BACKGROUND: Nasal surgery is occasionally performed to correct traumatic nasal deformity. Septal cartilage is the main tissue to be corrected and is a graft source when needed. A risk in engrafting with cartilage is the possibility of resorption as a result of either necrosis or apoptosis. The authors evaluated the rate of apoptosis in deviated and straight cartilage to investigate the cause of resorption of cartilage tissue.
METHODS: Twenty-five patients with traumatic nasal septum deviation (group I) and 13 patients with nontraumatic nasal septum deviation (group II) were prospectively enro…
Сравнительное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The pericellular matrix (PCM) is a narrow tissue region surrounding chondrocytes in articular cartilage, which together with the enclosed cell(s) has been termed the "chondron." While the function of this region is not fully understood, it is hypothesized to have important biological and biomechanical functions. In this article, we review a number of studies that have investigated the structure, composition, mechanical properties, and biomechanical role of the chondrocyte PCM. This region has been shown to be rich in proteoglycans (e.g., aggrecan, hyaluronan, and decorin), collagen (types II, …
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Tissue engineering is a promising method to treat damaged cartilage. So far it has not been possible to create tissue-engineered cartilage with an appropriate structural organization. It is envisaged that cartilage tissue engineering will significantly benefit from knowledge of how the collagen fiber orientation is directed by mechanical conditions. The goal of the present study is to evaluate whether a collagen remodeling algorithm based on mechanical loading can be corroborated by the collagen orientation in healthy cartilage.
METHODS: According to the remodeling algorithm, colla…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fourier transform infrared (FT-IR) imaging and microspectroscopy have been extensively applied to the analyses of tissues in health and disease. Spatially resolved mid-IR data has provided insights into molecular changes that occur in diseases of connective or collagen-based tissues, including, osteoporosis, osteogenesis imperfecta, osteopetrosis and pathologic calcifications. These techniques have also been used to probe chemical changes associated with load, disuse, and micro-damage in bone, and with degradation and repair in cartilage. This review summarizes the applications of FT-IR micros…
СтатьяПоддержка NIH: внешняя программаОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Autogenous cartilage-perichondrium-composite-grafts have become essential and well established transplant materials in reconstructive middle ear surgery. They have proven to be particularly appropriate for surgical situations which benefit from the bradytrophy and stiffness of the cartilage (adhesive otitis, retraction pockets, subtotal tympanic membrane defects, revision tympanoplasty). Of the numerous techniques available, the perichondrium-island technique and the palisade-cartilage technique are described in detail in this review, also regarding modifications and comments in the literature…
Аннотация на английскомСтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. …
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Arthroscopy : the journal of arthroscopic & related surgery : official publication of the Arthroscopy Association of North America and the International Arthroscopy Association2005eng
PURPOSE: The objective of the present study was to evaluate whether horizontal cleavage and complex meniscus tears, which are degenerative tears, are associated with an increased incidence of cartilage damage, in comparison with patients having other patterns of meniscal injury.
TYPE OF STUDY: Case series study.
METHODS: Data were collected prospectively from 497 consecutive knee arthroscopies carried out from 1997 to 2001. Patient data (age, sex, duration of symptoms, injuries, and possible mechanism of injury), operative details (types and number of portals, equipment used), intra-articula…
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A woman presented with premature knee osteoarthritis associated with marked femoral cartilage hypertrophy. She also exhibited phalangeal dysgenesis, suggesting this may be an unrecognised syndrome that may predispose to knee osteoarthritis.
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Studies have shown that joint bleeding leads to cartilage degradation independent of concurrent synovitis. We hypothesized that the blood-induced cartilage damage is because of increased chondrocyte apoptosis after short-term exposure of whole blood or isolated mononuclear cells plus red blood cells to cartilage. Human cartilage tissue samples were co-cultured for 4 days with whole blood (50% v/v) or with mononuclear cells plus red blood cells (50% v/v equivalents). Cartilage matrix proteoglycan synthesis ((35)SO(4)(2-) incorporation) was determined after 4 days as well as at day 16 (after a 1…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A wide range of materials have been used to achieve medialization of the paralyzed vocal fold. Recently, medialization techniques using autologous cartilage have been described, but little information is available on cartilage integration and viability in this situation. In this prospective, experimental, controlled study, right vocal fold paralysis was surgically induced in 30 New Zealand rabbits. An autologous auricular cartilage transplant was inserted in the vocal fold in 15 animals. In the control group, only the laryngeal nerve was sectioned. Each group was divided into two groups with f…
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES/HYPOTHESIS: The purpose of this study was to analyze the anatomical and audiologic results in more than 1,000 cartilage tympanoplasties that utilized a logical application of several techniques for the management of the difficult ear (cholesteatoma, recurrent perforation, atelectasis). Our hypothesis was that pathology and status of the ossicular chain should dictate the technique used to achieve optimal outcome.
STUDY DESIGN: Retrospective clinical study of patients undergoing cartilage tympanoplasty between July 1994 and July 2001. A computerized otologic database and patient cha…
Клиническое исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In recent years, many biochemical markers were tested with the aim of developing a tool for the early detection and monitoring of osteoarthritis (OA). Apart from chondral markers, we also evaluated osseous markers from the synovial fluid to obtain more comprehensive information, and we compared the levels in relation to the severity of OA. In this prospective, cross-sectional study, synovial fluid samples were obtained from 73 patients with OA of the knee joint prior to operation and after the joint was flushed with 50 ml of normal saline. All patients underwent surgery and were classified in
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The proposed operative technique with maternal auricular cartilage ear-donor) is modification of the method of M. Madzharov et al., for total and partial reconstruction of the auricle. The method includes the use of allogenic auricular cartilage and autogenic perichondrium (rib of auricular), attached to the cartilage with autogenic fibrin glue and/or sutured by nylon. The method is applied to 18 years old female patient with bilateral microtia III gr., for reconstruction of the left year. 2 years later, satisfying cosmetic result was encountered on the operated left ear and ear-donor. Briefly…
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Articular cartilage shows little or no intrinsic capacity for repair in response to injury or disease, and even minor lesions or injuries may lead to progressive damage and joint degeneration. Tissue engineering is a relatively new but rapidly growing field that has sought to use combinations of implanted cells, biomaterials, and biologically active molecules to repair or regenerate injured or diseased tissues. Despite many advances, tissue engineers have faced significant challenges in repairing or replacing tissues that serve a predominantly biomechanical function, such as articular cartilag…
СтатьяПоддержка службы здравоохранения СШАОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osteoarthritis (OA) is a degenerative joint disease characterised by the breakdown of the extracellular matrix of chondrocytes in the affected joints. Cytokines and growth factors which are known to play a role in the synthesis and degradation of cartilage matrix have been shown to be upregulated in osteoarthritic cartilage. This upregulation resulted in two different phenotypes, overexpressing either TNF-alpha and IL-6 or IL-1beta, TGFbeta1, IL-4 and IL-10. To investigate the hierarchy among growth factors and cytokines involved in cartilage metabolism, we analysed osteoarthritic cartilage ex…
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We studied kinetics in the epiphyseal cartilage of the brachymorphic (bm/bm) mouse, combining morphometry and labeling with halogenated nucleotides. The defective synthesis of the sulfate donor PAPS in these homozygous mutants is evident in tissues with a large production of glycosaminoglycans; these compounds become undersulfated. Compared with their heterozygous siblings, the longitudinal growth of the mutant mice was reduced by two-thirds. This was mainly associated with (1) reduced height of the proliferating zone, (2) a substantial number of G0 cells in this zone, and (3) reduced hypertro…
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The objective of this study was to evaluate the biomechanical properties of newly formed cartilaginous tissue synthesized from isolated chondrocytes. Cartilage from articular joints of lambs was either digested in collagenase to isolated chondrocytes or cut into discs that were devitalized by multiple freeze-thaw cycles. Isolated cells were incubated in suspension culture in the presence of devitalized cartilage matrix for 3 weeks. Multiple chondrocyte/matrix constructs were assembled with fibrin glue and implanted subcutaneously in nude mice for up to 6 weeks. Testing methods were devised to …
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Particles observed on the surfaces of human articular cartilage following trauma and from chondromalacic, osteoarthritic and rheumatoid joints using the scanning electron microscope were analysed by x-ray diffraction technique. The particles contained calcium and phosphorus and they were identified only in structurally abnormal cartilage. These findings suggest that local abnormality of articular cartilage probably underlies crystal-deposition.
Сравнительное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Articular cartilage has only a small capacity for regneration. This makes the repair of articular surfaces difficult. In 1959 Pridie described his method of resurfacing osteoarthritic knee joints. This operation is still in widespread use today. Pridie introduced the principle of drilling exposed subchondral bone with the objective of encouraging a fibro-cartilaginous repair. The newly formed fibrocartilaginous layer that develops over the lesion in osteoarthritis may be enough to decrease patients symptoms. Bone drilling into the subchondral layer is also effective in promoting healing of ost…
Аннотация на английскомСтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования