Introduction
Multiple myeloma (MM) is an aggressive B-cell malignancy characterized by the clonal expansion and accumulation of malignant plasma cells within the bone marrow (BM). 1 , 2 MM cell growth and survival relies heavily on the BM microenvironment, which provides a protective niche that promotes proliferation and confers resistance to apoptosis. Although major therapeutic advances over the past 2 decades, including immunomodulatory drugs, proteasome inhibitors, and monoclonal antibodies targeting SLAMF7 (signaling lymphocyte activation molecule family member 7) and CD38, have improved outcomes, MM remains incurable, and most patients eventually experience disease relapse and develop treatment resistance. 3 , 4 , 5 , 6 , 7 , 8 More effective therapies for relapsed/refractory MM (RRMM) are therefore still needed.
B-cell maturation antigen (BCMA), which is highly expressed on MM cells, has emerged as a key therapeutic target. 9 , 10 , 11 As a member of the tumor necrosis factor (TNF) receptor (TNFR) superfamily, BCMA mediates prosurvival and proliferative signaling downstream of B-cell activating factor (BAFF) and a proliferation-inducing ligand (APRIL), 2 cytokines that support MM cell growth and survival in the BM niche. 12 , 13 Several BCMA-targeted immunotherapies have been approved for RRMM, including antibody-drug conjugates, 14 chimeric antigen receptor (CAR) T-cell (CAR-T) therapy, 10 and bispecific antibodies (bsAbs). 15 , 16 Notably, ciltacabtagene autoleucel and idecabtagene vicleucel were approved in 2021 and 2022, respectively, and teclistamab, a BCMA-targeted T-cell–redirecting bsAb, received accelerated approval in 2022. 15 These therapies have demonstrated impressive efficacy in patients with heavily pretreated RRMM. 16 , 17
Despite these successes, BCMA-targeted immunotherapies have important limitations. Relapse can occur even after initial response, often because of antigen escape through BCMA downregulation or loss. 18 Proposed mechanisms include the expansion of MM subclones with low or absent surface BCMA, proteolytic cleavage of BCMA by γ-secretase, 19 and irreversible genetic loss of BCMA gene. 19 , 20 , 21 , 22 , 23 BCMA shedding also creates a circulating antigen sink that may reduce therapeutic activity. 19 Additionally, safety concerns have emerged, with some patients treated with ciltacabtagene autoleucel having developed parkinsonian symptoms, potentially resulting from off-tumor targeting of BCMA in the basal ganglia. 24 , 25 These challenges underscore the need for alternative or complementary strategies to overcome the limitations of BCMA-targeted therapies for MM.
Several T-cell–redirecting bsAbs have therefore been developed against alternative MM antigens, including G protein-coupled receptor class C group 5 member D (GPRC5D), 26 Fc receptor-homolog 5, 27 CD38, 28 , 29 and SLAMF7. 28 , 29 However, resistance to these newer therapies still occurs. For instance, some patients treated with GPRC5D-targeted bsAb talquetamab developed downregulation or loss of GPRC5D on MM cells. 30 Given the adaptability of MM under immunotherapeutic pressure, no single antigen-targeted strategy is likely to be universally effective. Expanding the therapeutic arsenal to include immunotherapies targeting a broader range of MM-associated antigens is therefore essential for overcoming resistance and improving outcomes in RRMM.
TACI (transmembrane activator and calcium-modulator and cyclophilin ligand [CAML] interactor), a close family member of BCMA, is also a receptor for BAFF and APRIL and supports MM cell survival and growth. 31 , 32 This makes TACI a compelling alternative target in MM. 11 CAR-T therapies using the APRIL receptor–binding domain have shown in vitro cytotoxicity against MM cells even under anti-BCMA blockade, supporting the feasibility of targeting TACI. 33 However, these approaches have not achieved robust clinical efficacy, likely due to suboptimal binder design. 34 , 35 Moreover, the complexity, high cost, and individualized nature of CAR-T manufacturing limit accessibility and timely clinical application.
Here, we engineered a TACI × CD3 bsAb that redirects T cells to target MM cells. This bsAbs induces robust T-cell activation, proliferation, and potent cytotoxicity against MM cells. Notably, it remains highly effective against MM cells with low BCMA expression that were resistant to BCMA-targeted bsAbs, and it also exhibited effective cytotoxicity against primary MM cells from patients. Collectively, these findings suggest that TACI × CD3 bsAb represents a promising therapeutic strategy to overcome BCMA escape in MM.
Methods
Cell lines and plasmids
Human embryonic kidney (HEK) 293T cells, Jurkat T cells, and human MM cell lines H929 and LP-1 were purchased from American Type Culture Collection. KMS-11 was purchased from the Japanese Collection of Research Bioresources cell bank (Japan). All the cell lines were cultured as described previously. 36 The human TACI (hTACI)-HEK293T cells were generated using lentivirus.
Antibody production and purification
Balb/c mice (InVivos, Singapore) were immunized with DNA plasmids via hydrodynamic tail vein injection and hybridomas were generated as described previously. 36 Anti-hTACI antibody–producing clones were screened by flow cytometry using hTACI-HEK293T cells and subcloned. The genes encoding the variable region of the immunoglobulin heavy and light chains were amplified by polymerase chain reaction and sequenced. The TACI × CD3 bsAb expression vector was constructed in a Fab–single-chain variable fragment (scFv) knob-into-hole (KiH) format using the CH3 KiH design. The TACI × CD3 bsAb was then produced in fed-batch culture and purified, followed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and Coomassie blue staining analysis. 36
Antigen binding assay
Binding of the TACI × CD3 bsAb to CD3 and TACI was assessed by flow cytometry using Jurkat T and hTACI-HEK293T cells, respectively. Data were acquired on an LSR II flow cytometer (BD Biosciences) and analyzed with FlowJo version 10.7 software (BD Biosciences).
Examination of TACI expression in the MM cell lines and primary MM cells
Cell surface expression of TACI in a panel of MM cell lines was measured by flow cytometry and quantified using QIFIKIT (Agilent; catalog no. K007811-8) according to the manufacturer’s instructions.
For primary MM samples, frozen BM specimens from patients with MM were thawed and stained with anti-TACI antibody together with anti-CD138 and anti-CD19 antibodies to identify MM and B cells, respectively, followed by flow cytometric analysis.
In vitro T-cell proliferation and activation
Human peripheral blood mononuclear cells were prepared from healthy donors using Ficoll-Paque PLUS (Cytiva). 36 Total T cells were isolated using pan–T cell isolation kit (Miltenyi Biotech, Germany), according to the manufacturer’s instructions.
To measure proliferation, T cells were first labeled with CellTrace Violet dye (BD Biosciences), as previously described, 36 and cocultured with KMS-11 cells in the presence of the indicated concentrations of TACI × CD3 bsAb for 72 hours at 37°C. Cells were then collected and stained with anti-human CD4 (BD Biosciences; SK3) and CD8 (BD Biosciences; SK1) antibodies for flow cytometric analysis. Division index was analyzed with FlowJo version 10.7 software.
To assess activation, T cells were cocultured with KMS-11 cells in the presence of the indicated concentrations of TACI × CD3 bsAb for 48 hours, and the expression of CD25 and CD69 was measured by flow cytometry. For the T-cell degranulation assay, T cells were cocultured with KMS-11 cells in the presence of BCMA × CD3 or TACI × CD3 bsAb for 4 hours, together with phycoerythrin-conjugated anti-CD107a (BioLegend, 328608). Golgi stop and Golgi plug were added after 1 hour of coculture.
Generation of BCMA KD MM cells
BCMA-knockdown (BCMA KD ) KMS11 cell lines were generated using CRISPR-CRISPR–associated protein 9 (Cas9)–mediated gene editing. A guide RNA targeting TNFRSF17 exon 1 (sequence: TAACGCTGACATGTTAGAGG) was synthesized as CRISPR RNA (Integrated DNA Technologies), annealed with transactivating CRISPR RNA, and complexed with Cas9 nuclease to form ribonucleoprotein complexes, which were delivered into KMS11 cells by electroporation using the Lonza 4D-X system with the SF cell line kit. BCMA KD was confirmed by polymerase chain reaction amplification and by flow cytometry.
Cytotoxicity against MM cell lines
For the MM cell lines without the luciferase (Luc) transgene, cells were first labeled with CellTrace Violet dye and cocultured in duplicates with purified T cells in the presence of the TACI × CD3 bsAb. After 48 hours, the cells were collected, stained with Fix Viability Dye 510, and analyzed by flow cytometry. For the MM cell lines expressing the Luc transgene, MM cells and purified T cells were cocultured in duplicate, and the percentage of MM cell killing by T cells was determined, as previously described, 36 as follows:
Cytokine measurement by ELISA
KMS-11 cells and purified T cells were cocultured at an effector-to-target ratio of 1:1 in the presence of indicated concentrations of TACI × CD3 bsAb. After 48 hours, culture supernatants were collected and analyzed for T-cell–secreted cytokines, including interferon gamma (IFN-γ), interleukin-2 (IL-2), granulocyte-macrophage colony-stimulating factor (GM-CSF), and TNF-α, by the enzyme-linked immunosorbent assay (ELISA) using human cytokine detection kits (BioLegend, San Diego, CA).
MM xenograft model and treatment with bsAb
Female NSG mice (NOD.Cg- Prkdc scid Il2rg tm1Wjl /SzJ; InVivos, Singapore), 6 to 8 weeks old, were injected IV with 2 × 10 6 BCMA wild type (BCMA WT )-KMS-11-Luc or BCMA KD -KMS-11-Luc cells. Two weeks later, mice were randomized into control and treatment groups and infused with 2 × 10 6 purified human T cells. The treatment group received bsAb (0.15 mg/kg, IV) every other day as indicated in the treatment schedule.
Bioluminescence imaging
Bioluminescence emitted by MM cells in mice was measured using the IVIS Spectrum in vivo imaging system (PerkinElmer). Mice were anaesthetized and injected intraperitoneally with 150 mg/kg VivoGlo Luciferin (Promega). Signal intensity was quantified using the Living Image software (PerkinElmer), and the sum of photon counts from ventral images was determined.
Detection of TACI × CD3 bsAb–induced T-MM cell doublets
KMS-11–green fluorescent protein (GFP; 1 × 10 5 cells) and T cells (1 × 10 5 cells) labeled with Cell Tracker Violet were cocultured in at 37°C for 15 minutes in the presence of 3 μg/mL bsAb. The cells were then washed on ice to remove unbound TACI × CD3 bsAb, and the frequency of T–KMS-11 cell doublets was determined by flow cytometry.
Confocal microscopy of the immune synapse
KMS-11-GFP and T cells were cocultured in a V-bottom well plate at 37°C for 45 minutes in the presence of 3 μg/mL TACI × CD3 bsAb. Cells were then fixed with 4% paraformaldehyde for 30 minutes and stained with fluorophore-conjugated antibodies against actin and Granzyme B in the dark for 1 hour at room temperature or overnight at 4°C. 36 Images were acquired using an Olympus FV3000 confocal microscope (Olympus, Japan).
Assessment of the cytotoxicity of TACI × CD3 bsAb against primary MM cells
Frozen BM samples from patients with MM were thawed and cultured in RPMI 1640 supplemented with 1% penicillin/streptomycin, and 1% l -glutamine containing 10% human serum and 3 ng/mL of human IL-6, in the presence of varying concentration of TACI × CD3 bsAb. After 46 hours, the cells were collected, stained with fluorophore-conjugated antibodies, and analyzed by flow cytometry. Flow-Count fluorospheres (Beckman Coulter; catalog no. 7547053) were used to determine the number of live CD138 + MM cells for calculating the percentage of MM cell lysis:
The percentage of primary MM cell lysis was calculated by the following formula:
Statistical analysis
Statistical analyses were performed using Prism 7 (GraphPad Software). Comparisons between groups were made using a 2-sided independent Student t test. A P value of <.05 was considered statistically significant (∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001; ∗∗∗∗ P < .0001).
Animal research
All animal experiments were conducted according to the guidelines approved by the institutional animal care and use committee of the Agency for Science, Technology, and Research.
Ethics and consent statement
The use of peripheral blood mononuclear cells from healthy donors was approved by the SingHealth centralized institutional review board exemption (reference: 2017/2471). Deidentified human blood was collected in accordance with Health Sciences Authority (HSA) Residual Blood Samples for Research, project titled “Harnessing immune response for new therapies in transplantation and cancer” (HSA study reference number 201306-04; and Agency for Science, Technology, and Research institutional review board reference number 2024-133).
Results
BCMA-low MM cells are resistant to BCMA × CD3 bsAb–mediated cytotoxicity
In patients with MM, BCMA downregulation is a major cause of relapse after BCMA-targeted immunotherapies. 21 , 22 , 23 To model clinical relapse due to BCMA loss, we generated a BCMA KD KMS11 cell line using CRISPR/Cas9 gene editing. Flow cytometry showed approximately threefold lower BCMA surface expression in BCMA KD vs BCMA WT KMS-11 cells ( supplemental Figure 1 ).
Next, we treated both BCMA WT and BCMA KD KMS-11 cells with a BCMA × CD3 bsAb that we had developed previously. 36 Although the bsAb induced nearly 100% specific lysis against BCMA WT cells at 0.3nM, with an 50% effective dose (EC 50 ) of ∼0.03nM, it achieved only ∼30% lysis of BCMA KD cells at even 10nM ( Figure 1 B). Consistently, the bsAb induced little upregulation of CD107a, a surrogate marker of degranulation, in T cells cocultured with BCMA KD cells, at 10nM. In contrast, it induced significant CD107a upregulation in both CD4 + and CD8 + T cells cocultured with BCMA WT cells at as low as 0.03nM ( Figure 1 C). Additionally, the bsAb induced limited upregulation of activation markers CD25 and CD69 on T cells in the presence of BCMA KD cells compared with BCMA WT cells ( Figure 1 D-E). These results suggest that BCMA × CD3 bsAb is inefficacious in activating T cells and eliminating MM cells with reduced BCMA expression.
Engineering a TACI-targeted T-cell–redirecting TACI × CD3 bsAb
To address resistance in MM cells with reduced BCMA, we searched for alternative targets by reanalyzing Human Protein Atlas data ( https://www.proteinatlas.org ). We found TACI to be one of the most significantly upregulated proteins in MM samples compared with healthy controls ( Figure 2 A). Furthermore, we detected TACI expression on the cell surface of a panel of MM cells ( Figure 2 B). This is consistent with previous reports showing that TACI supports MM cell growth and survival, 37 , 38 supporting its potential as an alternative immunotherapeutic target to BCMA.
