INTRODUCTION
Laryngeal cancer is a common malignant tumor of the head and neck, which is the sixth most common malignant tumor in the world. 1 , 2 In clinic, laryngeal cancer mainly refers to primary laryngeal cancer, and laryngeal squamous cell carcinoma (LSCC) is the most common pathological type of laryngeal cancer, accounting for about 90%. 3 At present, LSCC is mainly treated by surgery, radiotherapy, or chemotherapy. 4 However, the public data shows that the incidence of LSCC has a significant upward trend in recent years due to many factors such as personal bad living habits, environmental pollution, and genetics. 5 Moreover, most LSCC patients will receive radiotherapy and chemotherapy, but in about one‐third of cancer patients, the tumor will develop drug resistance or relapse. 6 Therefore, further studies on the pathogenesis and drug resistance of LSCC are very important for the treatment of LSCC.
SOX2 is a transcription factor, which has been reported to be elevated in many tumors where it is recognized to be involved in the tumorigenesis. SOX2 was reported to be highly expressed in LSCC tumor tissues compared with paracancerous tissues, and its elevation predicted a poor prognosis of LSCC patients. 7 In mechanism, SOX2 was reported to induce LSCC cell proliferation and migration by upregulating MMP‐2 expression and activating PI3K/AKT/mTOR signaling. 8
Ubiquitin‐specific protease 34 (USP34) is a deubiquitinating enzyme (DUB), which has been reported to be involved in the tumorigenesis of several cancers. In pancreatic cancer, silence of USP34 induced cell apoptosis, and obviously suppressed cell proliferation and migration by downregulating PRR11 and p‐p38 expression. 9 Another paper also showed that overexpression of USP34 could promote pancreatic cancer cell proliferation and migration by increasing the expression of p‐AKT and p‐PKC. 10 Additionally, USP34 could stabilize axin protein, and promote β‐catenin‐mediated transcription. 11 However, the function and mechanism of USP34 in LSCC are still unclear.
In this study, we initially found there was a positive correlation between USP34 and SOX2 expression by analyzing TCGA tumor database. Then several paracancerous and tumor tissues of LSCC were collected, and we confirmed USP34 expression was positively correlated with SOX2 expression in LSCC. Our further investigations showed USP34 upregulated SOX2 expression by reducing its polyubiquitination in LSCC. Moreover, USP34 knockdown inhibited LSCC cell survival, and enhanced the drug sensitivity of cisplatin in LSCC cells.
MATERIALS AND METHODS
Cells, tissues, and chemicals
The human LSCC cell lines (TU212 and TU686) and HEK293T were purchased from ATCC, Manassas. LSCC cell lines were cultured in RPMI 1640 medium (Hyclone) and HEK293T cells were cultured in DMEM medium (Hyclone) with 10% FBS and 1% penicillin/streptomycin. And cisplatin‐resistant LSCC cell lines (TU212 Resistant ) were induced by increasing the concentration of cisplatin in the medium. Cisplatin was purchased from Sigma‐Aldrich, St. Louis., Missouri. The paracancerous and tumor tissues of LSCC were collected from Beijing Hospital of Traditional Chinese Medicine, and the use of human tissues in this study was approved by the Institutional Review Board of Beijing Hospital of Traditional Chinese Medicine.
Quantitative real‐time PCR
To determine the mRNA levels, quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed as previously described. 10 The primers used were as follows: USP34, forward 5′‐CGTTTGGACATGACGCCCTA‐3′ and reverse 5′‐CATC TGCCGTTCCTGTGTGA‐3′; SOX2, forward 5′‐CCCTGTGGTTACCTCTTCCTCC‐3′ and reverse 5′‐TGCCGTTAATGGCCGTGCC‐3′; GAPDH, forward 5′‐AACGGATTTGGTCGTATTG‐3′ and reverse 5′‐GGAAGATGGTGATGGGATT‐3′.
Immunoblotting
To evaluate the protein expression, immunoblotting was carried out as described previously. 9 Anti‐USP34 and anti‐SOX2 antibodies were purchased from Santa Cruz Biotechnology, California. Anti‐GAPDH, anti‐Myc tag, anti‐Flag tag, and anti‐HA tag antibodies were purchased from Cell Signaling Technology, Danvers, Massachusetts.
Plasmid construction and lentivirus preparation
The human USP34 and SOX2 genes were amplified by PCR, and cloned into pcDNA3.1 vector with a Myc or Flag tag. HA‐Ub plasmid was obtained from Addgene. The plasmids were transfected into LSCC cells or HEK293T cells by using Lipofectamine2000. The lentivirus‐delivered shRNAs against USP34, SOX2, and the negative control (shNC) were purchased from Santa Cruz Biotechnology. The viral particles were produced as described previously. 10
Co‐immunoprecipitation
Co‐immunoprecipitation (Co‐IP) was performed as described previously. 12 In brief, cells were lysed and whole cell lysates were incubated with the specific primary antibody at 4°C overnight, and then the mixture was subsequently incubated with the protein A/G‐Sepharose beads (Santa Cruz Biotechnology) for 2 hours. Subsequently, the beads were centrifuged, washed, and boiled. Then, the supernatants from the boiled beads were subjected to immunoblotting against indicated antibodies.
Cell viability
The LSCC cells were infected with indicated lentivirus or incubated with different concentrations of cisplatin for indicated time, and then cell viability was determined by CCK‐8 assay (Dojindo, Japan) according to the manufacturer's instructions.
Statistical analysis
To compare the differences between two groups, two‐tailed Student t test was used. To compare the differences among multiple groups, analysis of variance (ANOVA) was used. And in this study, P value less than .05 was considered statistically significant.
RESULTS
USP34 is elevated in LSCC , and upregulates SOX2 expression
Based on the TCGA Tumor data, USP34 expression was found positively correlated with SOX2 expression in head and neck squamous cell carcinoma (Figure 1A ). To further confirm the relationship between USP34 expression and SOX2 expression in LSCC, the paracancerous and tumor tissues of LSCC were collected. As shown in Figure 1B , USP34 was markedly upregulated in LSCC tumor tissues. Additionally, SOX2 was also significantly upregulated in LSCC tumor tissues (Figure 1C ). Moreover, USP34 expression was also positively correlated with SOX2 expression in LSCC (Figure 1D ).
Above results prompted us to further investigate the relationship between USP34 and SOX2. And our further investigations showed that overexpression of USP34 markedly upregulated the protein level of SOX2 in LSCC cells (Figure 2A ,B), but not the mRNA level (Figure 2C ). In contrast, knockdown of USP34 markedly downregulated the protein level of SOX2 in LSCC cells (Figure 2D ,E), but not the mRNA level (Figure 2F ). These results suggested that USP34 stabilized SOX2 protein in LSCC cells.
USP34 interacts with SOX2 , and reduces its polyubiquitination
As USP34 was a deubiquitinase, and above results also showed USP34 stabilized SOX2 protein, which prompted us to investigate whether USP34 could affect the ubiquitination of SOX2 protein. As shown in Figure 3A ,B, the reciprocal Co‐IPs showed that USP34 could interact with SOX2 in LSCC cells. Moreover, SOX2 could be polyubiquitinated (Figure 3C , Lane3), and overexpression of USP34 could markedly reduce the polyubiquitination of SOX2 (Figure 3C , Lane 4), which further suggested that USP34 stabilized SOX2 by reducing its polyubiquitination.
Knockdown of USP34 inhibits LSCC cell proliferation
To further investigate the function of USP34 in LSCC cells, USP34 was knocked down in both of TU212 and TU686 cells (Figure 4A ). And the results showed that knockdown of USP34 could significantly inhibit the cell growth of TU212 and TU686 cells (Figure 4B ,C). In addition, overexpression of SOX2 could significantly abolish shUSP34‐induced cell growth inhibition in LSCC cells (Figure 4D ,E).
Knockdown of USP34 enhances the drug sensitivity in cisplatin‐resistant LSCC cells
At last, we also investigated the expression of USP34 in cisplatin‐resistant LSCC cells. As shown in Figure 5A , TU212 Resistant cells were more resistant to cisplatin than the wild‐type cells (TU212). The immunoblotting also showed that USP34 was upregulated in TU212 Resistant cells, and SOX2, a recognized drug‐resistant protein was also found upregulated (Figure 5B ). Subsequently, USP34 was knocked down in TU212 Resistant cells (Figure 5C ), and the results showed that knockdown of USP34 could enhance the drug sensitivity of cisplatin in TU212 Resistant cells (Figure 5D ), which further indicated that USP34 was involved in the drug resistance of LSCC cells. Additionally, SOX2 was also knocked down (Figure 5E ), and it showed that SOX2 knockdown enhanced the drug sensitivity of cisplatin in TU212 Resistant cells (Figure 5F ). Therefore, USP34/SOX2 axis may contribute to the drug resistance of LSCC cells.
DISCUSSION
With the development of therapy technology, the survival rate and quality of life of patients with LSCC have been greatly improved. 13 However, the recurrence, metastasis, and insensitivity to radiotherapy or chemoresistance often lead to poor therapeutic effects for LSCC, which cannot be solved by traditional therapies. 14 , 15 Therefore, it is urgent to identify novel targets for the treatment of LSCC. In the present study, we demonstrated that USP34 promoted LSCC cell survival and drug resistance by stabilizing SOX2, and targeting USP34/SOX2 axis may be a promising strategy to combat LSCC.
DUBs are the enzymes which are responsible for removing ubiquitins from ubiquitinated substrates, and have been proven to be the emerging targets for drug discovery in many human diseases. In tumors, many highly active DUBs have been identified, and several small‐molecule inhibitors targeting DUBs have been reported. 16 For example, ubiquitin‐specific protease 7 (USP7) has been reported to display important roles in many oncogenic pathways, which raised considerable interest of many researchers. 17 P5091 was a reported selective and effective USP7 inhibitor with EC50 of 4.2 μM, which could effectively inhibit the cell growth of multiple myeloma (MM) and overcome MM's resistance to bortezomib. 18 ML323 was a reported strong selective USP1‐UAF1 inhibitor with IC50 of 76 nm, and it could enhance the cytotoxicity of cisplatin in osteosarcoma and lung cancer cells. 19 In this study, we found the deubiquitinase USP34 was elevated in LSCC, and knockdown of USP34 could markedly suppress LSCC cell growth. Additionally, USP34 was also found upregulated in cisplatin‐resistant LSCC cells, and knockdown of USP34 could also enhance the drug sensitivity of cisplatin in LSCC cells. These results at least preliminarily indicated that USP34 may be an active DUB in LSCC, which may lead to novel therapies for LSCC.
SOX2, a transcription factor, has been found to be one of the promoters for LSCC tumorigenesis and drug resistance. 20 And in this study, we found that USP34 could interact with SOX2, and prevent SOX2 from degradation through ubiquitin‐proteasome pathway, which further explained one of the reasons why SOX2 was highly expressed in LSCC. Interestingly, a recent paper also showed that USP9x could interact with SOX2, and reduce its polyubiquitination, which was similar to USP34. 12 In our future experiments, we will compare whether USP34 and USP9x can play a synergistic role in LSCC.
CONCLUSION
Collectively, this study indicated that elevated USP34 regulated LSCC cell survival and induced the drug resistance of cisplatin in LSCC cells by stabilizing SOX2. USP34/SOX2 axis could be a promising strategy for the treatment of LSCC.
CONFLICT OF INTEREST
All authors disclosed no relevant financial conflicts of interest.
ACKNOWLEDGEMENTS
The authors thank for the support from Beijing Hospital of Traditional Chinese Medicine.
REFERENCES
1 Bray F , Ferlay J , Soerjomataram I , Siegel RL , Torre LA , Jemal A . Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries . CA Cancer J Clin . 2018 ; 68 ( 6 ): 394 – 424 . 30207593 10.3322/caac.21492
2 Yang D , Shi Y , Tang Y , Yin H , Guo Y , Wen S , et al. Effect of HPV infection on the occurrence and development of laryngeal cancer: A review . J Cancer . 2019 ; 10 ( 19 ): 4455 – 4462 . 31528209 10.7150/jca.34016 PMC6746124
3 Zhang L , Wu Y , Zheng B , Su L , Chen Y , Ma S , et al. Rapid histology of laryngeal squamous cell carcinoma with deep‐learning based stimulated Raman scattering microscopy . Theranostics . 2019 ; 9 ( 9 ): 2541 – 2554 . 31131052 10.7150/thno.32655 PMC6526002
4 Huang H , Zhang ZM , Zhang Y , Wang XL , Liu SY , Xu ZG . Long‐term outcome of patients with pyriform sinus squamous cell carcinoma treated with planned preoperative (chemo‐) radiotherapy plus laryngeal function sparing surgery . Zhonghua Zhong Liu Za Zhi . 2019 ; 41 ( 7 ): 535 – 539 . 31357842 10.3760/cma.j.issn.0253-3766.2019.07.010
5 Marur S , Forastiere AA . Head and neck squamous cell carcinoma: Update on epidemiology, diagnosis, and treatment . Mayo Clin Proc . 2016 ; 91 ( 3 ): 386 – 396 . 26944243 10.1016/j.mayocp.2015.12.017
6 Li L , Wang R , He S , Shen X , Kong F , Li S , et al. The identification of induction chemo‐sensitivity genes of laryngeal squamous cell carcinoma and their clinical utilization . Eur Arch Otorhinolaryngol . 2018 ; 275 ( 11 ): 2773 – 2781 . 30267217 10.1007/s00405-018-5134-x
7 Tang XB , Shen XH , Li L , Zhang YF , Chen GQ . SOX2 overexpression correlates with poor prognosis in laryngeal squamous cell carcinoma . Auris Nasus Larynx . 2013 ; 40 ( 5 ): 481 – 486 . 23462687 10.1016/j.anl.2013.01.003
8 Yang N , Hui L , Wang Y , Yang H , Jiang X . SOX2 promotes the migration and invasion of laryngeal cancer cells by induction of MMP‐2 via the PI3K/Akt/mTOR pathway . Oncol Rep . 2014 ; 31 ( 6 ): 2651 – 2659 . 24700142 10.3892/or.2014.3120
9 Lin C , Xia J , Gu Z , Meng Y , Gao D , Wei S . Downregulation of USP34 inhibits the growth and migration of pancreatic cancer cells via inhibiting the PRR11 . Onco Targets Ther . 2020 ; 13 : 1471 – 1480 . 32110045 10.2147/OTT.S228857 PMC7036619
10 Gu Z , Lin C , Hu J , Xia J , Wei S , Gao D . USP34 regulated human pancreatic cancer cell survival via AKT and PKC pathways . Biol Pharm Bull . 2019 ; 42 ( 4 ): 573 – 579 . 30686807 10.1248/bpb.b18-00646
11 Lui TT , Lacroix C , Ahmed SM , Goldenberg SJ , Leach CA , Daulat AM , et al. The ubiquitin‐specific protease USP34 regulates axin stability and Wnt/beta‐catenin signaling . Mol Cell Biol . 2011 ; 31 ( 10 ): 2053 – 2065 . 21383061 10.1128/MCB.01094-10 PMC3133363
12 Chen X , Zhang X , Cai H , Yang W , Lei H , Xu H , et al. Targeting USP9x/SOX2 axis contributes to the anti‐osteosarcoma effect of neogambogic acid . Cancer Lett . 2020 ; 469 : 277 – 286 . 31605775 10.1016/j.canlet.2019.10.015
13 Nachalon Y , Reicher Y , Alkan U , Levi L , Bachar G , Popovtzer A . Prognostic factors for survival and nonfunctional larynx in patients with squamous cell carcinoma of the larynx . Laryngoscope . 2020 ; 130 ( 5 ): 1202 – 1205 . 31260125 10.1002/lary.28173
14 Johnson KCC , Ley J , Oppelt P , Lu J , Gay HA , Daly M , et al. nab‐Paclitaxel‐based induction chemotherapy followed by cisplatin and radiation therapy for human papillomavirus‐unrelated head and neck squamous‐cell carcinoma . Med Oncol . 2019 ; 36 ( 11 ): 93 . 31595355 10.1007/s12032-019-1318-5
15 Lin XJ , Liu H , Li P , Wang HF , Yang AK , Di JM , et al. miR‐936 suppresses cell proliferation, invasion, and drug resistance of laryngeal squamous cell carcinoma and targets GPR78 . Front Oncol . 2020 ; 10 : 60 . 32117723 10.3389/fonc.2020.00060 PMC7011958
16 Wertz IE , Murray JM . Structurally‐defined deubiquitinase inhibitors provide opportunities to investigate disease mechanisms . Drug Discov Today Technol . 2019 ; 31 : 109 – 123 . 31200854 10.1016/j.ddtec.2019.02.003
17 Gavory G , O'Dowd CR , Helm MD , Flasz J , Arkoudis E , Dossang A , et al. Discovery and characterization of highly potent and selective allosteric USP7 inhibitors . Nat Chem Biol . 2018 ; 14 ( 2 ): 118 – 125 . 29200206 10.1038/nchembio.2528
18 Chauhan D , Tian Z , Nicholson B , Kumar KG , Zhou B , Carrasco R , et al. A small molecule inhibitor of ubiquitin‐specific protease‐7 induces apoptosis in multiple myeloma cells and overcomes bortezomib resistance . Cancer Cell . 2012 ; 22 ( 3 ): 345 – 358 . 22975377 10.1016/j.ccr.2012.08.007 PMC3478134
19 Liang Q , Dexheimer TS , Zhang P , Rosenthal AS , Villamil MA , You C , et al. A selective USP1‐UAF1 inhibitor links deubiquitination to DNA damage responses . Nat Chem Biol . 2014 ; 10 ( 4 ): 298 – 304 . 24531842 10.1038/nchembio.1455 PMC4144829
20 Chyr J , Guo D , Zhou X . LSCC SNP variant regulates SOX2 modulation of VDAC3 . Oncotarget . 2018 ; 9 ( 32 ): 22340 – 22352 . 29854282 10.18632/oncotarget.24918 PMC5976468