We report on a 17-year-old young woman with Ullrich-Turner syndrome (UTS), who was found to have a karyotype 45,X/46,X,idic(Y)(q11). She had age-appropriate genitalia without virilization in spite of the presence of the Y-derived marker chromosome and SRY locus in 70% of her lymphocytes. Having reviewed the literature, we conclude that a possible explanation for the lack of virilization in these mosaic patients is most likely an uneven distribution of tissue mosaicism (gonadal mosaicism).
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
European journal of pediatric surgery : official journal of Austrian Association of Pediatric Surgery ... [et al] = Zeitschrift fur Kinderchirurgie2000eng
Intersexual genitals or distinct hypospadias in combination with maldescended testis can be caused by endocrinological as well as chromosomal abnormalities. Even in early childhood such clinical findings require specific diagnostic procedures and subsequent treatment which is often invasive but has special importance as regards the early diagnosis of gonadal tumors. We present a child with cryptorchidism on the right, inguinal testis on the left and penoscrotal hypospadias. Cytogenetic analyses revealed a mosaic karyotype 45, X/46, X, idic (Yp) with unequal distribution of the mosaic in differ
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The authors report a family in which a woman with the mosaic Turner karyotype 45,X/46,X,r(X) transmitted the ring (X) chromosome to the second daughter and transmitted the X-derived chromosome to the first daughter. The mother had normal fertility with three documented pregnancies and conceptions occurred without any hormonal therapy. Her first pregnancy ended with spontaneous abortion, while the second pregnancy resulted in a 45,X/46,X,+mar female with ovarian failure and the third pregnancy resulted in a 45,X/46,X,r(X) female. The nature of the ring chromosome was confirmed by conventional c
Клинический случайАннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report two female patients with gonadal dysgenesis and sex chromosome mosaicism involving the Y chromosome. Conventional karyotyping was supplemented with fluorescent in situ hybridisation techniques in order to confirm the presence of Y chromosomes. One patient is a phenotypic female with karyotype 45,X/46,X,idic(Y)(q11.2). She underwent a laparoscopic gonadectomy at which streak ovaries without evidence of gonadoblastoma were removed. The second patient presented as a virilised female with karyotype 45,X/47,XYY. At laparoscopy, she was found to have mixed gonadal dysgenesis with a gonadob
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: According to the literature approximately 50% of patients with Turner's syndrome have karyotype 45,X in every cell, the rest have two or more cell lines with mosaics of sex chromosomes. New methods have shown that the mosaicism is probably more frequent than expected from classical cytogenetics examinations. The aim of this study was to detect numerical changes of sex chromosomes in mitoses and interphase nuclei of cultivated peripheral lymphocytes of patients with Turner's syndrome by means of FISH, to compare the sensitivity of classical and molecular-cytogenetic methods and to e
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects we
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 38-year old man was transmitted to our hospital because of his pneumonia and disconsciousness. Laboratory data showed leukocytosis (32,500/microliter), mild anemia, and decreased platelet count (6.7 x 10(4)/microliter). The bone marrow aspiration revealed the presence of 40% blastoid cells and cytogenetic study showed abnormal karyotype, 45, X, -Y, t(8; 21) (q22; q22), indicating acute myeloid leukemia (AML, M2). Furthermore, on the microscopic observation, cell fragments resembling giant platelets were observed which were positive for myeloperoxidase, and several fragments connected with ab
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
If hermaphrodite genitals are present in the patient or a higher degree of hypospadia is shown with maldescensus testis, a chromosomal disorder must be considered as one potential cause of the anomaly. The case report of a child with cryptorchidism on the right, inguinal testis on the left and penoscrotal hypospadia is presented as an example. A mosaic karyotype 45, X/46, X, idic (Yp) was diagnosed in this patient after chromosomal analysis. The cell line with the isodicentric Y chromosome could be demonstrated in about 90% of the lymphocytes, but only in 7% of the fibroblasts of the preputium
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: Patients with Turner syndrome (TS) may present a wide spectrum of gonadal function including spontaneous menstruation and fertility.
DESIGN: The aim of our study was to present the patients with Turner syndrome (TS) with spontaneous menstruations considering specific karyotype and X-inactivation processes.
MATERIALS AND METHODS: 5 women from group of 55 patients in age from 15 to 38 years with diagnosis of TS and gonadal function were found. Clinical analysis included the evaluation of spontaneous pubertal development and hormones levels. Cytogenetic analysis was performed on per
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
cognition of changes in the masticatory organ in patients with Turner syndrome. The material consisted of 31 girls with this syndrome from age 11 to 23, including 15 with karyotype 45,X, 9 with mosaic karyotype, 2 with structural aberrations of chromosome X and 5 girls with indeterminate karyotype with typical phenotype for Turner syndrome. The investigative methods applied were: extraoral and intraoral orthodontic clinic investigation, pantomographic investigation of dentition, investigation of breadth of dental arches and palatal height on plaster casts of maxilla and mandible with use of th
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A female patient with the karyotype 45,X/46, X, r(X)(p11.2 q13) and severe developmental delay, prominent fingertip pads, long palpebral fissures, short stature, and history of hypotonia had a phenotype reminiscent of Kabuki syndrome. We hypothesized that overexpression of X chromosome-derived sequences might be associated with the Kabuki-like phenotype observed. The nature and parental origin of this small-ring X were ascertained using a combination of genotyping with microsatellite markers and quantitative Southern blotting. PCR-based genotyping demonstrated heterozygosity at X-linked loci S
Клинический случайСтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report a family in which a woman with the mosaic karyotype 45,X/46,X,del(X)(p21.2) transmitted the deleted X chromosome to two daughters. The nature of the deletion was confirmed by fluorescent in situ hybridization (FISH). All three family members showed somatic Ullrich-Turner syndrome features, but only one daughter had ovarian failure. These observations have implications for the diagnosis of Ullrich-Turner syndrome and genotype/phenotype correlations of X chromosome deletions.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIMS/BACKGROUND: Females with Turner syndrome commonly exhibit ophthalmological abnormalities, although there is little information in the literature documenting findings specific to Turner syndrome mosaics. Ophthalmic findings are described in four patients with mosaic Turner syndrome. All had anterior chamber abnormalities and all four had karyotypic abnormalities with a 45, X cell line. The possible relation between the karyotypic and the phenotypic findings in these patients is discussed.
METHODS: Four girls with mosaic Turner syndrome underwent a full ophthalmological assessment, includi
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Results of marker chromosome identification using the FISH technique are presented. The origin of markers was determined in 11 patients with mosaic karyotype 45,X/46,X,mar. Using probes specific for X and Y chromosomes, we demonstrated that in 8 patients the marker originated from the X chromosome and in 3 cases it was an abnormal Y chromosome. These 3 patients were identified as at high risk for developing gonadoblastoma and prophylactic gonadectomy was performed. Results of these studies show that the FISH technique is a very useful method in the diagnosis of sex chromosome abnormalities.
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Data of the prevalence of osteoporosis in girls with Turner's syndrome are not uniform, and its causes have not been fully elucidated. Information on the mineralization of osseous tissue is controversial. The objective of the present work was to examine some more recent indicators of bone metabolism in a group of girls with Turner's syndrome.
METHODS AND RESULTS: A group of girls aged 4-20 years was examined where genetic examination had revealed karyotype 45 X (7 patients) or mosaic 45 X (46 XX) (9 patients). On X-ray examination osteoporosis was found in 71%, densitometric evide
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe an unusual marker chromosome Y. This marker is present in 5% of the lymphocytes of a dysgenetic woman showing a mosaic karyotype 45,X/46,XY/47,XY+mar. Q-banding revealed that the marker was morphologically identical to the Y chromosome of the patient but presented the primary constriction in the heterochromatic region. C-banding confirmed that the heterochromatic region was C-positive; furthermore, it showed two spots in the euchromatic region in a position corresponding to that of the centromere in the normal Y. Fluorescence in situ hybridization with the centromere-specific probe
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The rare association of mixed gonadal dysgenesis and non classical congenital hyperplasia by 21-hydroxylase deficiency poses the problem of their respective responsibility in the development of sexual ambiguity.
CASE REPORT: In a newborn with ambiguous genitalia, blood 17-OH progesterone was moderately elevated (3.9 to 14.1 ng/mL) leading to the diagnosis of non-classical 21 hydroxylase deficiency, Molecular studies later confirmed this diagnosis. However, the presence of a palpable gonad and the karyotype (45 X/46 XY mosaicism) indicated a mixed gonadal dysgenesis as the cause of
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bone mineral density (BMD), bone mineral content and body composition were determined in 47 middle-aged (mean age 47.9 +/- 1.1 years) women with Turner's syndrome. Bone mineral density was measured in the forearm, femoral neck and total body. The women investigated had a BMD lower than the normal mean. When expressed as Z scores (individual values compared to normal reference data matched for age, weight and sex), the median Z score of the total body was -1.23. When comparing women with the karyotype 45,X and mosaic women, the latter showed a higher BMD in all sites of measurement. Duration of
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Final height of 75 adults with Turner's syndrome (45 Israeli, 30 Italian), never treated with GH, was examined to see if a relationship with karyotype patterns and parental height existed. Patients were divided into five groups according to their chromosome pattern, as follows: group A = 45, X karyotype (34 patients); group B = mosaicism (11 with karyotype 45,X/46,XX and 7 with karyotype 45,X/46,XY); group C = deletion of all or part of Xp (19 patients); subgroup C1 = 6 with complete deletion of Xp; subgroup C2 = 9 with mosaicism 45,X/46,X,i(Xq); subgroup C3 = 4 with 45,X/46,X,ring(X); group D
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Under the auspices of ESPE/LWPES, a survey on spontaneous adult height in patients with Turner syndrome was conducted in 12 European countries. A total of 661 patients (45,X = 51%) with a median age of 23.6 years (range: 16-63) who had never received any growth-promoting treatment until the age of 14 had reached a mean height of 144.3 +/- 6.7 cm. There was no height difference between those (n = 220) who had received oxandrolone and/or estrogen after the age of 14 years and those (n = 441) who never received any treatment until the age of 20. On average, there was no major gain in height after
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.