1. Introduction
Giant cell tumor of bone (GCTB) is defined as an intermediate bone neoplasm, which indicates that it is a locally aggressive but rarely metastasizing tumor [ 1 ]. GCTB usually originates at the end of long bones of skeletally mature young adults (20 to 45 years old) and has a local recurrence rate of 15–50% [ 1 , 2 ]. Despite the high recurrence rate, fewer than 1% of all GCTB cases undergo malignant transformation due to an as-yet not completely identified mechanism [ 3 ]; the typically slow-growing pulmonary metastases are rarely observed [ 1 ].
Histologically, GCTB is characterized by three different cell populations: mononuclear spindle-shaped “stromal” cells, mononuclear macrophage-like osteoclast precursor cells, and multinucleated osteoclast-like giant cells [ 4 ]. The neoplastic “stromal” cells secrete high levels of various chemokines (e.g., CCL2 and CXCL12) to attract osteoclast precursor cells from the circulation to the tumor site [ 4 , 5 ]. The attracted monocytes will upregulate the expression of the RANK receptor (TNFRSF11A) due to the additional secretion of CSF1 (M-CSF1) by the neoplastic cells [ 6 ]. Furthermore, the neoplastic cells produce high levels of RANK ligand (TNFSF11), which will induce monocyte differentiation, fusion, and ultimately the formation of the characteristic multinucleated giant cells [ 7 ]. These formed giant cells exhibit osteoclast-like bone resorption features, causing the characteristic osteolytic phenotype of GCTB.
GCTB frequently harbors a heterozygous hotspot mutation in one of the genes encoding for histone H3.3 ( H3F3A ) (92% of the cases), and this mutation is exclusively observed in the neoplastic “stromal” cells [ 8 ]. The affected glycine residue (p.G34W and, to a lesser extent, p.G34L mutations) is highly specific for GCTB, and helps to discriminate GCTB from chondroblastoma (characterized by p.K36M mutations in H3F3A and H3F3B ) and other giant cell-rich tumor types [ 9 , 10 ]. The identification of the H3F3A variant has not only led to the development of novel diagnostic tools, but also confirmed that the “stromal” cells are the driving neoplastic component of GCTB, because these cells can be maintained in vitro and cause osteolytic bone lesions in orthotopic mouse models [ 11 , 12 , 13 ]. Moreover, knockdown or correction of the H3F3A p.G34W gene leads to a reduction in cell proliferation, cell migration, colony formation, and RANK ligand production in vitro, and inhibits tumor formation in mice [ 12 , 13 ].
Although the oncogenic mechanisms responsible for the neoplastic outgrowth of the tumor cells are rather complex [ 14 ] and relate to an interplay between the H3F3A mutation and telomere regulation in the neoplastic cells, the exact targets for oncogenesis, and thus, potential targets for therapy, have not yet been identified. Due to the incorporation of the H3F3A p.G34W oncohistone into the chromatin, several histone modifications (e.g., H3K36me3 and H3K27me3) are globally reduced or redistributed [ 13 , 15 , 16 , 17 ]. As these histone marks are changed beyond H3F3A p.G34W incorporation sites, the epigenetic landscape of the neoplastic cells is highly altered, which causes aberrant gene transcription patterns which may drive the formation of GCTB. The current understanding of the molecular mechanism behind H3F3A p.G34W-induced remodeling of the epigenome focuses around impaired osteogenic or myogenic differentiation of the neoplastic cells, resulting in the pathogenic secretion of ligands that recruit and activate osteoclast-like cells [ 13 , 16 , 18 ].
The standard of curative care for GCTB patients is surgery. If tumors are regarded unresectable or to facilitate surgical treatment, patients can be treated with systemic targeted therapy (i.e., denosumab or bisphosphonates) [ 2 , 19 , 20 , 21 ]. Denosumab, a fully human antibody against the RANK ligand, inhibits the formation of giant cells and thus stops the giant cell-driven bone resorption process. However, life-long treatment, when irresectable, may be required, because the neoplastic cells are not targeted by denosumab [ 22 ], resulting in relapse upon treatment discontinuation. Therefore, there is a need to develop novel therapeutic strategies which directly target the neoplastic cells in GCTB.
Due to the presence of a pathognomonic histone mutation (i.e., H3F3A p.G34W ) in GCTB, in the current study we examined whether targeting the epigenetic landscape could eliminate the neoplastic cells from GCTB lesions. To achieve this, four novel cell lines of neoplastic cells from GCTB patients, which were pre-operatively treated with denosumab, were established. These four cell lines expressed the H3F3A p.G34W mutation in vitro and were used to perform a broad epigenetics compound screen ( n = 128) to identify key epigenetic regulators in the neoplastic cells.
2. Materials and Methods
2.1. Cell Culture
Cell lines derived from the neoplastic “stromal” cells (L4040, L5077, L5345, and L5862) were generated at the Leiden University Medical Center (LUMC) from resected giant cell tumors of bone which were pre-operatively treated with denosumab ( Figure 1 and Figure S1, Tables S1 and S2 ). All samples were handled and coded according to the “Code for Proper Secondary Use of Human Tissue in The Netherlands” (Dutch Federation of Medical Scientific Societies), and their use was approved by the LUMC ethical committee (B20.012). Cells were cultured in IMDM (Gibco, Invitrogen Life-Technologies, Scotland, UK) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (F7524, Sigma-Aldrich, Saint Louis, MO, USA) and 1% insulin–transferrin–selenium (ITS-G) (Gibco). Cultures were maintained in a humidified incubator with 5% CO 2 at 37 °C. A PCR-based mycoplasma test and short tandem repeat (STR) profiling (GenePrint 10 System, Promega, Madison, WI, USA) were performed monthly. Due to the time of establishment or slow growth rates, the L5077, L5345, and L5862 cell lines could not be included in all performed experiments ( Table S1 ).
2.2. Sanger Sequencing of H3F3A p.G34W
DNA was isolated from cultured cells using the High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol. DNA (10–100 ng) was amplified with iQ™ SYBR ® Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) and H3F3A primers (FW: GACGTAATCTTCACCCTTTCAA and RV: TCCAGGTAAGATTATGGCTTCA) using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Sanger sequencing was performed at Macrogen (Amsterdam, the Netherlands) using an ABI 3730xl system (Applied Biosystems™, ThermoFisher Scientific, Waltham, MA, USA).
2.3. H3F3A p.G34W Immunohistochemistry
Cultured cells were fixed in 4% formaldehyde (Q Path, VWR Chemicals, Radnor, PA, USA) and prepared for paraffin embedding with the Epredia™ Cytoblock™ Cell Block Preparation System (ThermoFisher Scientific). Sections were stained with hematoxylin and eosin (H&E) using the Leica ST5020-CV5030 Stainer Integrated Workstation (Leica Biosystems, Amsterdam, The Netherlands). The H3F3A p.G34W immunohistochemical stain (RM263, RevMAb, Biosciences, San Francisco, CA, USA) was performed with the Dako Omnis immunostainer (Agilent, Santa Clara, CA, USA) according to the standard diagnostic procedure at LUMC.
2.4. Compounds
A detailed list of all compounds ( n = 128) included in the epigenetics compound library (L1900, Selleckchem, Houston, TX, USA) is presented in the supplementary files (Table S3) . The histone deacetylase (HDAC) inhibitors romidepsin (S3020, Selleckchem), panobinostat (S1030, Selleckchem), dacinostat (S1095, Selleckchem), quisinostat (S1096, Selleckchem), and fimepinostat (S2759, Selleckchem) were dissolved in DMSO.
2.5. Epigenetics Compound Screens
L4040 (15,000/well) and L5345 (15,000/well) cells were seeded in 96-well plates and allowed to attach overnight. Subsequently, cells were treated with the epigenetics compound library ( Table S3 ) at a final concentration of 1 µM. After 72 h of treatment, cells were fixed with 4% formaldehyde and stained with 2 µg/mL Hoechst 33342 (H1399, Invitrogen Life-Technologies). An automatic nuclei count was performed with the Cellomics ArrayScan VTI HCS 700 series and HCS Studio Cell Analysis Software (ThermoFisher Scientific). Data were normalized to the negative control (i.e., 0.1% DMSO) to obtain the percent of control values. The screen was performed once in triplicate. A schematic overview of the epigenetics compound screen is depicted in Figure 2 A.
The efficacy of compounds that reduced cell proliferation with >60% in both cell lines was validated by repeating the screen at final concentrations of 0.1 µM, 0.5 µM, and 1 µM. The validation screen was performed once in triplicate. A schematic overview of the validation screen is depicted in Figure 2 C. The online tool MORPHEUS (Broad Institute, Cambridge, MA, USA) was used to generate heatmaps.
2.6. Next-Generation RNA-Sequencing
RNA was isolated from cultured cells (i.e., L4040, L5077, and L5345) with the Direct-zol MiniPrep RNA isolation kit (Zymo Research, Irvine, CA, USA), according to the manufacturer’s protocol. RNA-sequencing on the BGISEQ-500 platform was performed by BGI Genomics (Shenzhen, China). RNA-Seq files were processed using the opensource BIOWDL RNAseq pipeline v5.0.0 ( https://zenodo.org/record/5109461#.Ya2yLFPMJhE ) (accessed on 15 June 2022). This pipeline performs FASTQ preprocessing (including quality control, quality trimming, and adapter clipping), RNA-Seq alignment, read quantification, and optional transcript assembly. FastQC was used for raw FASTQ read quality control. Adapter clipping was performed using Cutadapt (v2.10) with default settings. RNA-Seq reads’ alignment was performed using STAR (v2.7.5a) on the GRCh38 human reference genome. The gene read quantification was performed using HTSeq-count (v0.12.4) with the setting “–stranded=no”. The gene annotation used for quantification was Ensembl version 105. Transcripts per kilobase million (TPM) values were calculated for each sample using StringTie (v1.3.6). Variant calling was performed using GATK HaplotypeCaller (v4.1.8.0) with parameters suitable for RNAseq data analysis. Ensembl VEP was used for variant annotation. To select only meaningful variants for the follow-up analysis, we applied a filter on minimal read coverage of 10 reads (DP = 10) and minimal variant allele frequency of 30%. The analyzed data were used to determine the expression ratio of H3F3A wildtype and p.G34W ( H3-3A ) and pathogenic variants that could have caused spontaneous immortalization in L4040 cells ( ATRX , DAXX , TP53 , RB1 , CDKN2A , and CDKN2B ). Additionally, expression levels of all HDAC subtypes were extracted from the dataset. The raw data, identified variants, and obtained TPM values were deposited in the European Genome-phenome Archive (EGA) under accession number EGAS00001006441.
2.7. Drug Treatment of 2D Cell Cultures
L4040 (5000/well), L5077 (10,000/well), and L5862 (7500/well) cells were seeded in optimized cell densities in 96-well plates. After overnight attachment, cells were treated for 72 h with five HDAC inhibitors in concentrations ranging from 0.1 nM to 1 µM. Nuclei counts were performed as described under the methods section of the epigenetics compound screens. Data were normalized to “time 0 measurements” (i.e., nuclei counts before treatment) and the negative control (i.e., 0.1% DMSO) to correct for differences in growth rate kinetics (GR Calculator, http://www.grcalculator.org ) (accessed on 7 September 2021) [ 23 ]. Experiments were performed three times in triplicate.
2.8. Drug Treatment of 3D Cell Cultures
Multi-cellular tumor spheroids (MCTS) of L4040 and L5862 cells (10,000/well) were generated as previously described [ 24 ] and grown for seven days before drug treatment was started. MCTS were treated with romidepsin and panobinostat in concentrations ranging from 0.1 nM to 10 µM. After 72 h of treatment, MCTS were incubated in normal growth medium containing PrestoBlue cell viability reagent (1:10 dilution) for 1.5 h at 37 °C. Fluorescence was measured at 550/600 nm with the Infinite M Plex plate reader (Tecan Group Ltd., Männedorf, Switzerland). Data were normalized to the negative control (i.e., 0.1% DMSO) to obtain the percent of control values.
Subsequently, MCTS were fixed in 4% formaldehyde containing Alcian blue (1:200 dilution) and prepared for paraffin embedding with the Epredia™ Cytoblock™ Cell Block Preparation System. H&E stains were performed using the Leica ST5020-CV5030 Stainer Integrated Workstation. The H3F3A p.G34W immunohistochemical stain (RM263, RevMAb, Biosciences) was performed with the Dako Omnis immunostainer according to the standard diagnostic procedure at LUMC. Additionally, immunohistochemistry for Ki-67 (1:1600 dilution, clone D2H10, Cell Signaling Technology (CST), Leiden, The Netherlands) and cleaved caspase 3 (Cleaved caspase 3 (Asp175), 1:800 dilution, CST) was performed as previously described [ 24 ]. Experiments were performed three times in triplicate.
2.9. Western Blot
L4040 (125,000/well), L5077 (300,000/well), and L5862 (225,000/well) cells were seeded in 6-well plates and allowed to attach overnight. Subsequently, cells were treated for 24 h or 48 h with romidepsin (0.1 to 3.2 nM) or panobinostat (20 to 50 nM). Sample preparation, Western blotting, and quantification were performed as previously described [ 25 ]. Western blots were examined for the expression of full-length/cleaved caspase 3 (1:1000 dilution, 8G10, CST), full-length/cleaved PARP (1:1000 dilution, 46D11, CST), and acetyl-Histone H3 Lys9 (acH3K9) (1:1000 dilution, clone C5B11, CST). As a loading control, α-Tubulin (1:30,000 dilution, DM1A, CST) was used.
2.10. Statistical Analysis
Outlier values in the dose–response curve datasets were identified with the online outlier calculator (Grubbs’ test, α = 0.05) from GraphPad (San Diego, CA, USA).
3. Results
3.1. Established Cell Lines Consist of Neoplastic “Stromal” Cells That Express the H3F3A p.G34W Oncohistone In Vitro
Four cell lines of neoplastic cells from GCTB patients that were pre-operatively treated with denosumab were established and all primary tumors harbored an H3F3A p.G34W mutation ( Table S1 ). STR profiles from the primary tumors were identical to those from the established cell lines ( Table S2 ). Sanger sequencing confirmed the presence of a heterozygous H3F3A p.G34W mutation in all cell lines ( Figure 1 A); transcriptome sequencing showed RNA expression of both the H3F3A wildtype and mutant allele in three cell lines ( Figure S2 ). All established cell lines expressed the H3F3A p.G34W protein at passage 25 or higher as determined by immunohistochemistry with an H3F3A p.G34W mutant-specific antibody ( Figure 1 B), confirming outgrowth of neoplastic cells and expression of the oncohistone in vitro. Notably, the L5345 cell line contained a small number of H3F3A p.G34W-negative cells, as indicated by the arrow and inset in Figure 1 B. STR profiling did not indicate contamination with another cell line in culture ( Table S2 ), suggesting that a non-neoplastic cell type from the primary GCTB tumor survived until passage 28 or that expression of the oncohistone was lost in a subset of cells due to a currently unknown mechanism. Transcriptome sequencing of L5345 at passage 28 showed 51% wildtype and 49% mutant H3F3A reads ( Figure S2 ), confirming the presence and overall balanced expression of the H3F3A p.G34W mutation. Interestingly, the L4040 cell line reached passage numbers > 100, indicating spontaneous immortalization, although no ATRX , DAXX , TP53 , RB1 , CDKN2A , and CDKN2B variants were identified in the RNA sequencing data that could explain this unlimited lifespan. Hence, four novel cell lines of neoplastic cells from GCTB were successfully established. These four cell lines were subsequently used to identify novel therapeutic strategies, although not all cell lines could be included in each performed experiment due to time of establishment or slow growth rates ( Table S1 ).
3.2. Epigenetics Compound Screen Identifies Aurora Kinases, Janus Kinases, and HDAC Enzymes as Potential Therapeutic Targets for GCTB
To explore the potential of targeting the epigenetic landscape in GCTB, a broad epigenetics compound screen ( n = 128) was performed in two cell lines to identify novel therapeutic targets in an unbiased way ( Figure 2 A). Several compound classes, including Aurora kinase, Janus kinase (JAK), and HDAC inhibitors, reduced the growth of both GCTB cell lines ( Figure 2 B).
Eight compounds which inhibited cell growth with ≥60 % in two cell lines, as indicated by the bold numbers and lines in Figure 2 B, were selected for the validation screen ( Figure 2 C). Notably, several HDAC inhibitors and one JAK inhibitor (i.e., XL019) had a pronounced effect on cellular growth at a tenfold lower compound concentration than used in the primary screen (100 nM vs. 1 µM) ( Figure 2 D). Hence, Aurora kinase, JAK, and HDAC inhibitors represent promising therapeutic strategies for GCTB.
3.3. Class I HDAC Subtypes Are Most Abundantly Expressed in GCTB
HDAC inhibitors had the highest overall growth-reducing effect on the neoplastic cells in GCTB (average of 90% growth inhibition at 100 nM); therefore, this compound class was selected for further studies. HDAC enzymes consist of eleven different subtypes, which can be subdivided into four classes (class I, IIA, IIB, and IV). RNA expression levels of all HDACs were extracted from a previously generated RNA-sequencing dataset of three of the established cell lines (L4040, L5077, and L5345). All HDAC subtypes, except for HDAC4, were expressed in the neoplastic cells, of which class I (i.e., HDAC1, 2, and 3) and HDAC7 showed the highest levels of RNA expression ( Figure 3 ). Hence, the targets of HDAC inhibitors are expressed in GCTB, and broad or class-I-specific HDAC inhibitors may have the most pronounced effect on the growth of the neoplastic cells.
3.4. HDAC Inhibitors Reduce the Growth of Neoplastic “Stromal” Cells in Both 2D and 3D In Vitro Models
The four HDAC inhibitors identified in the epigenetics compound screen target all HDAC subtypes (dacinostat, panobinostat, and quisinostat), or specifically, class I, IIB, and IV (fimepinostat). The transcriptome sequencing data indicated that class I HDAC subtypes were most abundantly expressed in the neoplastic cells; therefore, the clinically approved class-I-specific HDAC inhibitor romidepsin was also included in follow-up studies, although this specific HDAC inhibitor was not identified as a hit compound in the primary epigenetics compound screen (compound #52). These five selected HDAC inhibitors were used to derive dose–response curves in three of the GCTB cell lines, of which two were not used in the epigenetics compound screen (L5077 and L5862). All cell lines were highly sensitive to the five HDAC inhibitors ( Figure 4 A), with GR 50 and IC 50 values in the nanomolar range after 72 h of treatment ( Table 1 ). Interestingly, all cell lines were most sensitive to treatment with romidepsin ( Table 1 ), implying that class I HDACs are indeed the subtypes of interest in GCTB. The two clinically approved HDAC inhibitors (i.e., romidepsin and panobinostat) were selected for further studies, to improve the translation of our preclinical findings to clinical trials.
The reduced complexity of 2D cell cultures can affect drug response, and thereby impede clinical translation; thus, we established 3D in vitro models of two GCTB cell lines to validate the effect of romidepsin and panobinostat. Dose–response curves of these two HDAC inhibitors in MCTS models of L4040 and L5862 cells showed similar IC 50 values as compared with the 2D cell culture experiments ( Figure 5 A and Table 1 ). Hence, both pan-HDAC and class-I-specific HDAC inhibitors reduce the growth of the neoplastic cells in 2D and 3D in vitro models.
3.5. Both Pan-HDAC and Class-I-Specific HDAC Inhibitors Induce Apoptosis and Histone Acetylation in GCTB
The inhibition of HDAC enzymes should prevent histone deacetylation, and thus cause an overall increase in histone acetylation; therefore, the levels of acetylated histone 3 (acH3K9) were determined after 24 h of treatment with romidepsin and panobinostat at ≥ GR 100 concentrations ( Figure 4 A). Indeed, treatment with both HDAC inhibitors induced an overall increase in histone acetylation in the three cell lines ( Figure 4 B). Moreover, the effect of romidepsin on histone acetylation was dose-dependent ( Figure 4 C), suggesting that lower HDAC inhibitor concentrations already affect the epigenetic landscape of the neoplastic cells, whereas growth is still minimally affected ( Figure 4 A).
To assess the underlying cell death mechanism, three cell lines were treated for 48 h with romidepsin and panobinostat at ≥GR 100 concentrations ( Figure 4 A). Romidepsin and panobinostat both increased the cleavage of PARP and caspase 3, both indicators of ongoing apoptosis, in all three cell lines, although caspase 3 activation was more pronounced than PARP cleavage ( Figure 4 D). Apoptosis induction was also observed in the 3D in vitro models of L4040 and L5862 after 72 h treatment with 10 nM romidepsin and 100 nM panobinostat (~IC 80 values in 3D in vitro models). A reduction in proliferation was observed in the L4040 cell line, whereas L5862 cells showed a slight increase in proliferation after treatment ( Figure 5 B). Notably, some L4040 and L5862 cells lost the detectable expression (IHC) of the oncohistone in untreated as well as treated conditions, suggesting that unknown factors can influence the expression levels of H3F3A p.G34W. Together, these results indicate that both pan-HDAC and class-I-specific HDAC inhibitors induce apoptosis in and alter the epigenetic landscape of the neoplastic cells.
4. Discussion
In this study, four novel cell lines of the neoplastic “stromal” cell component of GCTB were established and used to examine whether targeting the epigenetic landscape could be a promising therapeutic strategy to eliminate the neoplastic cells from GCTB. The establishment of novel patient-derived cell lines of neoplastic “stromal” cells is a great asset to the field, because the limited amount of available in vitro models restricts research on rare tumor entities such as GCTB [ 26 ]. To the best of our knowledge, we are the first to report on a GCTB cell line with an unlimited lifespan (L4040), which was not actively immortalized and does not show mutations in ATRX , DAXX , TP53 , RB1 , CDKN2A , and CDKN2B . Previous studies showed a maximum passage number of 20 to 40 [ 27 , 28 , 29 ], which is in line with the other three cell lines that were established in this study (L5077, L5345, and L5862). All established cell lines consist of neoplastic “stromal” cells that express the H3F3A p.G34W oncohistone whilst culturing over time.
In general, compound screens are a rough and easy way to explore drug sensitivity on a large scale, although have limitations, thus always requiring validation of “hits”. Pitfalls may include pipetting mistakes or inactivity of compounds, leading to false-negative or false-positive results. For instance, romidepsin (compound #52) was not identified as a hit compound in the primary epigenetics compound screen, although further studies showed the efficacy of romidepsin in three GCTB cell lines, which is a false-negative result that we cannot explain. Therefore, the current study only focused on compounds that showed an effect in the epigenetics compound validation screen.
We identified three compound classes that affect the cellular growth of the neoplastic cells: Aurora kinase, JAK, and HDAC inhibitors. TAK-901 is officially classified as an Aurora kinase inhibitor, but has a tenfold higher affinity for JAK3, making it a potent dual inhibitor of two interesting compound classes. Of interest, the most effective JAK inhibitor (i.e., XL019) also targets Platelet-Derived Growth Factor Receptor Beta (PDGFRβ), which is a receptor tyrosine kinase that is highly phosphorylated in GCTB [ 30 ]. Inhibition of PDGFRβ signaling with sunitinib affects the cell viability of the neoplastic cells in vitro and caused the complete depletion of giant cells and neoplastic cells in one patient [ 30 ]. Hence, compounds that target Aurora kinases, JAKs, and PDGFRβ warrant further investigation to determine whether these targeted therapies are of interest to treat GCTB.
The most promising therapeutic strategy identified in the current study was the use of HDAC inhibitors, which are a group of enzymes that play an important role in normal bone and cartilage development. HDAC1, -3, -5, and -7 are most abundantly expressed in bone tissue [ 31 ], and our study showed that three of these HDAC subtypes (HDAC1, -3, and -7) are also most prominently expressed in the GCTB cell lines. However, the overall expression patterns of HDAC enzymes in the neoplastic cells do not seem to resemble that of normal bone tissue [ 31 ]. The aberrant expression of HDAC enzymes can cause several bone-related abnormalities, including increased RANK ligand expression and bone resorption caused by the depletion of HDAC4 and -5 [ 32 ]. Notably, the expression of HDAC4 is indeed lost in the neoplastic cells. To elucidate whether HDAC enzymes contribute to the formation of GCTB and how HDAC inhibitors might be able to counteract the aberrant HDAC expression levels, additional studies should be performed.
Recently, it was also shown by others that romidepsin affects cell viability in four other patient-derived GCTB cell lines [ 28 , 29 ]. Moreover, it was shown that givinostat, a class I, IIA, and IIB HDAC inhibitor, reduced tumor growth in a patient-derived xenograft mouse model of malignant GCTB [ 33 ]. Interestingly, givinostat (compound #48) also showed an effect in the primary epigenetics compound screen that was performed in the current study, although the effect was not pronounced enough to be selected as a hit compound (95% and 44% growth reduction in L4040 and L5345 cells, respectively). Nevertheless, we showed that the neoplastic cells are highly sensitive to several broad HDAC inhibitors (i.e., dacinostat, quisinostat, panobinostat, and fimepinostat), as well as an HDAC class-I-specific inhibitor (i.e., romidepsin). Together, the current study and the studies mentioned above suggest that HDAC inhibition could be a potential therapeutic strategy for GCTB patients, although additional research is needed to elucidate the underlying biological mechanism for HDAC inhibitor sensitivity in GCTB.
Panobinostat and romidepsin are clinically approved for the treatment of multiple myeloma and peripheral T-cell lymphomas, respectively, and reach maximum plasma concentrations of 62 nM and 700 nM, respectively [ 34 , 35 ]. The maximum plasma concentrations in patients are comparable to the obtained GR 50 and IC 50 values for both HDAC inhibitors in our established 2D and 3D in vitro models of GCTB, suggesting that our findings are not related to off-target or toxic side-effects. However, HDAC inhibitors can cause serious adverse events in patients, including thrombocytopenia, neutropenia, various cardiac and metabolic effects, and infections [ 36 ]. The side-effects of long-term denosumab are limited; therefore, it should be carefully assessed per individual GCTB patient which type of treatment is most suitable and whether the elimination of neoplastic cells by HDAC inhibition outweighs the risk of potential side-effects.
Although this study clearly shows that HDAC inhibitors can eliminate the neoplastic cells in GCTB, the study design has limitations in regard to finding novel therapeutic options for GCTB. First, the utilized in vitro models do not entail all cell types that are normally present in GCTB lesions. The interplay between the neoplastic cells, monocytes, and giant cells might be an important characteristic to consider when identifying therapeutic strategies for GCTB patients. Additional research in co-culture 3D in vitro models of neoplastic cells and monocytes, as well as orthotopic in vivo models of GCTB, should be performed to confirm our current findings before clinical trials can be initiated. Moreover, these models could be used to investigate whether reactive cell reducing treatment (i.e., denosumab) would enhance the efficacy of HDAC inhibitors, which could potentially lead to reducing the dose of HDAC inhibitors to avoid side-effects in patients. The current study shows that at least one HDAC inhibitor affected the epigenome of neoplastic cells at concentrations which minimally affected cell viability, indicating the potential of combination strategies with HDAC inhibitors. Second, HDAC inhibitor sensitivity could not be directly linked to the presence of the H3F3A p.G34W mutation. It would be of interest to establish isogenic cell line pairs to study whether a synthetic lethal interaction between HDAC inhibitors and the H3F3A p.G34W mutation exists and whether treatment with this compound class can reverse H3F3A p.G34W-induced remodeling of the epigenome, which may also elucidate the underlying biological mechanism of HDAC inhibitor efficacy in GCTB. Finally, the current drug screen was focused on epigenetic targets and monotherapies, although targets beyond the epigenome as well as combination strategies are also of interest for GCTB. Recent studies indicate that next-generation antiangiogenic drugs could be promising therapeutic strategies for GCTB. Vascular endothelial growth factor (VEGF) expression is associated with the aggressiveness of osteolytic bone lesions [ 37 ] and treatment with lenvatinib with or without denosumab reduces the viability of primary GCTB cultures [ 38 ]. Lenvatinib combined with chemotherapeutic agents shows promising antitumor activity in osteosarcoma patients [ 39 ], and a combination strategy with pembrolizumab is currently under evaluation in a wide range of sarcoma patients, including bone sarcoma patients ( NCT04784247 ).
5. Conclusions
In summary, we established four novel cell lines of neoplastic “stromal” cells of GCTB which can be used to identify novel therapeutic targets as well as to better understand tumor biology in GCTB. Our study identified HDAC inhibitors as a potential therapeutic option to eliminate the neoplastic cells from GCTB lesions, although further studies should be performed to elucidate the mechanisms underlying HDAC inhibitor sensitivity in GCTB. Nevertheless, the identification of such therapeutic strategies is an important step towards the treatment of patients with unresectable or recurrent tumors who currently rely on life-long treatment with denosumab.
Acknowledgments
The authors thank Danielle de Jong, Pauline M. Wijers-Koster, and Brendy E.W.M. van den Akker for technical assistance.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/cancers14194708/s1 , Table S1: Clinical information of patient samples that were used to establish cell lines of neoplastic “stromal” cells, Table S2: STR profiles of corresponding primary tumor tissues and established cell lines, Table S3: Detailed list of all compounds included in the epigenetics compound library (L1900, Selleckchem), Figure S1: Original tumor of L4040 was diagnosed as GCTB with atypia, Figure S2: Established cell lines show RNA expression of H3F3A-WT and H3F3A p.G34W, and Figure S3: Original blots from all performed Western blots.
Click here for additional data file.
Author Contributions
Resources, P.C.W.H., M.A.J.v.d.S. and H.G.; Conceptualization, S.V., I.P., P.C.W.H., J.V.M.G.B. and K.S.; Methodology, S.V., I.P., J.V.M.G.B. and K.S.; Project administration, S.V.; Investigation, S.V., R.v.E., A.B.K., I.P., A.E.T. and I.H.B.-d.B.; Data curation, H.M.; Formal analysis, S.V. and H.M.; Validation, S.V.; Visualization, S.V.; Supervision, J.V.M.G.B. and K.S.; Funding Acquisition, H.G., J.V.M.G.B. and K.S.; Writing—Original draft, S.V. and K.S.; Writing—Review and editing, S.V., R.v.E., A.B.K., I.P., A.E.T., I.H.B.-d.B., P.C.W.H., M.A.J.v.d.S., H.G., H.M., J.V.M.G.B. and K.S. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Ethical review and approval were waived for this study, a waiver of consent was obtained from the medical ethical evaluation committee (protocol number: B20.012). All specimens in this study were handled according to the ethical guidelines described in ‘Code for Proper Secondary Use of Human Tissue in The Netherlands’ of the Dutch Federation of Medical Scientific Societies.
Informed Consent Statement
Patient consent was waived according to ‘Code for Proper Secondary Use of Human Tissue in The Netherlands’.
Data Availability Statement
The manuscript and supplementary files contain all potential findings based on raw data analysis. The RNA sequencing dataset was deposited in the European Genome-phenome Archive (EGA) under accession number EGAS00001006441. Other raw data are available from the corresponding author on reasonable request.
Conflicts of Interest
The authors declare no conflict of interest.
References
1. Flanagan A.M. Larousserie F. O’Donnell P.G. Yoshida A. Giant Cell Tumour of Bone WHO Classification of Tumours–Soft Tissue and Bone Tumours WHO Classification of Tumours Editorial Board IARC Press Lyon, France 2020 440 446
2. Van der Heijden L. Dijkstra P.D.S. van de Sande M.A.J. Kroep J.R. Nout R.A. van Rijswijk C.S.P. Bovee J.V.M.G. Hogendoorn P.C.W. Gelderblom H. The Clinical Approach Toward Giant Cell Tumor of Bone Oncologist 2014 19 550 561 10.1634/theoncologist.2013-0432 24718514 PMC4012970
3. Lieveld M. Bodson E. De Boeck G. Nouman B. Cleton-Jansen A.M. Korsching E. Benassi M.S. Picci P. Sys G. Poffyn B. Gene Expression Profiling of Giant Cell Tumor of Bone Reveals Downregulation of Extracellular Matrix Components Decorin and Lumican Associated with Lung Metastasis Virchows Arch. 2014 465 703 713 10.1007/s00428-014-1666-7 25304290
4. Forsyth R.G. De Boeck G. Baelde J.J. Taminiau A.H.M. Uyttendaele D. Roels H. Praet M.M. Hogendoorn P.C.W. CD33+ CD14- Phenotype Is Characteristic of Multinuclear Osteoclast-like Cells in Giant Cell Tumor of Bone J. Bone Miner. Res. 2009 24 70 77 10.1359/jbmr.080905 18767926
5. Liao T.S. Yurgelun M.B. Chang S.S. Zhang H.Z. Murakami K. Blaine T.A. Parisien M.V. Kim W. Winchester R.J. Lee F.Y.I. Recruitment of Osteoclast Precursors by Stromal Cell Derived Factor-1 (SDF-1) in Giant Cell Tumor of Bone J. Orthop. Res. 2005 23 203 209 10.1016/j.orthres.2004.06.018 15607894
6. Maggiani F. Forsyth R. Hogendoorn P.C.W. Krenacs T. Athanasou N.A. The Immunophenotype of Osteoclasts and Macrophage Polykaryons J. Clin. Pathol. 2011 64 701 705 10.1136/jcp.2011.090852 21561891
7. Roux S. Amazit L. Meduri G. Guiochon-Mantel A. Milgrom E. Mariette X. RANK (Receptor Activator of Nuclear Factor Kappa B) and RANK Ligand Are Expressed in Giant Cell Tumors of Bone Am. J. Clin. Pathol. 2002 117 210 216 10.1309/BPET-F2PE-P2BD-J3P3 11863217
8. Behjati S. Tarpey P.S. Presneau N. Scheipl S. Pillay N. Van Loo P. Wedge D.C. Cooke S.L. Gundem G. Davies H. Distinct H3F3A and H3F3B Driver Mutations Define Chondroblastoma and Giant Cell Tumor of Bone Nat. Genet. 2013 45 1479 1482 10.1038/ng.2814 24162739 PMC3839851
9. Cleven A.H.G. Höcker S. Briaire-De Bruijn I. Szuhai K. Cleton-Jansen A.M. Bovée J.V.M.G. Mutation Analysis of H3F3A and H3F3B as a Diagnostic Tool for Giant Cell Tumor of Bone and Chondroblastoma Am. J. Surg. Pathol. 2015 39 1576 1583 10.1097/PAS.0000000000000512 26457357
10. Presneau N. Baumhoer D. Behjati S. Pillay N. Tarpey P. Campbell P.J. Jundt G. Hamoudi R. Wedge D.C. Van Loo P. Diagnostic Value of H3F3A Mutations in Giant Cell Tumour of Bone Compared to Osteoclast-Rich Mimics J. Pathol. Clin. Res. 2015 1 113 123 10.1002/cjp2.13 27499898 PMC4858131
11. Lübbehüsen C. Lüke J. Seeling C. Mellert K. Marienfeld R. von Baer A. Schultheiss M. Möller P. Barth T.F.E. Characterization of Three Novel H3F3A-Mutated Giant Cell Tumor Cell Lines and Targeting of Their Wee1 Pathway Sci. Rep. 2019 9 6458 10.1038/s41598-019-42611-1 31015476 PMC6478864
12. Fellenberg J. Sähr H. Mancarella D. Plass C. Lindroth A.M. Westhauser F. Lehner B. Ewerbeck V. Knock-down of Oncohistone H3F3A-G34W Counteracts the Neoplastic Phenotype of Giant Cell Tumor of Bone Derived Stromal Cells Cancer Lett. 2019 448 61 69 10.1016/j.canlet.2019.02.001 30742944
13. Khazaei S. De Jay N. Deshmukh S. Hendrikse L.D. Jawhar W. Chen C.C. Mikael L.G. Faury D. Marchione D.M. Lanoix J. H3.3 G34w Promotes Growth and Impedes Differentiation of Osteoblast-like Mesenchymal Progenitors in Giant Cell Tumor of Bone Cancer Discov. 2020 10 1968 1987 10.1158/2159-8290.CD-20-0461 32967858 PMC7710565
14. Forsyth R.G. Krenács T. Athanasou N. Hogendoorn P.C.W. Cell Biology of Giant Cell Tumour of Bone: Crosstalk between m/Wt Nucleosome H3.3, Telomeres and Osteoclastogenesis Cancers 2021 13 5119 10.3390/cancers13205119 34680268 PMC8534144
15. Shi L. Shi J. Shi X. Li W. Wen H. Histone H3.3 G34 Mutations Alter Histone H3K36 and H3K27 Methylation in Cis J. Mol. Biol. 2018 430 1562 1565 10.1016/j.jmb.2018.04.014 29689253 PMC6450091
16. Lutsik P. Baude A. Mancarella D. Oez S. Kuehn A. Toth R. Hey J. Toprak U. Lim J. Nguyen V.H. Globally Altered Epigenetic Landscape and Delayed Osteogenic Differentiation in H3.3-G34W-Mutant Giant Cell Tumor of Bone Nat. Commun. 2020 11 5414 10.1038/s41467-020-18955-y 33110075 PMC7591516
17. Jain S.U. Khazaei S. Marchione D.M. Lundgren S.M. Wang X. Weinberg D.N. Deshmukh S. Juretic N. Lu C. David Allis C. Histone H3.3 G34 Mutations Promote Aberrant PRC2 Activity and Drive Tumor Progression Proc. Natl. Acad. Sci. USA 2020 117 27354 27364 10.1073/pnas.2006076117 33067396 PMC7959516
18. Hemingway F. Kashima T.G. Mahendra G. Dhongre A. Hogendoorn P.C.W. Mertens F. Athanasou N.A. Smooth Muscle Actin Expression in Primary Bone Tumours Virchows Arch. 2012 460 525 534 10.1007/s00428-012-1235-x 22543453
19. Balke M. Campanacci L. Gebert C. Picci P. Gibbons M. Taylor R. Hogendoorn P. Kroep J. Wass J. Athanasou N. Bisphosphonate Treatment of Aggressive Primary, Recurrent and Metastatic Giant Cell Tumour of Bone BMC Cancer 2010 10 462 10.1186/1471-2407-10-462 20799989 PMC2940802
20. Lipplaa A. Kroep J.R. van der Heijden L. Jutte P.C. Hogendoorn P.C.W. Dijkstra S. Gelderblom H. Adjuvant Zoledronic Acid in High-Risk Giant Cell Tumor of Bone: A Multicenter Randomized Phase II Trial Oncologist 2019 24 889-e421 10.1634/theoncologist.2019-0280 31040253 PMC6656477
21. Van der Heijden L. Dijkstra S. van de Sande M. Gelderblom H. Current Concepts in the Treatment of Giant Cell Tumour of Bone Curr. Opin. Oncol. 2020 32 332 338 10.1097/CCO.0000000000000645 32541321
22. Yang L. Zhang H. Zhang X. Tang Y. Wu Z. Wang Y. Huang H. Fu X. Liu J. Hogendoorn P.C.W. Clinicopathologic and Molecular Features of Denosumab-Treated Giant Cell Tumour of Bone (GCTB): Analysis of 21 Cases Ann. Diagn. Pathol. 2022 57 151882 10.1016/j.anndiagpath.2021.151882 34995868
23. Hafner M. Niepel M. Chung M. Sorger P.K. Growth Rate Inhibition Metrics Correct for Confounders in Measuring Sensitivity to Cancer Drugs Nat. Methods 2016 13 521 527 10.1038/nmeth.3853 27135972 PMC4887336
24. Franceschini N. Oosting J. Tamsma M. Niessen B. De Bruijn I.B. van den Akker B. Kruisselbrink A.B. Palubeckaitė I. Bovée J.V.M.G. Cleton-jansen A.M. Targeting the Nad Salvage Synthesis Pathway as a Novel Therapeutic Strategy for Osteosarcomas with Low Naprt Expression Int. J. Mol. Sci. 2021 22 6273 10.3390/ijms22126273 34200964 PMC8230647
25. Venneker S. Kruisselbrink A.B. Briaire-de Bruijn I.H. de Jong Y. van Wijnen A.J. Danen E.H.J. Bovée J.V.M.G. Inhibition of PARP Sensitizes Chondrosarcoma Cell Lines to Chemo- and Radiotherapy Irrespective of the IDH1 or IDH2 Mutation Status Cancers 2019 11 1918 10.3390/cancers11121918 PMC6966531 31810230
26. Balke M. Neumann A. Szuhai K. Agelopoulos K. August C. Gosheger G. Hogendoorn P.C.W. Athanasou N. Buerger H. Hagedorn M. A Short-Term in Vivo Model for Giant Cell Tumor of Bone BMC Cancer 2011 11 241 10.1186/1471-2407-11-241 21668953 PMC3125284
27. Noguchi R. Yoshimatsu Y. Ono T. Sei A. Hirabayashi K. Ozawa I. Kikuta K. Kondo T. Establishment and Characterization of NCC-GCTB1-C1: A Novel Patient-Derived Cancer Cell Line of Giant Cell Tumor of Bone Hum. Cell 2020 33 1321 1328 10.1007/s13577-020-00415-w 32815117
28. Yoshimatsu Y. Noguchi R. Tsuchiya R. Ono T. Sin Y. Akane S. Sugaya J. Mori T. Fukushima S. Yoshida A. Establishment and Characterization of Novel Patient-Derived Cell Lines from Giant Cell Tumor of Bone Hum. Cell 2021 34 1899 1910 10.1007/s13577-021-00579-z 34304386
29. Ono T. Noguchi R. Yoshimatsu Y. Tsuchiya R. Sin Y. Nakagawa R. Hirabayashi K. Ozawa I. Kikuta K. Kondo T. Establishment and Characterization of the NCC-GCTB4-C1 Cell Line: A Novel Patient-Derived Cell Line from Giant Cell Tumor of Bone Hum. Cell 2022 35 392 399 10.1007/s13577-021-00639-4 34731453
30. Mahdal M. Neradil J. Mudry P. Paukovcekova S. Zambo I.S. Urban J. Macsek P. Pazourek L. Tomas T. Veselska R. New Target for Precision Medicine Treatment of Giant-Cell Tumor of Bone: Sunitinib Is Effective in the Treatment of Neoplastic Stromal Cells with Activated PDGFRβ Signaling Cancers 2021 13 3543 10.3390/cancers13143543 34298757 PMC8305892
31. Bradley E.W. Carpio L.R. van Wijnen A.J. McGee-Lawrence M.E. Westendorf J.J. Histone Deacetylases in Bone Development and Skeletal Disorders Physiol. Rev. 2015 95 1359 1381 10.1152/physrev.00004.2015 26378079 PMC4600951
32. Obri A. Makinistoglu M.P. Zhang H. Karsenty G. HDAC4 Integrates PTH and Sympathetic Signaling in Osteoblasts J. Cell Biol. 2014 205 771 780 10.1083/jcb.201403138 24934156 PMC4068141
33. Yafei J. Haoran M. Wenyan J. Linghang X. Kai T. Gangyang W. Zhuoying W. Jing H. Mengkai Y. Yujie T. Personalized Medicine Modality Based on Patient-Derived Xenografts from a Malignant Transformed GCTB Harboring H3F3A G34W Mutation J. Orthop. Transl. 2021 29 106 112 10.1016/j.jot.2021.04.004 34136349 PMC8173097
34. Van Veggel M. Westerman E. Hamberg P. Clinical Pharmacokinetics and Pharmacodynamics of Panobinostat Clin. Pharmacokinet. 2018 57 21 29 10.1007/s40262-017-0565-x 28667459
35. Woo S. Gardner E.R. Chen X. Ockers S.B. Baum C.E. Sissung T.M. Price D.K. Frye R. Piekarz R.L. Bates S.E. Population Pharmacokinetics of Romidepsin in Patients with Cutaneous T-Cell Lymphoma and Relapsed Peripheral T-Cell Lymphoma Clin. Cancer Res. 2009 15 1496 1503 10.1158/1078-0432.CCR-08-1215 19228751 PMC2707030
36. Subramanian S. Bates S.E. Wright J.J. Espinoza-Delgado I. Piekarz R.L. Clinical Toxicities of Histone Deacetylase Inhibitors Pharmaceuticals 2010 3 2751 2767 10.3390/ph3092751 27713375 PMC4034096
37. Kumta S.M. Huang L. Cheng Y.Y. Chow L.T.C. Lee K.M. Zheng M.H. Expression of VEGF and MMP-9 in Giant Cell Tumor of Bone and Other Osteolytic Lesions Life Sci. 2003 73 1427 1436 10.1016/S0024-3205(03)00434-X 12850503
38. De Vita A. Vanni S. Miserocchi G. Fausti V. Pieri F. Spadazzi C. Cocchi C. Liverani C. Calabrese C. Casadei R. A Rationale for the Activity of Bone Target Therapy and Tyrosine Kinase Inhibitor Combination in Giant Cell Tumor of Bone and Desmoplastic Fibroma: Translational Evidences Biomedicines 2022 10 372 10.3390/biomedicines10020372 35203581 PMC8962296
39. Gaspar N. Venkatramani R. Hecker-Nolting S. Melcon S.G. Locatelli F. Bautista F. Longhi A. Lervat C. Entz-Werle N. Casanova M. Lenvatinib with Etoposide plus Ifosfamide in Patients with Refractory or Relapsed Osteosarcoma (ITCC-050): A Multicentre, Open-Label, Multicohort, Phase 1/2 Study Lancet Oncol. 2021 22 1312 1321 10.1016/S1470-2045(21)00387-9 34416158