We proceeded to develop a TACI × CD3 T-cell–redirecting bsAb using the same strategy previously used for generating the BCMA × CD3 bsAb 36 ( Figure 2 C). A mouse anti-human TACI monoclonal antibody obtained was used to engineer the TACI × CD3 bsAb using a Fab-scFv–KiH format, and the antibody was purified as previously described. 36 , 39 Sodium dodecyl sulfate–polyacrylamide gel electrophoresis with Coomassie staining confirmed bsAb integrity, showing expected bands of ∼52 kDa (scFv-Fc), 50 kDa (heavy chain), and 25 kDa (light chain) under reducing conditions, and a predominant ∼127 kDa band under nonreducing conditions ( Figure 2 D). Size-exclusion high-performance liquid chromatography confirmed >90% purity ( Figure 2 E).
To evaluate antigen specificity, we used flow cytometry to assess bsAb-binding to hTACI-HEK293T cells ( Figure 2 F) and Jurkat T cells ( Figure 2 G). The bsAb bound TACI on hTACI-HEK293T cells in a dose-dependent manner from 1nM, with negligible binding to parental cells. Similarly, it bound CD3 on Jurkat cells above 0.3nM but showed no binding to CD3 − K562 cells at even 10nM. These results confirm that the TACI × CD3 bsAb retains integrity and dual binding specificity for TACI and CD3.
TACI × CD3 bsAb induces potent T-cell cytotoxicity and activation in vitro
We next assessed the bsAb-mediated T-cell cytotoxicity against MM cells. Using Luc-expressing KMS-11 (KMS-11-Luc) cells, coculture with human T cells at ab effector-to-target ratio of 1:1 showed dose-dependent killing, reaching ∼100% lysis at ∼0.3nM, with an EC 50 of ∼0.11nM ( Figure 3 A). The bsAb also induced effective lysis of RPMI 8226 and LP-1 cells, which express lower levels of surface TACI (3889 and 2994 molecules per cell; Figure 2 B), with EC 50 values of 0.056nM and 0.262nM, respectively ( Figure 3 A). Notably, KMS-11 cells were completely lysed, whereas RPMI 8226 showed reduced lysis and LP-1 displayed high baseline lysis, likely reflecting differences in TACI expression. These results demonstrate that TACI × CD3 bsAb efficiently and selectively induces T-cell cytotoxicity against TACI + MM cells in vitro.
To assessed T-cell activation and proliferation induced by the bsAb, T cells were cocultured with KMS-11 cells for 48 hours with varying concentrations of bsAb, and activation markers CD25 and CD69 were measured on CD4 + and CD8 + T-cell subsets ( Figure 3 B). The TACI × CD3 bsAb induced a dose-dependent upregulation of both markers, plateauing at ∼10nM. We further evaluated the ability of the TACI × CD3 bsAb to promote T-cell expansion. CellTrace Violet–based proliferation assays revealed that the bsAb elicited a robust, concentration-dependent T-cell expansion, starting at 0.3nM ( Figure 3 C). In parallel, ELISA showed that the TACI × CD3 bsAb induced robust production of cytokines, including IFN-γ, IL-2, GM-CSF, and TNF-α, beginning at 0.3nM; IFN-γ and GM-CSF secretion peaked at ∼30 ng/mL and ∼10 ng/mL, respectively, at 1nM ( Figure 3 D).
Together, these findings demonstrate that the bsAb potently drives T-cell activation, proliferation, and cytokine production in vitro.
TACI × CD3 bsAb facilitates immunological synapse formation
BsAb-mediated killing of tumor cells by T or natural killer cells depends on immunological synapse (IS) formation, which enable the directed release of cytolytic granules into tumor cells. 36 We therefore assessed whether the TACI × CD3 bsAb could promote IS formation. 36 , 40 Flow cytometry showed that the bsAb significantly increased T-cell–MM conjugates (Violet + GFP + doublets) between T cells and GFP-expressing KMS-11 cells, compared with controls ( Figure 4 A). Consistent with this, bsAb treatment markedly increased phosphorylation of lymphocyte-specific protein tyrosine kinase, a key initiator of TCR signaling, within 15 minutes ( Figure 4 B). Confocal microscopy further revealed accumulation of F-actin and Granzyme B at the T-cell–KMS-11 interface, consistent with classical IS architecture ( Figure 4 C). Together, these findings demonstrate that TACI × CD3 bsAb effectively promotes functional IS formation, thereby triggering T-cell activation and cytotoxicity against MM cells.
TACI × CD3 bsAb effectively suppresses MM cell growth in vivo
We next evaluated the therapeutic potential of the TACI × CD3 bsAb in vivo using an MM xenograft model. NSG mice were injected with 2 × 10 6 KMS-11-Luc cells and, after tumor engraftment, received adoptive transfer of human T cells with or without TACI × CD3 bsAb treatment ( Figure 5 A). Tumor progression was monitored weekly using in vivo bioluminescence imaging (IVIS Spectrum in vivo imaging system; PerkinElmer). In control mice, tumors expanded rapidly, reaching ∼10 10 photons per second (p/s) within 3 weeks. In contrast, bsAb-treated mice showed markedly suppressed tumor growth from the fourth dose onward, ( Figure 5 B), with a 100- to 1000-fold reduction in photon flux compared with controls ( Figure 5 C). Notably, tumor suppression persisted beyond treatment, with bsAb-treated mice maintaining low or declining signals during a 7-day treatment-free period to day 24, whereas controls continued to progress, and also with a longer 14-day treatment-free interval after the final dose ( Figure 5 B-C; supplemental Figure 2 ). These results demonstrate that TACI × CD3 bsAb effectively redirects T cells to eliminate MM cells in vivo and induce durable tumor suppression.
TACI × CD3 bsAb effectively targets MM cells with low BCMA expression
Because BCMA × CD3 bsAb failed to induce effective T-cell–mediated cytotoxicity against BCMA KD MM cells ( Figure 1 ), we examined whether the TACI × CD3 bsAb could overcome this resistance. Flow cytometry confirmed comparable TACI expression on BCMA WT and BCMA KD KMS-11 cells ( Figure 6 A). In coculture assays, the TACI × CD3 bsAb induced potent cytotoxicity against BCMA KD cells, achieving >70% lysis at 0.1nM and >90% at 1nM, whereas BCMA × CD3 bsAb produced only ∼25% lysis even at 100nM ( Figure 6 B). Consistently, BCMA × CD3 bsAb induced minimal degranulation against BCMA KD cells, even at high concentrations. In contrast, TACI × CD3 bsAb robustly upregulate CD107a from 0.01nM ( Figure 6 C). It also strongly upregulated CD25 and CD69 from 0.1nM, whereas BCMA × CD3 bsAb remained ineffective even at saturating doses ( Figure 6 D-E).
We next evaluated in vivo efficacy in an MM xenograft model established with BCMA KD KMS-11-Luc cells ( Figure 6 F). Consistent with the in vitro findings, BCMA × CD3 bsAb failed to control tumor growth, with bioluminescence increasing 10-fold after 4 doses (6.3 × 10 8 p/s), similar to that in untreated mice (5.8 × 10 8 p/s; Figure 6 G). In contrast, the TACI × CD3 bsAb markedly suppressed tumor growth and maintained stable tumor burden near pretreatment levels. Collectively, these findings demonstrate that the TACI × CD3 bsAb can effectively target MM cells that have undergone BCMA escape, supporting its potential as a therapeutic strategy for relapsed MM associated with BCMA loss.
TACI × CD3 bsAb exhibits cytotoxicity against primary MM cells
To assess the translational relevance of TACI × CD3 bsAb, we evaluated its cytotoxicity against primary MM cells from patients. Flow cytometry showed that CD138 + MM cells from patient BM samples expressed approximately threefold higher levels of TACI than CD19 + B cells from the same samples ( Figure 7 A-B).
Using thawed frozen BM cells cultured for 46 hours with increasing concentrations of TACI × CD3 bsAb, we found that the bsAb induced ∼30% lysis of CD138 + MM cells at 0.01nM and 0.1nM, increasing to ∼50% at 1nM; in 1 of 6 samples, lysis reached nearly 90% ( Figure 7 C,E). Consistent with this, the bsAb also induced dose-dependent upregulation of CD69 on CD8 + T cells ( Figure 7 D,F). Although variation in viable T-cell recovery after thawing likely contributed to intersample variability, these results demonstrate that TACI × CD3 bsAb exerts substantial cytotoxicity against primary MM cells.
Discussion
Here, we designed, produced, and characterized a T-cell–redirecting bsAb as an alternative strategy to address the limitation of BCMA-targeted immunotherapies in MM. BCMA downregulation or loss is a major mechanism of relapse in patients treated with BCMA-directed therapies, creating an unmet need for complementary targets. Our TACI × CD3 bsAb efficiently redirected T cells to lyse MM cells, including BCMA-low cells resistant to BCMA × CD3 bsAb, thereby demonstrating its potential to address BCMA escape.
In this study, the TACI × CD3 bsAb demonstrated significant antitumor activity in vitro, in vivo, and in primary MM samples from patients. It induced robust T-cell activation, proliferation, and cytokine production, and effective cytotoxicity against MM cells. Notably, it retained potent efficacy against BCMA KD MM cells, supporting its potential to overcome resistance associated with BCMA downregulation. In the MM xenograft model, the TACI × CD3 bsAb significantly suppressed tumor growth; however, its efficacy appeared somewhat reduced against BCMA KD MM compared with BCMA WT MM cells. A possible explanation is the intrinsically faster growth of BCMA KD cells, which we observed in both in vitro and in vivo settings, although this will require further investigation. Future patient-based studies will be needed to determine whether BCMA-low clones acquire a proliferative advantage during or after BCMA-targeted therapy. Importantly, the TACI × CD3 bsAb also induced cytotoxicity against primary MM cells and promoted CD8 + T-cell activation in patient-derived BM samples. Although the responses varied across specimens, likely contributed owing to interpatient heterogeneity and difference in the number and functional state of T cells recovered after thawing, these findings further strengthen the translational relevance of targeting TACI in MM.
TACI, along with BCMA and BAFF receptors, belong to the TNFR superfamily and binds BAFF and APRIL. Importantly, its expression is independent of BCMA. TACI expression persists in patient-derived BCMA-deficient samples, 41 and our CRISPR-Cas9 data confirmed that BCMA KD does not alter TACI levels, consistent with their distinct genomic loci. These findings highlight TACI as an attractive therapeutic target in MM, particularly after relapse after BCMA-targeted therapy. Consistent with this, previous studies have shown TACI-directed CAR-T therapy could overcome BCMA loss. 41 Compared with CAR-T therapy, which is costly, complex, and time-consuming, 42 antibody-based TACI-targeted approaches such as T-cell–redirecting bsAbs may offer a more practical and widely accessible modality.
Despite this promise, TACI expression across clinically relevant MM subsets remains incompletely defined. Although TACI has been reported in MM cell lines and primary patient samples, 38 , 43 its expression in primary myeloma cells with distinct genetic alterations has not been systematically characterized. It is also unknown whether TACI expression is retained in MM cells from patients with irreversible BCMA and/or GPRC5D loss. Addressing these questions will be important for strengthening the translational rationale for TACI-targeted immunotherapy, better define its therapeutic window, and inform the optimal clinical use of TACI-directed approaches. In particular, testing TACI × CD3 bsAb in samples from patients who experience disease relapsed after BCMA- or GPRC5D-directed immunotherapy will be highly informative.
More broadly, dual-targeting or multitargeting strategies are increasingly being explored to mitigate antigen escape. CAR-Ts targeting both BCMA and TACI have shown enhanced efficacy, 41 supporting the development of multispecific antibodies that simultaneously engage BCMA, TACI, and CD3 to provide broader target coverage and more durable disease control. TACI × CD3 bsAb may also have value as a bridging therapy, because bsAbs are increasingly used to control disease while patients await CAR-T manufacture and infusion. For example, talquetamab has been used to bridge patients awaiting BCMA CAR-T therapy. 44 Given its activity against MM cells, including those with reduced BCMA expression, TACI × CD3 bsAb may likewise represent a useful bridging option for patients planned for BCMA-directed CAR-T therapy.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Acknowledgment
This work was supported by the core fund of Singapore Immunology Network, Agency for Science, Technology and Research.
Authorship
Contribution: S.X. and K.-P.L. conceptualized the study; S.X. supervised the study; M.Z., W.F.L., J.H., H.L., K.-P.L., Y.Y., and S.X. developed the methodology; M.Z., W.F.L., J.H., E.Z.X.N., and H.L. performed the experiments; M.Z., W.F.L., and J.H. were responsible for analysis and visualization; S.H.M.T., S.D.M., M.O., C.S., and W.J.C. provided samples from patients with multiple myeloma; M.Z., J.H., and S.X. wrote the original draft; and all authors read and approved the final manuscript.
Footnotes
M.Z., W.F.L., and J.H. contributed equally to this study.
Original data are available from the corresponding authors, Shengli Xu ( xu_shengli@a-star.edu.sg ), Yuansheng Yang ( yang_yuansheng@a-star.edu.sg ), and Kong-Peng Lam ( lam_kong_peng@a-star.edu.sg ), on request.
The full-text version of this article contains a data supplement.
Contributor Information
Yuansheng Yang, Email: yang_yuansheng@a-star.edu.sg.
Kong-Peng Lam, Email: lam_kong_peng@a-star.edu.sg.
Shengli Xu, Email: xu_shengli@a-star.edu.sg.
Supplementary Material
Supplemental Figures
References
1. Dimopoulos MA, Richardson PG, Moreau P, Anderson KC. Current treatment landscape for relapsed and/or refractory multiple myeloma. Nat Rev Clin Oncol. 2015;12(1):42–54. doi: 10.1038/nrclinonc.2014.200.
2. Cerchione C, Usmani SZ, Stewart AK, et al. Gene expression profiling in multiple myeloma: redefining the paradigm of risk-adapted treatment. Front Oncol. 2022;12 doi: 10.3389/fonc.2022.820768.
3. Lonial S, Dimopoulos M, Palumbo A, et al. ELOQUENT-2 Investigators Elotuzumab therapy for relapsed or refractory multiple myeloma. N Engl J Med. 2015;373(7):621–631. doi: 10.1056/NEJMoa1505654.
4. Pazina T, James AM, MacFarlane AWT, et al. The anti-SLAMF7 antibody elotuzumab mediates NK cell activation through both CD16-dependent and -independent mechanisms. Oncoimmunology. 2017;6(9):e1339853. doi: 10.1080/2162402X.2017.1339853.
5. Palumbo A, Chanan-Khan A, Weisel K, et al. CASTOR Investigators Daratumumab, bortezomib, and dexamethasone for multiple myeloma. N Engl J Med. 2016;375(8):754–766. doi: 10.1056/NEJMoa1606038.
6. Stewart AK, Rajkumar SV, Dimopoulos MA, et al. ASPIRE Investigators Carfilzomib, lenalidomide, and dexamethasone for relapsed multiple myeloma. N Engl J Med. 2015;372(2):142–152. doi: 10.1056/NEJMoa1411321.
7. Moreau P, Kumar SK, San Miguel J, et al. Treatment of relapsed and refractory multiple myeloma: recommendations from the International Myeloma Working Group. Lancet Oncol. 2021;22(3):e105–e118. doi: 10.1016/S1470-2045(20)30756-7.
8. Sperling AS, Anderson KC. Facts and hopes in multiple myeloma immunotherapy. Clin Cancer Res. 2021;27(16):4468–4477. doi: 10.1158/1078-0432.CCR-20-3600.
9. Cho SF, Lin L, Xing L, et al. monoclonal antibody: a new treatment strategy against multiple myeloma. Antibodies (Basel) 2017;6(4) doi: 10.3390/antib6040018.
10. Cho SF, Xing L, Anderson KC, Tai YT. Promising antigens for the new frontier of targeted immunotherapy in multiple myeloma. Cancers (Basel) 2021;13(23) doi: 10.3390/cancers13236136.
11. Xu S, Lam KP. Transmembrane activator and CAML interactor (TACI): another potential target for immunotherapy of multiple myeloma? Cancers (Basel) 2020;12(4) doi: 10.3390/cancers12041045.
12. Tai YT, Acharya C, An G, et al. APRIL and BCMA promote human multiple myeloma growth and immunosuppression in the bone marrow microenvironment. Blood. 2016;127(25):3225–3236. doi: 10.1182/blood-2016-01-691162.
13. Day ES, Cachero TG, Qian F, et al. Selectivity of BAFF/BLyS and APRIL for binding to the TNF family receptors BAFFR/BR3 and BCMA. Biochemistry. 2005;44(6):1919–1931. doi: 10.1021/bi048227k.
14. FDA approves first BCMA-targeted therapeutic. Nature. 2020 doi: 10.1038/d41573-020-00157-2. https://www.nature.com/articles/d41573-020-00157-2
15. Moreau P, Garfall AL, van de Donk NWCJ, et al. Teclistamab in relapsed or refractory multiple myeloma. N Engl J Med Overseas Ed. 2022;387(6):495–505. doi: 10.1056/NEJMoa2203478.
16. Firestone R, Lesokhin AM, Usmani SZ. An embarrassment of riches: three FDA-approved bispecific antibodies for relapsed refractory multiple myeloma. Blood Cancer Discov. 2023;4(6):433–436. doi: 10.1158/2643-3230.BCD-23-0176.
17. Zheng H, Xian H, Zhang W, et al. BCMA-targeted therapies for multiple myeloma: latest updates from 2024 ASH annual meeting. J Hematol Oncol. 2025;18(1):23. doi: 10.1186/s13045-025-01675-5.
18. Gazeau N, Beauvais D, Yakoub-Agha I, et al. Effective anti-BCMA retreatment in multiple myeloma. Blood Adv. 2021;5(15):3016–3020. doi: 10.1182/bloodadvances.2021004176.
19. Chen H, Li M, Xu N, et al. Serum B-cell maturation antigen (BCMA) reduces binding of anti-BCMA antibody to multiple myeloma cells. Leuk Res. 2019;81:62–66. doi: 10.1016/j.leukres.2019.04.008.
20. Green DJ, Pont M, Sather BD, et al. Fully human BCMA targeted chimeric antigen receptor t cells administered in a defined composition demonstrate potency at low doses in advanced stage high risk multiple myeloma. Blood. 2018;132(suppl 1):1011.
21. Brudno JN, Maric I, Hartman SD, et al. T cells genetically modified to express an anti–B-cell maturation antigen chimeric antigen receptor cause remissions of poor-prognosis relapsed multiple myeloma. J Clin Oncol. 2018;36(22):2267–2280. doi: 10.1200/JCO.2018.77.8084.
22. Da Vià MC, Dietrich O, Truger M, et al. Homozygous BCMA gene deletion in response to anti-BCMA CAR T cells in a patient with multiple myeloma. Nat Med. 2021;27(4):616–619. doi: 10.1038/s41591-021-01245-5.
23. Samur MK, Fulciniti M, Aktas Samur A, et al. Biallelic loss of BCMA as a resistance mechanism to CAR T cell therapy in a patient with multiple myeloma. Nat Commun. 2021;12(1):868. doi: 10.1038/s41467-021-21177-5.
24. Van Oekelen O, Aleman A, Upadhyaya B, et al. Neurocognitive and hypokinetic movement disorder with features of parkinsonism after BCMA-targeting CAR-T cell therapy. Nat Med. 2021;27(12):2099–2103. doi: 10.1038/s41591-021-01564-7.
25. Cohen AD, Parekh S, Santomasso BD, et al. Incidence and management of CAR-T neurotoxicity in patients with multiple myeloma treated with ciltacabtagene autoleucel in CARTITUDE studies. Blood Cancer J. 2022;12(2):32. doi: 10.1038/s41408-022-00629-1.
26. Harrison S, Riley CH, Manier S, et al. Society of Hematologic Oncology 2023 Annual Meeting (SOHO 2023) CIG Media Group, LP; 2023. Efficacy of forimtamig, a GPRC5DxCD3 bispecific antibody, in patients with relapsed/refractory multiple myeloma (RRMM): analysis of patient and disease-related factors associated with responses.
27. Kumar S, Bachier CR, Cavo M, et al. CAMMA 2: a phase I/II trial evaluating the efficacy and safety of cevostamab in patients with relapsed/refractory multiple myeloma (RRMM) who have triple-class refractory disease and have received a prior anti-B-cell maturation antigen (BCMA) agent. J Clin Oncol. 2023;41:TPS8064.
28. Green DJ, O'Steen S, Lin Y, et al. CD38-bispecific antibody pretargeted radioimmunotherapy for multiple myeloma and other B-cell malignancies. Blood. 2018;131(6):611–620. doi: 10.1182/blood-2017-09-807610.
29. Devasia AJ, Chari A, Lancman G. Bispecific antibodies in the treatment of multiple myeloma. Blood Cancer J. 2024;14(1):158. doi: 10.1038/s41408-024-01139-y.
30. Lee H, Ahn S, Maity R, et al. Mechanisms of antigen escape from BCMA- or GPRC5D-targeted immunotherapies in multiple myeloma. Nat Med. 2023;29(9):2295–2306. doi: 10.1038/s41591-023-02491-5.
31. Moreaux J, Legouffe E, Jourdan E, et al. BAFF and APRIL protect myeloma cells from apoptosis induced by interleukin 6 deprivation and dexamethasone. Blood. 2004;103(8):3148–3157. doi: 10.1182/blood-2003-06-1984.
32. Tai Y-T, Li X-F, Breitkreutz I, et al. Role of B-cell–activating factor in adhesion and growth of human multiple myeloma cells in the bone marrow microenvironment. Cancer Res. 2006;66(13):6675–6682. doi: 10.1158/0008-5472.CAN-06-0190.
33. Lee L, Draper B, Chaplin N, et al. An APRIL-based chimeric antigen receptor for dual targeting of BCMA and TACI in multiple myeloma. Blood. 2018;131(7):746–758. doi: 10.1182/blood-2017-05-781351.
34. Lee L, Lim WC, Galas-Filipowicz D, et al. Limited efficacy of APRIL CAR in patients with multiple myeloma indicate challenges in the use of natural ligands for CAR T-cell therapy. J Immunother Cancer. 2023;11(6) doi: 10.1136/jitc-2023-006699.
35. Camviel N, Wolf B, Croce G, Gfeller D, Zoete V, Arber C. Both APRIL and antibody-fragment-based CAR T cells for myeloma induce BCMA downmodulation by trogocytosis and internalization. J Immunother Cancer. 2022;10(11) doi: 10.1136/jitc-2022-005091.
36. Huo J, Huang Y, Zheng Z, et al. Development of a T cell-redirecting bispecific antibody targeting B-cell maturation antigen for the suppression of multiple myeloma cell growth. Antib Ther. 2022;5(2):138–149. doi: 10.1093/abt/tbac012.
37. Moreaux J, Cremer FW, Reme T, et al. The level of TACI gene expression in myeloma cells is associated with a signature of microenvironment dependence versus a plasmablastic signature. Blood. 2005;106(3):1021–1030. doi: 10.1182/blood-2004-11-4512.
38. Novak AJ, Darce JR, Arendt BK, et al. Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood. 2004;103(2):689–694. doi: 10.1182/blood-2003-06-2043.
39. Xu Y, Lee J, Tran C, et al. Production of bispecific antibodies in "knobs-into-holes" using a cell-free expression system. MAbs. 2015;7(1):231–242. doi: 10.4161/19420862.2015.989013.
40. Zhang M, Loh HP, Goh Fang S, Yang Y, Lam K-P, Xu S. Development of BCMA-targeted bispecific natural killer cell engagers for multiple myeloma treatment. Antibodies. 2024;13(4) doi: 10.3390/antib13040097.
41. Larson RC, Kann MC, Graham C, et al. Anti-TACI single and dual-targeting CAR T cells overcome BCMA antigen loss in multiple myeloma. Nat Commun. 2023;14(1):7509. doi: 10.1038/s41467-023-43416-7.
42. Subklewe M. BiTEs better than CAR T cells. Blood Adv. 2021;5(2):607–612. doi: 10.1182/bloodadvances.2020001792.
43. Ferguson ID, Patiño-Escobar B, Tuomivaara ST, et al. The surfaceome of multiple myeloma cells suggests potential immunotherapeutic strategies and protein markers of drug resistance. Nat Commun. 2022;13(1):4121. doi: 10.1038/s41467-022-31810-6.
44. Scott S, Nooka A, Kaufman J, et al. Talquetamab bridging therapy for B-cell maturation antigen chimeric antigen receptor T-cell in relapsed/refractory multiple myeloma. Blood. 2025;146(suppl 1):2811.