The number of cutaneous melanoma survivors has been increasing for years due to improvements in early diagnosis and subsequent prolonged survival. These patients are at increased risk of developing a second melanoma and a second primary malignancy (SPM) at other sites as well. We performed a review of scientific literature and meta-analysis to evaluate the risk of developing a SPM (other than melanoma) among melanoma patients. Twenty-three independent papers and over 350,000 melanoma patients were included. Risk of cancer among melanoma survivors was increased overall (1.57, 95% CI 1.29-1.90)
СтатьяМетаанализСистематический обзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite many experimental and clinical studies conducted on distraction osteogenesis (DO) in the past decade, changes in the surrounding tissues that occur after the procedure remains poorly understood. To study the biochemical changes of recovery in nerve tissues upon DO-induced nerve injury, we prepared a rabbit model of tibia lengthening to observe the expression pattern of nerve growth factor (NGF) and low-affinity NGF receptor (p75NGFR) in the distracted tibial nerve. The distracted tibial nerve was harvested at various time points during the consolidation period of new bone formation and
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To evaluate the effect of reconstruction with autograft implantation in total hip arthroplasty(THA) with regional acetabular deficiency.
METHODS: From 1991 to 2000, 39 cases of THA with acetabular deficiency were conducted. Autogenous bone implantation was used to reconstruct the deficient acetabulum. Of the 39 patients, 25 were males and 14 were females. The age ranged from 34 to 62 (45.2 on average). There were 21 cases of developmental dysplasia resulted deficiency, 14 cases of fracture of femoral neck complicated with head necrosis (10 hips) and fracture of acetabulum(4 hips).
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The complications of prosthetic surgery in the dysplastic hip have specific features that are related to the conditions that make the realization of an implant technically complex; the altered primary acetabular and femoral morphology, the sequelae of previous non-substitutive surgery, and the consequent possible upsetting of joint biomechanics. It is possible to distinguish between complications relative to the skeleton, joint biomechanics, and soft tissues. Prosthetization of the acetabular skeletal aspect may encounter frequent errors in reconstruction (incongruous reaming-too much or too l
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The practice of dentistry requires an understanding of medical illnesses and the implications of treatment on the oral environment. Periodic review enables the practitioner to anticipate patient needs and to interact competently with other medical care providers. Presented in this review are recent advances in understanding the relationship between medical and oral diseases. Where appropriate, therapeutic regimens for the treatment of oral manifestations are suggested. Diabetes remains equivocally associated with periodontal disease. The dynamic nature of the immune system and the exhaustive l
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Correction of deformities around the knee joint in the frontal and sagittal axis, torsion, length and translation.
INDICATIONS: Complex deformities of the proximal tibia, and to a lesser extent of the distal femur, which cannot be treated with acute correction using plate or nail osteosynthesis.
CONTRAINDICATIONS: Nicotine abuse, soft tissue problems, lack of patient compliance.
SURGICAL TECHNIQUE: First, mounting of the proximal ring of the ring fixator strictly parallel to the joint line in 2 planes, fixation with 3 or 4 pins or wires. Then mounting of the distal ring, fixation
Аннотация на английскомСтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: Hereditary multiple exostoses (HME) patients frequently present with ankle valgus deformity and marked fibular shortening. Loss of the lateral buttress may cause translational talus instability (TTI) that manifests as ankle pain after physical exercise, medial clear space widening on plain radiographs, and gross translational movement of the talus within the mortise. Among 123 HME patients examined and/or surgically treated, 10 patients (14 ankles) with symptomatic TTI underwent fibular lengthening with osteochondroma excision. Twelve ankles of 9 patients were followed for >1 year
СтатьяМногоцентровое исследованиеРандомизированное исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Congenital deficiency of the fibula may present a variety of patterns. In a series of 20 patients with this diagnosis, we have observed limb-length inequality and a spectrum of musculoskeletal anomalies involving the ipsilateral hip, femur, knee, tibia/fibula, ankle, and foot. Considering the frequently associated abnormalities of the lower extremity, the term postaxial hypoplasia may be more descriptive than the traditional terms fibular hemimelia or fibular a/hypoplasia. By raising the awareness of associated deformities, the clinician is better prepared to advise patients and to intercede a
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thirty-two patients who had ablation of the foot by the Syme or Boyd technique for partial or total absence of the fibula, with subsequent fitting of a prosthesis, were compared with eleven patients who had lengthening of the lower limb by the Wagner method, to assess the long-term results of each procedure. The final results were evaluated on the basis of pain, limp, limb-length discrepancy, level of physical activity, and satisfaction of the patient. Of the thirty-two patients who had an amputation, twenty-eight (88 per cent) had a satisfactory result, compared with only six (55 per cent) of
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Our main objective is to assess the efficiency of the osteochondroplasty with relative neck lengthening in adults with healed Perthes clinically (through assessment of impingement-free hip ROM, functional scores) and radiographically.
