OBJECTIVE: The current study aims to describe the infection and infestation adverse events that may be associated with the use of ocrelizumab using real-world data.
METHODS: Infection and infestation adverse event reports with the generic name ocrelizumab as the primary suspect in the FAERS database from Q4 2003 to Q3 2024 were included in the study. The disproportionality analysis software package OpenVigil 2.1-MedDRA-v24, including the Reporting Odds Ratio (ROR) and Proportional Reporting Ratio (PRR) algorithms, was used to determine signal strength of infection and infestation adverse even
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: This research aimed to investigate the pathophysiological mechanism of how drug-induced parkinsonism (DIP) affects the integrity of the white matter (WM) fiber microstructure as measured by magnetic resonance diffusion tensor image (DTI) fractional anisotropy (FA) and mean diffusivity (MD).
METHODS: We recruited 17 participants diagnosed with DIP, 20 Parkinson's disease (PD) patients, and 16 normal controls (NCs) with a similar age, gender, and years of education. Subsequently, all participants underwent DTI magnetic resonance imaging scanning. To analyze the data, we utilized t
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Trigeminal neuralgia (TN) is the most common neuropathic disorder in the maxillofacial region. The etiology and pathogenesis of TN have not been clearly determined to date, although there are many hypotheses.
OBJECTIVE: The goal of this study was to investigate the interactions between different types of cells in TN, particularly the impact and intrinsic mechanism of demyelination on the trigeminal ganglion, and to identify new important target genes and regulatory pathways in TN.
METHODS: TN rat models were prepared by trigeminal root compression, and trigeminal nerve tissues we
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Plants are considered a wealthy resource of novel natural drugs effective in the treatment of multidrug-resistant infections. Here, a bioguided purification of Ephedra foeminea extracts was performed to identify bioactive compounds. The determination of antimicrobial properties was achieved by broth microdilution assays to evaluate minimal inhibitory concentration (MIC) values and by crystal violet staining and confocal laser scanning microscopy analyses (CLSM) to investigate the antibiofilm capacity of the isolated compounds. Assays were performed on a panel of three gram-positive and three g
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Candida auris (CA) is an emerging fungus, classified as an urgent global health threat, that resists common antifungal drugs and decontamination procedures; identification requires specific tools; transmissibility and mortality are high in healthcare settings. Infection and colonisation can be long-lasting, leading to problems in isolation procedures and the risk of outbreaks. This study aims to evaluate publication and citation related metrics, identify major keywords and topics, and assess geographic distribution of published articles.
METHODS: A list of all publications contain
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: The increasing epidemic of infections caused by drug-resistant Gram-negative bacteria has led to the development of several antibiotic therapies. Owing to the scarcity of head-to-head comparisons of current and emerging antibiotics, the present network meta-analysis aimed to compare the efficacy and safety of antibiotics in patients with nosocomial pneumonia, complicated intra-abdominal infection, or complicated urinary tract infection.
METHODS: Two independent researchers systematically searched databases up to August 2022 and included 26 randomised controlled trials that fulfill
СтатьяПоддержка исследования: вне правительства СШАNetwork Meta-AnalysisПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investig
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Model-informed approaches are important in drug development, including for dose optimization and the collection of evidence in support of efficacy.
MATERIALS AND METHODS: We developed a modified Michaelis-Menten pharmacokinetics/pharmacodynamics model and used it to conduct simulations of glucarpidase at doses between 10 and 80 U/kg rescue treatment after high-dose methotrexate therapy. We carried out a dose-finding modeling and simulation study before a phase II study of glucarpidase. Monte-Carlo simulations were conducted using the deSolve package of R software (version 4.1.2).
Клиническое исследование II фазыСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Noncommunicable diseases (NCDs) place a heavy burden on populations globally and in particular, on lower-income countries (LIC). WHO identified a package of 16 "best buy" lifestyle and management interventions that are cost-effective and applicable in all settings. The purpose of this study was to evaluate and compare NCD risk factors in all WHO countries and make preliminary assessment of "best buy" interventions.
METHODS: Risk factors estimation was made in 188 countries. NCD attributable "best buys" concern tobacco use, unhealthy diet, physical inactivity, and harmful use of al
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: This study aims to determine the treatment preferences of physicians interested in fibromyalgia treatment and to investigate their hesitations about prescribing pregabalin.
METHODS: Our survey study was conducted between February 5 and 20, 2021. The survey forms were sent to the known email addresses and phone numbers of 1569 physical medicine and rehabilitation (PMR), algology, and rheumatology physicians. The replies to the surveys were checked for possible resubmissions. The pooled data were evaluated with the SPSS 22.0 statistical package program. Frequency distributions were
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sotorasib is a first-in-class KRASG12C covalent inhibitor in clinical development for the treatment of tumors with the KRAS p.G12C mutation. A comprehensive nonclinical safety assessment package, including secondary/safety pharmacology and toxicology studies, was conducted to support the marketing application for sotorasib. Sotorasib was negative in a battery of genotoxicity assays and negative in an in vitro phototoxicity assay. Based on in vitro assays, sotorasib had no off-target effects against various receptors, enzymes (including numerous kinases), ion channels, or transporters. Consiste
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This was a clinical trial study that aimed to investigate the efficacy of vaginal chlorhexidine gel in the treatment of vulvovaginal candidiasis, bacterial vaginosis, and nonspecific vaginitis. The study population included patients who complained of vaginal discharge and presented to our University Gynecology Clinic. The data were analyzed using the Statistical Package for the Social Sciences (SPSS) software. The student t-test and Mann-Whitney U test were used to analyze the quantitative and ordinal data, respectively. In order to analyze the qualitative data, the Chi-square or Fischer's exa
Клиническое исследованиеСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: There is an increasing rise of cosmetic injectables. We sought to understand the manufacturing, quality control process, and needle selection of hypodermic needles for fillers.
OBJECTIVE: To understand the process of manufacturing and quality control of hypodermic needles and the relevance to an aesthetic clinician.
METHODS: We conducted a search of the internet and contacted medical device companies to understand the manufacturing process. We then collaborated with the Executive director of global pharmaceutical technology from Abbvie as well as the packaging and device engine
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Background and Aims: Viral hepatitis are one of the main causes of liver cirrhosis. The treatment of portal hypertension caused by liver cirrhosis is difficult and diverse, and the therapeutic effect is unknown. Bayesian network meta-analysis was performed to compare the efficacy and safety of treatments for patients with portal hypertension and cirrhosis, including a transjugular intrahepatic portosystemic shunt (TIPS), endoscopic therapy, surgical therapy and medications. Methods: Eligible articles were searched for in PubMed, Embase, Cochrane Library and Web of Science databases from their
Систематический обзорСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To provide up-to-date medication prescribing patterns in US neonatal intensive care units (NICUs) and to examine trends in prescribing patterns over time.
STUDY DESIGN: We performed a cohort study of 799 016 infants treated in NICUs managed by the Pediatrix Medical Group from 2010 to 2018. We used 3 different methods to report counts of medication: exposure, courses, and days of use. We defined the change in frequency of medication administration by absolute change and relative change. We examined the Food and Drug Administration (FDA) package insert for each medication to determin
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
According to the World Health Organization report, 5.4 million under-five children died, which is similar to under-five mortality rate of 39 deaths per 1000 live births. This rate is higher in sub-Saharan Africa with 76 deaths per 1000 live births. More than 1 out of every 2 deaths is because of diseases that can be managed with drug of low-cost and high quality. Institutional-based cross-sectional survey was conducted from January to February 2021, at the University of Gondar Comprehensive Specialized Hospital. Statistical Package for the Social Sciences software version 24 was used for data
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Schistosomiasis is one of the Neglected Tropical Diseases in Ethiopia. Since 2015, yearly school-based mass drug administration (MDA) using praziquantel has become the major control strategy. This study aimed to assess trends of Schistosoma mansoni infection in a high-endemic area in Northwest Ethiopia.
METHODOLOGY: Data were extracted from routine laboratory logbooks at two health centers in West Dembia district, Amhara region, for the period 2013-2018. Wet-mount direct microscopy was used to diagnose intestinal parasites. Chi-square test was used to compare proportions of S. m
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In studies of HIV-1, virus production is normally monitored by either a reverse transcriptase assay or a p24 antigen capture ELISA. However, these assays are costly and time-consuming for routine handling of a large number of HIV-1 samples. For example, sample dilution is always required in the ELISA procedure to determine p24 protein levels because of the very narrow range of detectable concentrations in this assay. Here, we establish a novel HIV-1 production assay system to solve the aforementioned problems by using a recently developed small peptide tag called HiBiT. This peptide is a fragm
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Ibogaine is a psychoactive indole alkaloid that has been investigated for use as a treatment for opioid addiction. While not commercially available in the United States, it is available via Internet suppliers. Ibogaine use has been associated with significant cardiac and neurologic effects, such as QT-segment prolongation, cardiac dysrhythmias, hallucinations, seizures, and central nervous system depression. We present a case of verified ibogaine exposure with associated QTc prolongation and torsade de pointes with qualitative analysis of the ingested substance, and examine the his
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Topical corticosteroids (CSs) are commonly used to treat inflammatory skin conditions including eczema and psoriasis. Although topical CS package inserts describe hyperglycemia and glycosuria as adverse drug reactions, it is unclear whether topical CS use in real life is also associated with an increased risk of type 2 diabetes (T2D).
RESEARCH DESIGN AND METHODS: Two matched case-control studies and one cohort study were conducted using routinely collected health care data from Denmark and the U.K. A total of 115,218 and 54,944 adults were identified as case subjects with new-onset
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования