b 1.20 ± 0.00 b Amygdalin Treatment 40.00 ± 0.58 c 16.33 ± 0.33 c 33.43 ± 0.72 bc 41.87 ± 0.93 bc 1.10 ± 0.06 bc Tamoxifen + Amygdalin 55.33 ± 2.03 a 20.00 ± 0.58 b 34.90 ± 1.33 b 40.71 ± 0.41 bc 1.07 ± 0.03 bcd Amygdalin Protection 49.67 ± 1.45 b 24.00 ± 0.58 a 43.00 ± 1.91 a 40.47 ± 0.47 bc 1.03 ± 0.03 cd a,b,c,d : means in the same column with different subscripts are statistically different at (P˃0.05).

Effect on steroid hormones

The results revealed that DMBA-induced breast cancer showed a significant increase in steroid hormones, in which PRL was increased by 41% and E2 by 193% compared to the control group, but Amygdalin in co-administration with tamoxifen improved steroid hormones by PRL which decreased by 13% compared to DMBA group, as well as E2 decreased by 15% with Amygdalin as a protective administration in compared to DMBA group, Table 3 . Table 3 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on steroid hormones in DMBA-induced tumor mice. Groups Estrogen (E2) Pg ml -1 Prolactin (PRL) ng ml -1 Control 30.90 ± 1.50 bc 0.87 ± 0.01 b DMBA Carcinogen 88.46 ± 5.14 a 1.23 ± 0.09 a Tamoxifen Therapy 34.07 ± 0.29 bc 0.87 ± 0.01 b Amygdalin Treatment 35.01 ± 0.25 b 0.90 ± 0.01 b Tamoxifen + Amygdalin 40.71 ± 0.41 bc 1.07 ± 0.03 bcd Amygdalin Protection 32.03 ± 0.76 bc 0.89 ± 0.01 b a,b,c,d : means in the same column with different subscripts are statistically different at (P˃0.05).

Effect on tumor markers

The results revealed that DMBA-induced breast cancer showed a significant increase in tumor markers, in which CEA was increased by 201%, CA15.3 by 164%, and CA125 by 109% compared to the control group. On the contrary, Amygdalin in co-administration with tamoxifen declined the tumor markers by CEA, which decreased by 63%, CA15.3 by 60%, and CA125 by 46% compared to the DMBA group, Table 4 . Table 4 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on tumor markers in DMBA-induced tumor mice. Groups CEA ng ml -1 CA15.3 U L -1 CA125 U L -1 Control 0.54 ± 0.03 c 0.70 ± 0.02 b 2.16 ± 0.08 b DMBA 1.63 ± 0.05 a 1.85 ± 0.07 a 4.53 ± 0.18 a Tamoxifen Therapy 0.61 ± 0.04 bc 0.71 ± 0.02 b 2.30 ± 0.06 b Amygdalin Treatment 0.68 ± 0.03 b 0.78 ± 0.04 b 2.48 ± 0.10 b Tamoxifen + Amygdalin 0.59 ± 0.03 bc 0.74 ± 0.05 b 2.28 ± 0.10 b Amygdalin Protection 0.68 ± 0.02 b 0.77 ± 0.03 b 2.48 ± 0.08 b a,b,c : means in the same column with different subscripts are statistically different at (P˃0.05).

Effect on Oxidative Stress

Breast tissueSOD antioxidant was increased by 2.5%, and breast tissue GPx antioxidant was increased in percentage of 123% with the said dose of Amygdalin protection administration when compared with the DMBA group. Still, SOD was downed by given DMBA by 2.9% and GPx by 48% compared to the control group, Table 5 . Table 5 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on oxidative stress in DMBA-induced tumor mice. Groups SOD U g -1 GPx U g -1 Control 1368.96 ± 4.71 a 4675.30 ± 2 42.02 ab DMBA 1327.12 ± 17.97 b 2388.34 ± 653.97 c Tamoxifen Therapy 1374.37 ± 0.22 a 3987.94 ± 112.31 b Amygdalin Treatment 1375.12 ± 1.52 a 4513.18 ± 404.33 ab Tamoxifen + Amygdalin 1368.37 ± 5.41 a 4201.93 ± 303.25 ab Amygdalin Protection 1361.62 ± 1.95 a 5349.68 ± 202.16 a a,b,c : means in the same column with different subscripts are statistically different at (P˃0.05).

Effect on Gene Expressions of TNF-α, BcL-2, Caspase-3, and P53

TNF-α of breast tissue was significantly upregulated by DMBA when compared with the control group (from the value of control 1.05 ± 0.02 to the value 2.73 ± 0.04 of DMBA) and grossly downregulated by Amygdalin administration—asa protective substance (from the value 2.73 ± 0.04 of DMBA to the value 0.03 ± 0.01 of Amygdalin protective substance) along with BcL-2 of breast tissue was significantly upregulated by DMBA when compared with the control group (from the value of control 1.06 ± 0.02 to the value 1.54 ± 0.11 of DMBA) and grossly downregulated by Amygdalin– in coadministration with tamoxifen- with cancer induced by DMBA (from the value 1.54 ± 0.11 of DMBA to the value 0.62 ± 0.19 of Amygdalin with tamoxifen); however, Caspase-3 of breast tissue was significantly upregulated bycoadministration of Amygdalin with tamoxifen (from the value 0.55 ± 0.31 of DMBA to the value 2.42 ± 0.14 of Amygdalin with tamoxifen), as well as P53 of breast tissue wassignificantly upregulated by Amygdalin treatment (from the value 0.04 ± 0.02 of DMBA to the value 1.54 ± 0.14 of Amygdalin treatment) and both of them downed by given DMBA., Table 6 . Table 6 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on gene expressions in DMBA-induced tumor mice. Groups TNF-α BCL-2 Caspase-3 P53 Control 1.05 ± 0.02 b 1.06 ± 0.02 b 1.15 ± 0.03 bc 1.12 ± 0.02 b DMBA 2.73 ± 0.04 a 1.54 ± 0.11 a 0.55 ± 0.31 c 0.04 ± 0.02 c Tamoxifen Therapy 0.06 ± 0.00 d 1.27 ± 0.08 ab 2.40 ± 0.05 a 1.36 ± 0.06 a Amygdalin Treatment 0.70 ± 0.16 c 0.99 ± 0.06 b 1.68 ± 0.31 b 1.54 ± 0.14 a Tamoxifen + Amygdalin 0.18 ± 0.07 d 0.62 ± 0.19 c 2.42 ± 0.14 a 1.11 ± 0.03 b Amygdalin Protection 0.03 ± 0.01 d 1.19 ± 0.07 b 1.10 ± 0.15 bc 1.06 ± 0.06 b a,b,c,d : means in the same column with different subscripts are statistically different at (P˃0.05).

Effect on CD20, CD44, cell cycle, and annexin V by flowcytometry

The results of CD20 and CD44 contents revealed significant increases in the breast tissue of DMBA mice when compared with the regular control group, while Amygdalin administrations—as a treatment, a protective substance, or co-administrated with tamoxifen therapy—exposed significant decrease when compared with DMBA carcinogenic group, as shown in Table 7 and Figs. 1 and 2 . Table 7 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on CD20 and CD44 in DMBA-induced tumor mice. Groups CD20 CD44 Control 11.60 ± 1.34 e 14.07 ± 1.46 c DMBA 87.53 ± 1.16 a 83.17 ± 5.39 a Tamoxifen Therapy 27.10 ± 3.41 bc 27.10 ± 1.69 b Amygdalin Treatment 22.10 ± 2.99 cd 22.70 ± 1.20 b Tamoxifen + Amygdalin 18.23 ± 1.24 de 14.60 ± 0.35 c Amygdalin Protection 29.90 ± 2.65 b 29.83 ± 0.79 b Data are presented as mean ± SE. SE Standard Error. a,b,c,d,e means in the same column with different subscripts are statistically different at (P˃0.05). Fig. 1 Flow cytometry charts of studied groups’ mammary (CD20) activities. Fig. 2 The flow cytometric histogram shows CD44 staining for different groups.

Furthermore, significant deregulation of cell distribution was observed in sub G1 phase (DNA fragmentation), G0/1 (cell viable), S (synthesis of DNA), and G2/M (arrest in the cell cycle) phases in cancer tissue of carcinogenic mice compared to those of the control mice. Pre-treatment with amygdalin ameliorated the deregulation of the cell population significantly; however, a pronounced increase in cell population was detected in the G1 phase and G0/1 phase. Otherwise, a significant decrease in cell population was seen in the S phase and G2/M phase compared to DMBA mice. Regarding the effect of treatments, amygdalin as a single treatment resulted in a cell population in the sub-G1 phase. Meanwhile, significant change was recorded in other phases compared to the control group.

Furthermore, Amygdalin co-administration with tamoxifen therapy caused remarkable improvement in cell population distribution in the different cell cycle phases and recorded significant differences concerning DMBA mice. On the other hand, more remarkable cell arrest has occurred at the sub-G1 phase, S phase, and G2/M phase. However, an insignificant change in cell population was observed in the G1 phase compared to amygdalin as sole treatment, as shown in Table 8 and Fig. 3 . Table 8 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on cell cycle in DMBA-induced tumor mice. Groups Sub-G1 G0/1 S phase G2 M Control 10.33 ± 0.67 d 79.47 ± 2.13 a 6.03 ± 1.93 b 3.50 ± 0.78 b DMBA 5.47 ± 0.38 e 66.33 ± 2.64 ab 20.47 ± 2.35 a 10.43 ± 1.88 a Tamoxifen Therapy 31.60 ± 3.10 b 64.77 ± 2.62 b 1.50 ± 0.70 bc 0.07 ± 0.07 c Amygdalin Treatment 32.00 ± 1.28 b 64.20 ± 7.85 b 1.87 ± 0.12 bc 0.37 ± 0.22 c Tamoxifen + Amygdalin 60.40 ± 1.40 a 30.53 ± 0.33 c 0.43 ± 0.03 c 0.00 ± 0.00 c Amygdalin Protection 21.97 ± 0.94 c 71.87 ± 5.63 ab 3.37 ± 2.42 bc 0.87 ± 0.77 bc Data are presented as mean ± SE. SE: Standard Error. a,b,c,d,e : means in the same column with different subscripts are statistically different at (P˃0.05). Fig. 3 Flow cytometric analysis of cell cycle phases for different groups.

Moreover, the results of Annexin V (LL) showed a significant increase in the breast tissue of DMBA mice compared with control mice and a significant decrease with Amygdalin administrations—as a treatment, a protective substance, or co-administrated with tamoxifen therapy—when compared with DMBA mice. Annexin V (UL, LR, and UR) results showed a significant decrease in the breast tissue of DMBA mice but a significant increase with Amygdalin administrations. On the other hand, tamoxifen therapy resulted in a considerable reduction in Annexin V (LL) and a substantial increase in Annexin V (UL, LR, and UR), as shown in Table 9 and Fig. 4 . Table 9 Effect of Amygdalin administrations compared with tamoxifen therapy and DMBA carcinogen on Annexin V in DMBA-induced tumor mice. Group UL UR LL LR Control 0.20±0.00 b 1.47±0.63 d 95.47±1.23 a 2.93±0.56 c DMBA 0.10±0.00 b 5.33±0.09 d 79.47±1.08 b 15.80±0.44 b Tamoxifen Therapy 3.03±1.22 a 36.83±1.11 c 54.33±2.19 c 5.80±2.30 c Amygdalin Treatment 1.00±0.06 b 60.40±2.48 b 33.87±2.37 d 4.70±0.35 c Tamoxifen+ Amygdalin 0.43±0.07 b 72.60±2.48 a 12.83±1.76 e 14.17±0.78 b Amygdalin Protection 0.30±0.06 b 37.97±2.66 c 32.53±4.15 d 29.20±1.66 a Data are presented as mean ± SE. SE: Standard Error. a,b,c,d,e : means in the same column with different subscripts are statistically different at (P˃0.05). Fig. 4 The flow cytometric analysis of the annexin-v kit for different groups is shown as a quadrant analysis.

Histopathological findings

The histopathological analysis in Fig. 5 shows that the negative control group has a glandular duct lined with epithelial lining (arrowhead – Fig. 5 . A) within a fat stroma (arrow indicates fat cell—Fig. 5 . A). Photomicrographs of the cross-section of the carcinogenic mammary gland are shown in Fig. 5 . B has proven the success of the current method, materials, and duration used in this in vivo experiment to induce mammary tumors in mice. DMBA group had proliferated microductular carcinoma (arrowheads – Fig. 5 . B) associated with myxomatous changes within the connective tissues matrix, prominent angiogenesis, and marked mononuclear inflammatory cell infiltration (arrowhead indicates plasma cells). However, the mammary gland of DMBA mice treated with amygdalin showed marked decreases in the proliferated ducts (arrowheads – Fig. 5 . C) with a significant increase of extracellular matrix around the duct (arrow – Fig. 5 . C). Furthermore, the mammary gland of the protected group showed hyperplastic glandular acini with marked tubular basophilia (arrowheads – Fig. 5 .D). Fig. 5 Mammary gland cross-sections photographed under a microscope for the different groups are shown in slide A as the control group, B slide as the DMBA carcinogenic group, C slide as the amygdalin treatment group, D slide as amygdalin protective group, E slide as the tamoxifen therapy group, F group as amygdalin combined with tamoxifen therapy. X&E, X200, bar = 50 µm.

On the other hand, the mammary gland of DMBA treated with tamoxifen showed marked degenerated and apoptotic changes within the glandular acinar epithelium (arrowheads – Fig. 5 . E) and moderate periglandular inflammatory cells infiltration (arrow – Fig. 5 . E). Thus, the mammary gland of DMBA mice with a combination of both tamoxifen and amygdalin showed a marked decrease in the increased ducts (arrowheads – Fig. 5 . F), an increase in periglandular myoepithelial cells, and a substantial reduction in the inflammatory cells infiltration (arrow indicates few plasma cells – Fig. 5 . F).

Discussion

The research results proved that amygdalin possesses a Protective and Chemotherapeutical Role in Induced Mammary Cancer in Experimental Mice and Upregulation of Related Genes, wherein it has excellent efficacy as used alone as a treatment or a protective drug or in co-administration with tamoxifen therapy in DMBA-treated mice in liver enzymes, tamoxifen therapy reached the hepatic values to be within the control range, more preferable to Amygdalin treatment than Amygdalin co-administration with tamoxifen therapy over Amygdalin protection, respectively. As the serum activity of the liver cytoplasmic enzyme increases in carcinogenic mice, ALT indicates necrotic lesions in the hepatic cells 49 . Thus, Amygdalin administrations have hepatic ameliorative potential against DMBA carcinogen, with increases in albumin and decrease in liver enzyme activity (alanine transaminase (ALT), aspartate transaminase (AST), as well as alkaline phosphatase (ALP)) compared to carcinogenic mice 50 . Amygdalin significantly decreased serum hepatic function, while DMBA-carcinogenic group serum AST, ALT, and ALP increased. This protects the liver by maintaining plasma membrane integrity and inhibiting enzyme leakage. Because of this, the extract’s ability to restore the activities of marker enzymes following delivery may be explained 51 .

Regarding kidney functions, the results showed that Amygdalin protection proved more potential than Amygdalin co-administration with tamoxifen therapy and Amygdalin treatment than tamoxifen therapy, respectively. Reductions in renal function concentrations demonstrated that amygdalin has a renal ameliorative effect against renal damage in female mice. Our findings corroborated those of Guo et al. 52 , who found that amygdalin prevents the rise in blood urea and serum creatinine in cases with chronic renal disease. On the other hand, increased renal function levels in the blood are another side effect of DMBA cancer due to Extracellular matrix (ECM) buildup and fibroblast proliferation in the kidney 18 , 53 . Moreover, the inhibition of kidney cell cancer development by amygdalin was reported by Juengel et al. 54 , and this effect was reversed after treatment with amygdalin.

DMBA-induced breast cancer had higher estrogen and prolactin levels than controls. According to statistical research, amygdalin protection decreased estrogen steroid hormone (E2) more than co-administration with tamoxifen therapy or treatment alone. Prolactin (PRL) steroid hormone decreased more with amygdalin co-administration with tamoxifen therapy than with tamoxifen alone, Amygdalin protection, or Amygdalin treatment in DMBA mice. Amygdalin oral administration significantly reduced endocrine estrogen and anterior pituitary prolactin levels in DMBA group mice 55 . This means that the hypothalamic-pituitary-ovarian axis, its hormones, growth factors, receptors, and oxidative balance are all involved in carcinogenesis and female reproduction processes via regulating mammary cell survival and secretion by Amygdalin 56 . Tamoxifen therapy has mixed estrogenic and antiestrogenic effects. Therefore, considerable improvements in E2 and PRL hormones were noted 5 .

Other aspects revealed a significant decrease in tumor markers of carcinoembryonic antigen (CEA), cancer antigen 15.3 (CA15.3), and cancer antigen 125 (CA125) with Amygdalin administrations, whether in treatment or protection group inconsistent with Jaswal et al. 57 . In antibody-directed enzyme prodrug treatment, tumor-specific antibodies were conjugated to enzymes and then given systemically to combat tumor antigens (ADEPT). The enzyme then helped the prodrug become an effective cytotoxic agent that could be used directly on the tumor. The duration between dosages was optimized to reduce systemic toxicity by clearing the tumor’s blood and normal tissues of the conjugates. As the functional medicine travels to the malignancy, it will cause the bystander effect and kill the antigen-negative cells 58 . The tumor has been treated using amygdalin, a prodrug that may be broken into free cyanide by the sweet enzyme almond α-glucosidase. If activated locally at the tumor site, this chemical could eliminate malignant tumor cells without causing systemic damage. Some believed this drug might kill cancer cells by attaching to the antibody. In conjunction with the ADEPT system, amygdalin and beta-glucosidase were considered promising targeted cancer therapy 59 .

From current results of tumor markers, tamoxifen proved to be more highly effective than amygdalin, but amygdalin in co-administration with tamoxifen therapy showed excellent efficacy on breast tumor markers. According to estrogen antagonism of tamoxifen therapy, the mammary tumor marker CA15.3 and general tumor marker CEA significantly decreased in carcinogenic mice, but CA125 significantly decreased in carcinogenic mice due to its potentiality on inhibition of progesterone receptors in the endometrium 60 , 61 .

The effect of Amygdalin protection on malignant breast tissue GPx was much greater than that of treatment, co-administration with tamoxifen, or tamoxifen alone. The current study showed that amygdalin effectively controlled the antioxidant defense system throughout the experiment by regulating superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities, which are indicative of amygdalin’s antioxidant properties and free radical scavenging capacity. Similarly, Karabulut et al. 62 demonstrated that Amygdalin supplementation offered robust protection against the oxidative stress generated by DMBA by lowering oxidative stress and raising both SOD and GPx values. In a mouse model of 7,12-dimethylbenz[a]anthracene (DMBA)-induced carcinogenesis, the Amygdalin-containing fraction showed anti-cancer efficacy in vivo by boosting the antioxidant response as evaluated by SOD and GPx activities. Amygdalin was found to play a role in the functioning of the Amygdalin-containing fraction. The latter could be metabolized into HCN in malignant tissue, leading to cell death via oxidative stress 63 .

Furthermore, compared to the DMBA carcinogenic group, after 4 weeks, the therapeutic dose of tamoxifen increased the activity of SOD and GPx values. The findings of Lim et al. 64 , who found that tamoxifen inhibits hydrogen peroxide production, corroborated these findings. Tamoxifen’s antioxidative potential can be explained as follows. Tamoxifen is metabolized into 4-hydroxy tamoxifen and N-desmethyl tamoxifen by the liver’s cytochrome P450, a dependent oxidase, during tamoxifen mediation. This antioxidant property of breaking chains and the possible impacts on membrane structure result from the phenolic hydroxyl group 65 .

Tumor necrosis factor-alpha (TNF-α), a potent paracrine and endocrine modulator of inflammatory and immunological processes, played a significant role in evaluating the anti-cancer effect of amygdalin in this study through gene expression. B lymphoma cell 2 (BcL-2) which is an anti-apoptotic marker; caspase-3, which is an apoptotic marker; and 53 K. Dalton Protein (P53), which acts as a tumor suppressor and regulates cell division by keeping cells from growing and dividing (proliferating) too fast or in an uncontrolled way 66 .

Compared to the DMBA group, Amygdalin protection dramatically reduced malignant breast tissue TNF-α more than tamoxifen therapy, co-administration, or treatment alone. The effect of Amygdalin co-administration with tamoxifen therapy on malignant breast tissue BcL-2 was significantly more down-regulating than treatment, protection, or DMBA. Additionally, Amygdalin co-administration with tamoxifen therapy upregulated malignant breast tissue caspase-3 more than tamoxifen therapy, Amygdalin treatment, or Amygdalin protection compared to the DMBA group. The apoptosis cycle was promoted by two pathways: (1) the death receptor-mediated extrinsic apoptosis pathway and (2) the intrinsic mitochondrial pathway. Apoptosis family proteins, such as Bcl-2, work by neutralizing pro-apoptotic proteins like Bax, which protects the tumor cells from apoptosis by occurring in the cytosol and then translocating to the mitochondria to induce apoptosis 67 , 68 . The mitochondrial system, which encompasses both pro- and anti-apoptotic proteins, is regulated by Bcl-2 67 .

Compared to the DMBA group, Amygdalin treatment upregulated malignant breast tissue P53 more than tamoxifen therapy, co-administration with tamoxifen therapy, or prevention. Both TNF-α and BcL-2 gene expressions were significantly increased by DMBA action, but both caspase-3 and P53 gene expressions were significantly decreased. The mechanisms of transcriptional inhibition that reflect the ability of androgen receptors to bind DNA included two models. Type 1 antagonists bind the receptor but hinder receptor DNA binding, whereas type 2 antagonists induce DNA binding but fail to initiate gene transcription 69 .

In contrast to B cell acute lymphoblastic leukemia, which is positive in roughly half of the cases, and neoplastic plasma cells of multiple myeloma, which are CD20-negative, our flow cytometric research demonstrates that over 90% of cases with non-lymphomas Hodgkin’s are CD20-positive 70 ; and CD44 which is an early indicator for induction of breast cancer and act as an immune suppression in late breast carcinoma 71 .

According to CD20 and CD44 data, Amygdalin co-administration with tamoxifen therapy affects malignant breast tissue. Compared to the DMBA group, Amygdalin treatment, tamoxifen therapy, and Amygdalin protection downregulated CD20 and CD44 considerably. In agreement with the reports mentioned above, the current study demonstrated over-expression of CD20 and CD44 protein in DMBA-induced mice compared to control mice 72 . In breast cancer cases, the epithelial-mesenchymal transition state is linked to a cancer stem cell-like population harboring the CD44 + /CD24- profile and has been proposed to play a critical role in metastatic progression 73 . As mentioned in our discussion and correlation with other literature, up-regulation of CD20 and CD44 has been a marker for breast cancer 74 .

Carcinogenesis is linked to cell cycle checkpoint gene loss and apoptosis suppression. Cell cycle checkpoint genes regulate DNA replication and chromosomal segregation to ensure cell cycle progression. Normal cells’ checkpoint genes temporarily block the cell cycle by increasing gene transcription after DNA damage. This aids DNA repair to prevent mitosis-transmitted DNA lesions. Incomplete DNA repair stops the cell cycle and activates apoptosis. DNA instability caused by checkpoint gene loss can turn normal cells into cancer cells 75 . Thus, cell cycle analysis is necessary to investigate tumor cell proliferation and inhibition.

The effect of Amygdalin co-administration with tamoxifen therapy on malignant breast tissue in the sub-G1 phase was substantially more significant than that of Amygdalin treatment, tamoxifen therapy, or protection compared to the DMBA group. Compared to the DMBA group, tamoxifen therapy had a considerably more significant effect on malignant breast tissue in the G0/1 phase than Amygdalin treatment, protection, or co-administration. Instead, compared to the DMBA group, Amygdalin protection on malignant breast tissue in the S. phase and G2/M was substantially greater than Amygdalin treatment, tamoxifen medication, or Amygdalin co-administration with tamoxifen therapy. This study found typical cell cycle phases in control mice’s mammary tissues. Mammary tumor induction caused uncontrolled cell invasion at various periods. Our findings support previous findings that cell cycle disruption contributes to tumor growth 76 . Furthermore, we find the disturbances in cell cycle machinery, i.e., the proportional increase in sub-G1 or G0/1 phases and decrease in synthesis (S) and Gap2/Mitotic (G2/M) phases at acute and protracted treatments 77 . Thus, plant-derived compounds have been reported to induce cell cycle arrest and cell death in many tumor cell lines 78 . The prophylactic and therapeutic effects of Amygdalin shift of cell distribution into the G0/1 phase. Meanwhile, the proportion of cells in the S and G2/M phases was significantly decreased compared to the tumor-bearing untreated group (DMBA group).

According to an apoptotic marker (Annexin V), tamoxifen therapy increased malignant breast tissue in the UL region more than the Amygdalin treatment, co-administration, or protection compared to the DMBA group. Tamoxifen therapy increased the effect of malignant breast tissue in the LL region more than Amygdalin treatment, protection, or administration with tamoxifen therapy compared to the DMBA group. Compared to the DMBA group, Amygdalin co-administration with tamoxifen medication increased malignant breast tissue in the UR region more than Amygdalin treatment, protection, or isolation. Compared to the DMBA group, Amygdalin protection on malignant breast tissue in the LR region was substantially greater than amygdalin treatment, tamoxifen therapy, or Amygdalin co-administration with tamoxifen. In this respect, such a strategy perhaps partially agrees with the cytotoxic mechanisms of action of the tested compound 79 . Early apoptosis implies positive for annexin and negative of propidium iodide, while late apoptosis and necrosis are positive for both annexin and propidium iodide.

In histopathology, our study showed that histopathological findings agreed with our molecular and biochemical results, showing the modulatory effect of different treatments on mammary gland cancer cells. Histopathological findings of DMBA-induced mice showed neoplastic activity detected in the acini and ductal epithelium, leading to cystic adenoma. Still, the mammary gland of DMBA mice treated with amygdalin registered a massive recurrence of normal histological structure appearance of a few acini tissue sections. In the amygdalin-protected group, the high-grade mammary intraepithelial neoplasia histological pattern was replaced by typical mammalian acini in the mammary gland. These outcomes might occur from the decomposition of amygdalin into benzaldehyde, glucose, and hydrocyanic acid 17 .

On the other hand, the mammary gland of DMBA treated with tamoxifen depleted the periglandular inflammatory cells infiltration. In contrast, the mammary gland of DMBA mice with a combination of both tamoxifen and amygdalin showed a marked decrease in the proliferated ducts, an increase of periglandular myoepithelial cells, and a marked reduction of inflammatory cells infiltration. These findings were related to the role of tamoxifen as a partial agonist of the estrogen receptors 5 , rather than amygdalin decomposition.

Conclusions

Breast cancer in female mice induced by the DMBA carcinogen may be treated with amygdalin, delivered either separately (as a prophylactic or therapeutic drug) or in combination with tamoxifen therapy. The biochemical markers of liver function (AST, ALT, and ALP) and renal function (urea, creatinine), raised due to DMBA exposure, returned to baseline levels after amygdalin treatment. Amygdalin improves breast cancer by reducing the levels of steroid hormones (E2 and PRL) and blood tumor markers (CEA, CA15.3, and CA125). Amygdalin demonstrated considerable antioxidant activity by enhancing the activities of SOD and GPx in breast cancer tissue. Conversely, the gene expressions of caspase-3 and P53 were elevated, whereas TNF-α and BcL-2 were downregulated in breast tissue. Flow cytometric research indicated that amygdalin was associated with CD20 and CD44, facilitating the cell cycle and death in carcinogenic mice. Histopathological tests supported all the aforementioned data, revealing that the DMBA group exhibited proliferative microductular carcinoma accompanied by significant mononuclear inflammatory cell infiltration, which diminished following the amygdalin administration. Amygdalin, a new anti-cancer drug, significantly protected breast tissue from experimentally induced apoptosis in female mice with mammary carcinogen-induced tumors. It is advisable to integrate various modalities of pharmaceutical combinations to effectively administer amygdalin along the multiple pathways implicated in the development and progression of breast cancer.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Acknowledgements

The Researchers would like to thank the Deanship of Graduate Studies and Scientific Research at Qassim University for finan-cial support (QU-APC-2025).

Author contributions

Conceptualization, A.D.A., E.I.S.; methodology, T.A., I.M.A. and H.A.; investigation, I.M.A., S.O.A. and K.S.R.; data curation, A.D.A., E.I.S., and H.B; Formal analysis, T.A., I.M.A., H.A, S.O.A. and K.S.R.; writing—original draft preparation, T.A., I.M.A., E.I.S. and T.E. ; review, and editing, I.M.A. A.D.A., T.E. and H.B.

Funding

The Researchers would like to thank the Deanship of Graduate Studies and Scientific Research at Qassim University for financial support (QU-APC-2025).

Data availability

Data is provided within the manuscript.

Declarations

Competing interests

The authors declare no competing interests.

Institutional review board statement

The study was approved by the Committee of Research Ethics, School of Veterinary Medicine at Benha University (BUFVTM 18–01-23).

References

1. Henry NL Bedard PL DeMichele A Standard and Genomic Tools for Decision Support in Breast Cancer Treatment Am. Soc. Clin. Oncol. Educ. 2017 10.1200/EDBK_175617 28561710 Henry, N. L., Bedard, P. L. & DeMichele, A. Standard and Genomic Tools for Decision Support in Breast Cancer Treatment. Am. Soc. Clin. Oncol. Educ. 10.1200/EDBK_175617 (2017). 10.1200/EDBK_175617 28561710

2. DeSantis, C., Siegel, R. & Jemal, A. Breast cancer facts & figures 2015–2016. Am. Cancer Soc. 44 (2015).

3. Hartwig A Mode of action-based risk assessment of genotoxic carcinogens Archives Toxicol. 2020 94 1787 1877 10.1007/s00204-020-02733-2 PMC7303094 32542409 Hartwig, A. et al. Mode of action-based risk assessment of genotoxic carcinogens. Archives Toxicol. 94 , 1787–1877. 10.1007/s00204-020-02733-2 (2020). 10.1007/s00204-020-02733-2 PMC7303094 32542409

4. Carmichael AR Mokbel K Evolving Trends in Breast Surgery: Oncoplastic to Onco-Aesthetic Surgery Arch. Plast. Surg. 2016 43 222 223 10.5999/aps.2016.43.2.222 27018587 PMC4807182 Carmichael, A. R. & Mokbel, K. Evolving Trends in Breast Surgery: Oncoplastic to Onco-Aesthetic Surgery. Arch. Plast. Surg. 43 , 222–223. 10.5999/aps.2016.43.2.222 (2016). 27018587 10.5999/aps.2016.43.2.222 PMC4807182

5. Wang D-Y Fulthorpe R Liss SN Edwards EA Identification of estrogen-responsive genes by complementary deoxyribonucleic acid microarray and characterization of a novel early estrogen-induced gene: EEIG1 Mol. Endocrinol. 2004 18 402 411 10.1210/me.2003-0202 14605097 Wang, D.-Y., Fulthorpe, R., Liss, S. N. & Edwards, E. A. Identification of estrogen-responsive genes by complementary deoxyribonucleic acid microarray and characterization of a novel early estrogen-induced gene: EEIG1. Mol. Endocrinol. 18 , 402–411. 10.1210/me.2003-0202 (2004). 14605097 10.1210/me.2003-0202

6. Dorr RT Paxinos J The current status of laetrile Ann. Intern. Med. 1978 89 389 397 10.7326/0003-4819-89-3-389 356691 Dorr, R. T. & Paxinos, J. The current status of laetrile. Ann. Intern. Med. 89 , 389–397 (1978). 356691 10.7326/0003-4819-89-3-389

7. Shim S-M Kwon H Metabolites of amygdalin under simulated human digestive fluids Int. J. Food Sci. Nutr. 2010 61 770 779 10.3109/09637481003796314 20528582 Shim, S.-M. & Kwon, H. Metabolites of amygdalin under simulated human digestive fluids. Int. J. Food Sci. Nutr. 61 , 770–779. 10.3109/09637481003796314 (2010). 20528582 10.3109/09637481003796314

8. Orlikova, B., Legrand, N., Panning, J., Dicato, M. & Diederich, M. in Advances in Nutrition and Cancer. (eds Vincenzo Zappia et al. ) 123–143 (Springer Berlin Heidelberg).

9. Orlikova, B., Legrand, N., Panning, J., Dicato, M. & Diederich, M. in Adv. Nutr. Cancer 123–143 (Springer, 2014). 10.1007/978-3-642-38007-5_8 24114478

10. Barakat, H. in 1st International Electronic Conference on Nutrients - Nutritional and Microbiota Effects on Chronic Disease session Potential nutraceutical effects of nutrients, phytochemicals, and microbiota in chronic metabolic disorders (MDPI, 2020).

11. Barakat H Amygdalin: a review on its characteristics, antioxidant potential, gastrointestinal microbiota intervention, anticancer therapeutic and mechanisms, toxicity, and encapsulation Biomolecules 2022 12 1514 10.3390/biom12101514 36291723 PMC9599719 Barakat, H. et al. Amygdalin: a review on its characteristics, antioxidant potential, gastrointestinal microbiota intervention, anticancer therapeutic and mechanisms, toxicity, and encapsulation. Biomolecules 12 , 1514 (2022). 36291723 10.3390/biom12101514 PMC9599719

12. Lea MA Koch MR Effects of cyanate, thiocyanate, and amygdalin on metabolite uptake in normal and neoplastic tissues of the Rat2 JNCI J. Nat. Cancer Inst. 1979 63 1279 1283 10.1093/jnci/63.5.1279 291753 Lea, M. A. & Koch, M. R. Effects of cyanate, thiocyanate, and amygdalin on metabolite uptake in normal and neoplastic tissues of the Rat2. JNCI J. Nat. Cancer Inst. 63 , 1279–1283. 10.1093/jnci/63.5.1279 (1979). 291753

13. Chang H-K Amygdalin induces apoptosis through regulation of Bax and Bcl-2 expressions in human DU145 and LNCaP prostate cancer cells Biol. Pharm. Bull. 2006 29 1597 1602 10.1248/bpb.29.1597 16880611 Chang, H.-K. et al. Amygdalin induces apoptosis through regulation of Bax and Bcl-2 expressions in human DU145 and LNCaP prostate cancer cells. Biol. Pharm. Bull. 29 , 1597–1602 (2006). 16880611 10.1248/bpb.29.1597

14. Do J-S Hwang J-K Seo H-J Woo W-H Nam S-Y Antiasthmatic Activity and Selective Inhibition of Type 2 Helper T cell Response by Aqueous Extract of Semen Armeniacae Amarum Immunopharmacol. Immunotoxicol. 2006 28 213 225 10.1080/08923970600815253 16873091 Do, J.-S., Hwang, J.-K., Seo, H.-J., Woo, W.-H. & Nam, S.-Y. Antiasthmatic Activity and Selective Inhibition of Type 2 Helper T cell Response by Aqueous Extract of Semen Armeniacae Amarum. Immunopharmacol. Immunotoxicol. 28 , 213–225. 10.1080/08923970600815253 (2006). 16873091 10.1080/08923970600815253

15. Li X-B Determination and pharmacokinetics of amygdalin in rats by LC–MS-MS J. Chromatogr. Sci. 2014 52 476 481 10.1093/chromsci/bmt063 23735239 Li, X.-B. et al. Determination and pharmacokinetics of amygdalin in rats by LC–MS-MS. J. Chromatogr. Sci. 52 , 476–481 (2014). 23735239 10.1093/chromsci/bmt063

16. Song Z Xu X Advanced research on anti-tumor effects of amygdalin Therapeutics is J. Cancer Res. 2014 10 3 10.4103/0973-1482.139743 25207888 Song, Z. & Xu, X. Advanced research on anti-tumor effects of amygdalin. Therapeutics is J. Cancer Res. 10 , 3 (2014). 10.4103/0973-1482.139743 25207888

17. Zhou C Enhancement of amygdalin activated with β-D-glucosidase on HepG2 cells proliferation and apoptosis Carbohydr. Polym. 2012 90 516 523 10.1016/j.carbpol.2012.05.073 24751072 Zhou, C. et al. Enhancement of amygdalin activated with β-D-glucosidase on HepG2 cells proliferation and apoptosis. Carbohydr. Polym. 90 , 516–523 (2012). 24751072 10.1016/j.carbpol.2012.05.073

18. Scherf, K. A. in Handbook of Plant-Based Food and Drinks Design 371–390 (Elsevier, 2024).

19. Park H-J Amygdalin inhibits genes related to cell cycle in SNU-C4 human colon cancer cells World J. Gastroenterol. 2005 11 5156 16127745 10.3748/wjg.v11.i33.5156 PMC4320388 Park, H.-J. et al. Amygdalin inhibits genes related to cell cycle in SNU-C4 human colon cancer cells. World J. Gastroenterol. 11 , 5156 (2005). 16127745 10.3748/wjg.v11.i33.5156 PMC4320388

20. Chen Y Amygdalin induces apoptosis in human cervical cancer cell line HeLa cells Immunopharmacol. Immunotoxicol. 2013 35 43 51 10.3109/08923973.2012.738688 23137229 Chen, Y. et al. Amygdalin induces apoptosis in human cervical cancer cell line HeLa cells. Immunopharmacol. Immunotoxicol. 35 , 43–51 (2013). 23137229 10.3109/08923973.2012.738688

21. Badawy AA Othman RQA El-Magd MA Effect of combined therapy with camel milk-derived exosomes, tamoxifen, and hesperidin on breast cancer Mol. Cell Toxicol. 2021 10.1007/s13273-021-00163-4 Badawy, A. A., Othman, R. Q. A. & El-Magd, M. A. Effect of combined therapy with camel milk-derived exosomes, tamoxifen, and hesperidin on breast cancer. Mol. Cell Toxicol. 10.1007/s13273-021-00163-4 (2021).

22. Santos Pimenta LP Schilthuizen M Verpoorte R Choi YH Quantitative analysis of amygdalin and prunasin in prunus serotina Ehrh using 1H-NMR spectroscopy Phytochem. Anal. 2014 25 122 126 10.1002/pca.2476 24115144 Santos Pimenta, L. P., Schilthuizen, M., Verpoorte, R. & Choi, Y. H. Quantitative analysis of amygdalin and prunasin in prunus serotina Ehrh using 1H-NMR spectroscopy. Phytochem. Anal. 25 , 122–126. 10.1002/pca.2476 (2014). 24115144 10.1002/pca.2476

23. Semwal PC Semwal A Bhatt S Parashar T Jakhmola V Apricot-a new source of chemically active constituents: a medicinal overview Biomed. pharmacol. J. 2023 16 1133 1142 10.13005/bpj/2693 Semwal, P. C., Semwal, A., Bhatt, S., Parashar, T. & Jakhmola, V. Apricot-a new source of chemically active constituents: a medicinal overview. Biomed. pharmacol. J. 16 , 1133–1142 (2023).

24. Jaswal V Palanivelu J Ramalingam C Effects of the gut microbiota on amygdalin and its use as an anti-cancer therapy: Substantial review on the key components involved in altering dose efficacy and toxicity Biochem. Biophys. Rep. 2018 14 125 132 29872744 10.1016/j.bbrep.2018.04.008 PMC5986699 Jaswal, V., Palanivelu, J. & Ramalingam, C. Effects of the gut microbiota on amygdalin and its use as an anti-cancer therapy: Substantial review on the key components involved in altering dose efficacy and toxicity. Biochem. Biophys. Rep. 14 , 125–132 (2018). 29872744 10.1016/j.bbrep.2018.04.008 PMC5986699

25. Toomey VM Nickum EA Flurer CL Cyanide and amygdalin as indicators of the presence of bitter almonds in imported raw almonds J. Forensic Sci. 2012 57 1313 1317 10.1111/j.1556-4029.2012.02138.x 22564183 Toomey, V. M., Nickum, E. A. & Flurer, C. L. Cyanide and amygdalin as indicators of the presence of bitter almonds in imported raw almonds. J. Forensic Sci. 57 , 1313–1317 (2012). 22564183 10.1111/j.1556-4029.2012.02138.x

26. Minari J Chemopreventive effect of Annona muricata on DMBA-induced cell proliferation in the breast tissues of female albino mice Egypt. J. Med. Hum. Genet. 2014 15 327 334 10.1016/j.ejmhg.2014.05.001 Minari, J. Chemopreventive effect of Annona muricata on DMBA-induced cell proliferation in the breast tissues of female albino mice. Egypt. J. Med. Hum. Genet. 15 , 327–334 (2014).

27. Fendl KC Zimniski SJ Role of Tamoxifen in the Induction of Hormone-independent Rat Mammary Tumors1 Cancer Res. 1992 52 235 237 1727383 Fendl, K. C. & Zimniski, S. J. Role of Tamoxifen in the Induction of Hormone-independent Rat Mammary Tumors1. Cancer Res. 52 , 235–237 (1992). 1727383

28. Bromley J Hughes BGM Leong DCS Buckley NA Life-threatening interaction between complementary medicines: Cyanide toxicity following ingestion of amygdalin and vitamin C Ann. Pharmacother. 2005 39 1566 1569 10.1345/aph.1E634 16014371 Bromley, J., Hughes, B. G. M., Leong, D. C. S. & Buckley, N. A. Life-threatening interaction between complementary medicines: Cyanide toxicity following ingestion of amygdalin and vitamin C. Ann. Pharmacother. 39 , 1566–1569. 10.1345/aph.1E634 (2005). 16014371 10.1345/aph.1E634

29. Karimi B Ashrafi M Shomali T Yektaseresht A Therapeutic effect of simvastatin on DMBA-induced breast cancer in mice Fundam. Clin. Pharmacol. 2019 33 84 93 10.1111/fcp.12397 29962034 Karimi, B., Ashrafi, M., Shomali, T. & Yektaseresht, A. Therapeutic effect of simvastatin on DMBA-induced breast cancer in mice. Fundam. Clin. Pharmacol. 33 , 84–93. 10.1111/fcp.12397 (2019). 29962034 10.1111/fcp.12397

30. Marquardt N Euthanasia of laboratory mice: Are isoflurane and sevoflurane real alternatives to carbon dioxide? PloS one 2018 13 e0203793 10.1371/journal.pone.0203793 30199551 PMC6130864 Marquardt, N. et al. Euthanasia of laboratory mice: Are isoflurane and sevoflurane real alternatives to carbon dioxide?. PloS one 13 , e0203793 (2018). 30199551 10.1371/journal.pone.0203793 PMC6130864

31. Young, D. Effects of drugs on clinical laboratory tests. Third . Vol. 3 (1990).

32. Belfield A Goldenberg D M. Enzyme. 1971 12 561 10.1159/000459586 Belfield, A. & Goldenberg, D. M. Enzyme. 12 , 561 (1971). 10.1159/000459586 5169852

33. Tietz, N. W. in Clinical guide to laboratory tests 1096–1096 (1995).

34. Bowers LD Wong ET Kinetic serum creatinine assays. II. A critical evaluation and review Clin. Chem. 1980 26 555 561 10.1093/clinchem/26.5.555 7020989 Bowers, L. D. & Wong, E. T. Kinetic serum creatinine assays. II. A critical evaluation and review. Clin. Chem. 26 , 555–561. 10.1093/clinchem/26.5.555 (1980). 7020989

35. Sugarbaker, P. H. in Advances in Immunity and Cancer Therapy: Volume 1 (ed P. K. Ray) 167–193 (Springer New York, 1985). 10.1007/978-1-4612-5068-5_5 3916663

36. Geraghty JG Coveney EC Sherry F O'Higgins NJ Dufy MJ CA 15–3 in patients with locoregional and metastatic breast carcinoma Cancer 1992 70 2831 2834 10.1002/1097-0142(19921215)70:12<2831::AID-CNCR2820701218>3.0.CO;2-8 1451063 Geraghty, J. G., Coveney, E. C., Sherry, F., O’Higgins, N. J. & Dufy, M. J. CA 15–3 in patients with locoregional and metastatic breast carcinoma. Cancer 70 , 2831–2834. 10.1002/1097-0142(19921215)70:12%3c2831::AID-CNCR2820701218%3e3.0.CO;2-8 (1992). 1451063 10.1002/1097-0142(19921215)70:12<2831::aid-cncr2820701218>3.0.co;2-8

37. Haga Y Sakamoto K Egami H Yoshimura R Akagi M Evaluation of Serum CA125 Values in Healthy Individuals and Pregnant Women Am. J. Med. Sci. 1986 292 25 29 10.1097/00000441-198607000-00005 3521278 Haga, Y., Sakamoto, K., Egami, H., Yoshimura, R. & Akagi, M. Evaluation of Serum CA125 Values in Healthy Individuals and Pregnant Women. Am. J. Med. Sci. 292 , 25–29. 10.1097/00000441-198607000-00005 (1986). 3521278 10.1097/00000441-198607000-00005

38. Martin B Rotten D Jolivet A Gautray JP Binding of Steroids by Proteins in Follicular Fluid of the Human Ovary J. Clin. Endocrinol. Metab. 1981 53 443 447 10.1210/jcem-53-2-443 7195910 Martin, B., Rotten, D., Jolivet, A. & Gautray, J. P. Binding of Steroids by Proteins in Follicular Fluid of the Human Ovary. J. Clin. Endocrinol. Metab. 53 , 443–447. 10.1210/jcem-53-2-443 (1981). 7195910 10.1210/jcem-53-2-443

39. Uotila M Ruoslahti E Engvall E Two-site sandwich enzyme immunoassay with monoclonal antibodies to human alpha-fetoprotein J. Immunol. Methods 1981 42 11 15 10.1016/0022-1759(81)90219-2 6165775 Uotila, M., Ruoslahti, E. & Engvall, E. Two-site sandwich enzyme immunoassay with monoclonal antibodies to human alpha-fetoprotein. J. Immunol. Methods 42 , 11–15. 10.1016/0022-1759(81)90219-2 (1981). 6165775 10.1016/0022-1759(81)90219-2

40. Nishikimi M Appaji Rao N Yagi K The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen Biochem. Biophys. Res. Commun. 1972 46 849 854 10.1016/S0006-291X(72)80218-3 4400444 Nishikimi, M., Appaji Rao, N. & Yagi, K. The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem. Biophys. Res. Commun. 46 , 849–854. 10.1016/S0006-291X(72)80218-3 (1972). 4400444 10.1016/s0006-291x(72)80218-3

41. Paglia DE Valentine WN Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase J. Lab. Clin. Med. 1967 70 158 169 6066618 Paglia, D. E. & Valentine, W. N. Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 70 , 158–169 (1967). 6066618

42. Zhang X-F Gurunathan S Combination of salinomycin and silver nanoparticles enhances apoptosis and autophagy in human ovarian cancer cells: an effective anticancer therapy Int. J. Nanomedicine. 2016 11 3655 3675 10.2147/IJN.S111279 27536105 PMC4977082 Zhang, X.-F. & Gurunathan, S. Combination of salinomycin and silver nanoparticles enhances apoptosis and autophagy in human ovarian cancer cells: an effective anticancer therapy. Int. J. Nanomedicine. 11 , 3655–3675. 10.2147/IJN.S111279 (2016). 27536105 10.2147/IJN.S111279 PMC4977082

43. Yuan Y-G Gurunathan S Combination of graphene oxide–silver nanoparticle nanocomposites and cisplatin enhances apoptosis and autophagy in human cervical cancer cells Int. J. Nanomedicine. 2017 12 6537 6558 10.2147/IJN.S125281 28919753 PMC5592952 Yuan, Y.-G. & Gurunathan, S. Combination of graphene oxide–silver nanoparticle nanocomposites and cisplatin enhances apoptosis and autophagy in human cervical cancer cells. Int. J. Nanomedicine. 12 , 6537–6558. 10.2147/IJN.S125281 (2017). 28919753 10.2147/IJN.S125281 PMC5592952

44. Gasparino E The effect of heat stress on GHR, IGF-I, ANT, UCP and COXIII mRNA expression in the liver and muscle of high and low feed efficiency female quail Br. Poult. Sci. 2014 55 466 473 10.1080/00071668.2014.925090 24848692 Gasparino, E. et al. The effect of heat stress on GHR, IGF-I, ANT, UCP and COXIII mRNA expression in the liver and muscle of high and low feed efficiency female quail. Br. Poult. Sci. 55 , 466–473. 10.1080/00071668.2014.925090 (2014). 24848692 10.1080/00071668.2014.925090

45. Recktenwald DJ Introduction to Flow Cytometry: Principles, Fluorochromes, Instrument Set-up Calibration. J. Chemother. 1993 2 387 394 10.1089/scd.1.1993.2.387 7922001 Recktenwald, D. J. Introduction to Flow Cytometry: Principles, Fluorochromes, Instrument Set-up. Calibration. J. Chemother. 2 , 387–394. 10.1089/scd.1.1993.2.387 (1993). 10.1089/scd.1.1993.2.387 7922001

46. Dean PN Jett JH Mathematical analysis of DNA distributions derived from flow microfluorometry J. Cell Biol. 1974 60 523 10.1083/jcb.60.2.523 4855906 PMC2109170 Dean, P. N. & Jett, J. H. Mathematical analysis of DNA distributions derived from flow microfluorometry. J. Cell Biol. 60 , 523 (1974). 4855906 10.1083/jcb.60.2.523 PMC2109170

47. Bancroft, J. D. & Gamble, M. Theory and Practice of Histological Techniques . (Churchill Livingstone, 2008).

48. Steel, R. G. Pinciples and procedures of statistics a biometrical approach . 3rd ed edn, (1997).

49. El-Sharaky AS Newairy AA Kamel MA Eweda SM Protective effect of ginger extract against bromobenzene-induced hepatotoxicity in male rats Food and Chem Toxicol 2009 47 1584 1590 10.1016/j.fct.2009.04.005 19371770 El-Sharaky, A. S., Newairy, A. A., Kamel, M. A. & Eweda, S. M. Protective effect of ginger extract against bromobenzene-induced hepatotoxicity in male rats. Food and Chem Toxicol 47 , 1584–1590. 10.1016/j.fct.2009.04.005 (2009). 19371770 10.1016/j.fct.2009.04.005

50. El-Desouky MA Fahmi AA Abdelkader IY Nasraldin KM Anticancer effect of amygdalin (vitamin B-17) on hepatocellular carcinoma cell line (HepG2) in the presence and absence of zinc Anticancer Agents Med. Chem. 2020 20 486 494 10.2174/1871520620666200120095525 31958042 El-Desouky, M. A., Fahmi, A. A., Abdelkader, I. Y. & Nasraldin, K. M. Anticancer effect of amygdalin (vitamin B-17) on hepatocellular carcinoma cell line (HepG2) in the presence and absence of zinc. Anticancer Agents Med. Chem. 20 , 486–494 (2020). 31958042 10.2174/1871520620666200120095525

51. Ali, S. A., Ibrahim, N. A., Mohammed, M. M., El-Hawary, S. & Refaat, E. A. The potential chemo preventive effect of ursolic acid isolated from Paulownia tomentosa, against N-diethylnitrosamine: initiated and promoted hepatocarcinogenesis. Heliyon 5 (2019). 10.1016/j.heliyon.2019.e01769 PMC6536727 31193530

52. Guo J Wu W Sheng M Yang S Tan J Amygdalin inhibits renal fibrosis in chronic kidney disease Mol. Med. Rep. 2013 7 1453 1457 10.3892/mmr.2013.1391 23525378 Guo, J., Wu, W., Sheng, M., Yang, S. & Tan, J. Amygdalin inhibits renal fibrosis in chronic kidney disease. Mol. Med. Rep. 7 , 1453–1457. 10.3892/mmr.2013.1391 (2013). 23525378 10.3892/mmr.2013.1391

53. Dong Z Sun Y Wei G Li S Zhao Z Ergosterol ameliorates diabetic nephropathy by attenuating mesangial cell proliferation and extracellular matrix deposition via the TGF-β1/Smad2 signaling pathway Nutrients 2019 11 483 10.3390/nu11020483 30823598 PMC6412245 Dong, Z., Sun, Y., Wei, G., Li, S. & Zhao, Z. Ergosterol ameliorates diabetic nephropathy by attenuating mesangial cell proliferation and extracellular matrix deposition via the TGF-β1/Smad2 signaling pathway. Nutrients 11 , 483 (2019). 30823598 10.3390/nu11020483 PMC6412245

54. Juengel E Amygdalin inhibits the growth of renal cell carcinoma cells in vitro Int. J. Mol. Med. 2016 37 526 532 10.3892/ijmm.2015.2439 26709398 Juengel, E. et al. Amygdalin inhibits the growth of renal cell carcinoma cells in vitro. Int. J. Mol. Med. 37 , 526–532. 10.3892/ijmm.2015.2439 (2016). 26709398 10.3892/ijmm.2015.2439

55. Kolesár, E., Halenár, M., Kolesárová, A. & Massányi, P. Natural plant toxicant-cyanogenic glycoside amygdalin: characteristic, metabolism and the effect on animal reproduction. J. Microbiol. Biotechnol. Food Sci. 4 (2015).

56. Kolesarova A Resveratrol inhibits reproductive toxicity induced by deoxynivalenol J. Environ. Sci. Health A. 2012 47 1329 1334 10.1080/10934529.2012.672144 22540658 Kolesarova, A. et al. Resveratrol inhibits reproductive toxicity induced by deoxynivalenol. J. Environ. Sci. Health A. 47 , 1329–1334. 10.1080/10934529.2012.672144 (2012). 10.1080/10934529.2012.672144 22540658

57. Jaswal V Palanivelu J C, R. Effects of the Gut microbiota on Amygdalin and its use as an anti-cancer therapy: Substantial review on the key components involved in altering dose efficacy and toxicity Biochem. Biophys. Rep. 2018 14 125 132 10.1016/j.bbrep.2018.04.008 29872744 PMC5986699 Jaswal, V., Palanivelu, J. & C, R.,. Effects of the Gut microbiota on Amygdalin and its use as an anti-cancer therapy: Substantial review on the key components involved in altering dose efficacy and toxicity. Biochem. Biophys. Rep. 14 , 125–132. 10.1016/j.bbrep.2018.04.008 (2018). 29872744 10.1016/j.bbrep.2018.04.008 PMC5986699

58. Syrigos KN Rowlinson-Busza G Epenetos AA In vitro cytotoxicity following specific activation of amygdalin by β-glucosidase conjugated to a bladder cancer-associated monoclonal antibody Int. J. Cancer. 1998 78 712 719 10.1002/(SICI)1097-0215(19981209)78:6<712::AID-IJC8>3.0.CO;2-D 9833764 Syrigos, K. N., Rowlinson-Busza, G. & Epenetos, A. A. In vitro cytotoxicity following specific activation of amygdalin by β-glucosidase conjugated to a bladder cancer-associated monoclonal antibody. Int. J. Cancer. 78 , 712–719. 10.1002/(SICI)1097-0215(19981209)78:6%3c712::AID-IJC8%3e3.0.CO;2-D (1998). 9833764 10.1002/(sici)1097-0215(19981209)78:6<712::aid-ijc8>3.0.co;2-d

59. Li Y-L Li Q-X Liu R-J Shen X-Q Chinese Medicine Amygdalin and β-Glucosidase Combined with Antibody Enzymatic Prodrug System As A Feasible Antitumor Therapy Chin. J. Integr. Med. 2018 24 237 240 10.1007/s11655-015-2154-x 26272547 Li, Y.-L., Li, Q.-X., Liu, R.-J. & Shen, X.-Q. Chinese Medicine Amygdalin and β-Glucosidase Combined with Antibody Enzymatic Prodrug System As A Feasible Antitumor Therapy. Chin. J. Integr. Med. 24 , 237–240. 10.1007/s11655-015-2154-x (2018). 26272547 10.1007/s11655-015-2154-x

60. Alam A Chemotherapy treatment and strategy schemes: A review Open Acc. J. of Toxicol 2018 2 555 600 Alam, A. et al. Chemotherapy treatment and strategy schemes: A review. Open Acc. J. of Toxicol 2 , 555–600 (2018).

61. Gill, S. S., Gill, R. K. & Sobti, R. in Handbook of Oncobiology: From Basic to Clinical Sciences 259–296 (Springer, 2024).

62. Karabulut AB Apricot attenuates oxidative stress and modulates of Bax, Bcl-2, caspases, NFκ-B, AP-1, CREB expression of rats bearing DMBA-induced liver damage and treated with a combination of radiotherapy Food and Chem. Toxicol. 2014 70 128 133 10.1016/j.fct.2014.04.036 24819963 Karabulut, A. B. et al. Apricot attenuates oxidative stress and modulates of Bax, Bcl-2, caspases, NFκ-B, AP-1, CREB expression of rats bearing DMBA-induced liver damage and treated with a combination of radiotherapy. Food and Chem. Toxicol. 70 , 128–133. 10.1016/j.fct.2014.04.036 (2014). 24819963 10.1016/j.fct.2014.04.036

63. Hosny S Sahyon H Youssef M Negm A Prunus Armeniaca L. seed extract and its amygdalin containing fraction induced mitochondrial-mediated apoptosis and autophagy in liver carcinogenesis Anticancer Agents Med. Chem. 2021 21 621 629 10.2174/1871520620666200608124003 32510292 Hosny, S., Sahyon, H., Youssef, M. & Negm, A. Prunus Armeniaca L. seed extract and its amygdalin containing fraction induced mitochondrial-mediated apoptosis and autophagy in liver carcinogenesis. Anticancer Agents Med. Chem. 21 , 621–629 (2021). 32510292 10.2174/1871520620666200608124003

64. Lim JS Frenkel K Troll W Tamoxifen suppresses tumor promoter-induced hydrogen peroxide formation by human neutrophils1 Cancer Res. 1992 52 4969 4972 1516053 Lim, J. S., Frenkel, K. & Troll, W. Tamoxifen suppresses tumor promoter-induced hydrogen peroxide formation by human neutrophils1. Cancer Res. 52 , 4969–4972 (1992). 1516053

65. Testa B Kraemer SD The biochemistry of drug metabolism–an introduction: part 5 Metab. Bioact. Chem. Biodiv. 2009 6 591 684 10.1002/cbdv.200900022 19479846 Testa, B. & Kraemer, S. D. The biochemistry of drug metabolism–an introduction: part 5. Metab. Bioact. Chem. Biodiv. 6 , 591–684 (2009). 10.1002/cbdv.200900022 19479846

66. Patil MR Bihari A A comprehensive study of p53 protein J. Cell. Biochem. 2022 123 1891 1937 10.1002/jcb.30331 36183376 Patil, M. R. & Bihari, A. A comprehensive study of p53 protein. J. Cell. Biochem. 123 , 1891–1937 (2022). 36183376 10.1002/jcb.30331

67. Qian S The role of BCL-2 family proteins in regulating apoptosis and cancer therapy Front. Oncol. 2022 12 985363 10.3389/fonc.2022.985363 36313628 PMC9597512 Qian, S. et al. The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Front. Oncol. 12 , 985363 (2022). 36313628 10.3389/fonc.2022.985363 PMC9597512

68. Garner TP Lopez A Reyna DE Spitz AZ Gavathiotis E Progress in targeting the BCL-2 family of proteins Curr. Opin. Chem. Biol. 2017 39 133 142 10.1016/j.cbpa.2017.06.014 28735187 PMC5667545 Garner, T. P., Lopez, A., Reyna, D. E., Spitz, A. Z. & Gavathiotis, E. Progress in targeting the BCL-2 family of proteins. Curr. Opin. Chem. Biol. 39 , 133–142 (2017). 28735187 10.1016/j.cbpa.2017.06.014 PMC5667545

69. Truss M Bartsch J Beato M Antiprogestins prevent progesterone receptor binding to hormone responsive elements in vivo Proc. Natl. Acad. Sci. 1994 91 11333 11337 10.1073/pnas.91.24.11333 7972059 PMC45225 Truss, M., Bartsch, J. & Beato, M. Antiprogestins prevent progesterone receptor binding to hormone responsive elements in vivo. Proc. Natl. Acad. Sci. 91 , 11333–11337 (1994). 7972059 10.1073/pnas.91.24.11333 PMC45225

70. Anderson K Expression of human B cell-associated antigens on leukemias and lymphomas: a model of human B cell differentiation Blood 1984 63 1424 1433 10.1182/blood.V63.6.1424.1424 6609729 Anderson, K. et al. Expression of human B cell-associated antigens on leukemias and lymphomas: a model of human B cell differentiation. Blood 63 , 1424–1433. 10.1182/blood.V63.6.1424.1424 (1984). 6609729

71. Zöller M CD44: can a cancer-initiating cell profit from an abundantly expressed molecule? Nat. Rev. Cancer. 2011 11 254 267 10.1038/nrc3023 21390059 Zöller, M. CD44: can a cancer-initiating cell profit from an abundantly expressed molecule?. Nat. Rev. Cancer. 11 , 254–267 (2011). 21390059 10.1038/nrc3023

72. Olsson E CD44 isoforms are heterogeneously expressed in breast cancer and correlate with tumor subtypes and cancer stem cell markers BMC Cancer 2011 11 418 10.1186/1471-2407-11-418 21957977 PMC3196967 Olsson, E. et al. CD44 isoforms are heterogeneously expressed in breast cancer and correlate with tumor subtypes and cancer stem cell markers. BMC Cancer 11 , 418. 10.1186/1471-2407-11-418 (2011). 21957977 10.1186/1471-2407-11-418 PMC3196967

73. Ginestier C CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts J. Clin. Investig. 2010 120 485 497 10.1172/JCI39397 20051626 PMC2810075 Ginestier, C. et al. CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts. J. Clin. Investig. 120 , 485–497 (2010). 20051626 10.1172/JCI39397 PMC2810075

74. Smith SM Lyu YL Cai L NF-κB affects proliferation and invasiveness of breast cancer cells by regulating CD44 expression PloS one 2014 9 e106966 10.1371/journal.pone.0106966 25184276 PMC4153718 Smith, S. M., Lyu, Y. L. & Cai, L. NF-κB affects proliferation and invasiveness of breast cancer cells by regulating CD44 expression. PloS one 9 , e106966 (2014). 25184276 10.1371/journal.pone.0106966 PMC4153718

75. Fantini M In vitro and in vivo antitumoral effects of combinations of polyphenols, or polyphenols and anticancer drugs: Perspectives on cancer treatment Int. J. Mol. Sci. 2015 16 9236 9282 10.3390/ijms16059236 25918934 PMC4463587 Fantini, M. et al. In vitro and in vivo antitumoral effects of combinations of polyphenols, or polyphenols and anticancer drugs: Perspectives on cancer treatment. Int. J. Mol. Sci. 16 , 9236–9282 (2015). 25918934 10.3390/ijms16059236 PMC4463587

76. Maya-Mendoza A Tang CW Pombo A Jackson DA Mechanisms regulating S phase progression in mammalian cells Front. Biosci. 2009 14 4199 4213 10.2741/3523 19273345 Maya-Mendoza, A., Tang, C. W., Pombo, A. & Jackson, D. A. Mechanisms regulating S phase progression in mammalian cells. Front. Biosci. 14 , 4199–4213 (2009). 10.2741/3523 19273345

77. Anbumani S Mohankumar MN Gamma radiation induced cell cycle perturbations and DNA damage in Catla Catla as measured by flow cytometry Ecotoxicol. Environ. Saf. 2015 113 18 22 10.1016/j.ecoenv.2014.11.011 25483367 Anbumani, S. & Mohankumar, M. N. Gamma radiation induced cell cycle perturbations and DNA damage in Catla Catla as measured by flow cytometry. Ecotoxicol. Environ. Saf. 113 , 18–22 (2015). 25483367 10.1016/j.ecoenv.2014.11.011

78. Hosseini A Ghorbani A Cancer therapy with phytochemicals: evidence from clinical studies Avicenna. J. Phytomed. 2015 5 84 97 25949949 PMC4418057 Hosseini, A. & Ghorbani, A. Cancer therapy with phytochemicals: evidence from clinical studies. Avicenna. J. Phytomed. 5 , 84–97 (2015). 25949949 PMC4418057

79. Arur S Annexin I is an endogenous ligand that mediates apoptotic cell engulfment Dev. Cell 2003 4 587 598 10.1016/S1534-5807(03)00090-X 12689596 Arur, S. et al. Annexin I is an endogenous ligand that mediates apoptotic cell engulfment. Dev. Cell 4 , 587–598 (2003). 12689596 10.1016/s1534-5807(03)00090-x