PATIENTS AND METHODS: This was a prospective case series study included 30 hips of 30 patients who underwent osteochondroplasty and RNL due to symptomatic healed LCPD. This study included 16 males (53.3%) and 14 females (46.7%). The age of patients ranged from 19 to 40 years with mean age 26.4 years at the date of surgery (SD 6.4).
RESULTS: Median ti
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Gradual correction of genu varum using circular external fixators is well-established. Although the External Fixation Index (EFI) is widely used in linear bone lengthening, no standardized, time-normalized metric exists for angular deformity correction. This study introduces the angular External Fixation Index (aEFI) as a descriptive tool and evaluates internal consistency within a clinical cohort treated with oblique proximal tibial corticotomy (OPTC).
METHODS: A prospective cohort study included 22 patients (30 knees) who underwent gradual genu varum correction using OPTC an…
СтатьяВалидационное исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pannexin 3 (Panx3) is a glycoprotein that forms mechanosensitive channels expressed in chondrocytes and annulus fibrosus cells of the intervertebral disc (IVD). Evidence suggests Panx3 plays contrasting roles in traumatic versus aging osteoarthritis (OA) and intervertebral disc degeneration (IDD). However, whether its deletion influences the response of joint tissue to forced use is unknown. The purpose of this study was to determine if Panx3 deletion in mice causes increased knee joint OA and IDD after forced treadmill running. Male and female wildtype (WT) and Panx3 knockout (KO) mice were r
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: This technique video reviews medial meniscal allograft transplantation (MAT) using a representative case example.
INDICATIONS: Medial meniscal allograft transplantation is indicated in symptomatic patients with a deficient medial tibiofemoral compartment that has not progressed to arthritic changes. Concomitant procedures to address focal cartilage defects, ligamentous laxity, and/or limb malalignment should be performed prior to MAT or in the same surgical setting.
TECHNIQUE DESCRIPTION: Preoperative workup includes magnetic resonance imaging (MRI), prior arthroscopic pictures,
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Focal fibrocartilaginous dysplasia (FFCD) is a rare disorder of the upper and lower extremities. In the distal ulna, a ligamentous tether emerging from the metaphysis crosses the physis and restricts growth, leading to deformity. Lesion excision before radiocapitellar subluxation has been shown to restore growth and allow remodeling. We review the outcomes of 4 patients with FFCD of the distal ulna after the occurrence of radiocapitellar incongruity.
METHODS: This retrospective review examined 4 patients diagnosed with FFCD of the distal ulna from 2007 to 2015. Diagnosis was based
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: In end-stage arthritis indicated for total ankle arthroplasty (TAA), full-thickness cartilage damage, subchondral bone defect/shaving, and fluttering of the talar dome occur, shortening the distance between the tibial and talar insertions of ligaments and leading to laxity of ligaments surrounding the ankle joint. Under such conditions, medial ligaments (including the deltoid ligament) would not be expected to function properly. To stabilize the ankle joint during the stance phase, medial ligament function under tension is important. This study therefore examined whether TAA contri
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sacral agenesis is a term that applies to a wide range of developmental disorders of the lower portions of the spine and pelvis. Hemisacrum patients with all sacral segments present on one side of the spine, and decompensated lumbar rotoscoliosis, whit instability torac-pelvic that had transiliac lengthening of the lower extremity, accomplished by an innominate osteotomy with interposition of a rectangular iliac-bone graft in the osteotomy site, besides a posterior lumbar-iliac percutaneous fusion. We reported 5 adolescent patients, 2 men and 3 women, treated from 2000 to 2009, associated with
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Latest advances made in joint replacement implants allows reconstruction of entire limbs. These special prostheses or megaprostheses were originally designed for the treatment of severe oncological bone loss. Nowadays, however, the indications and applications of these devices are expanding to other orthopaedic and trauma clinical conditions. Since 2008 we have implanted 152 megaprostheses in non-oncological conditions: 87 were implanted for post-traumatic failures aseptic/septic (represented by complex non-unions and critical size bone defects); 26 total femur, 52 distal femur a
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Flatfoot deformities are characterized by collapse of the medial arch due to tendinous and ligamentous dysfunction. The degree of deformity can be evaluated radiographically by measuring the talo-first metatarsal angle (Meary angle). These deformities have traditionally been corrected using a medial cuneiform dorsal opening wedge (Cotton) osteotomy; however, this procedure requires bone grafting to fill the osteotomy site and results in lengthening of the medial column. To address these concerns, the plantar closing wedge of the medial cuneiform bone, known as the reverse Cotton os
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: In order to treat proximal femur fibrous dysplasia (FD) patients combined with hip joint osteoarthritis (OA), the three-dimensional (3D) designing osteotomy and implantation of femoral component was firstly used for deformity correction and total hip arthroplasty (THA). The purpose is to present the detailed design, perioperative management and evaluate short-term clinical outcomes of this novel therapeutic method.
METHOD: A retrospective study was performed in twelve FD patients combined with hip joint OA who were treated in our hospital between July 2013 and April 2015. Seven pa
СтатьяВалидационное исследованиеПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования