The melting temperature and hyperchromia of intestine mucosa tRNA preparations and the effect of inactivating factors on aminoacyl-tRNA-synthetase activity were studied at the stage of hypovitaminosis and under deep A-avitaminosis. It is shown that in the aminoacylation reaction, aminoacyl-tRNA-synthetase is a component more sensitive to vitamin A deficiency.
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Microbiota transplantation has emerged as a powerful tool to investigate host-microbe interactions across a wide range of organisms, yet its applicability and ecological limits in marine bivalves remain poorly understood. Here, we experimentally test whether microbiota associated with chronic environmental contamination can be transferred and persist in adult Manila clams (Ruditapes philippinarum). We compared two water-mediated approaches: (i) inoculation of a donor tissue homogenate into the water and (ii) cohabitation with live donor clams through shared seawater flow. Donors originated fro
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In the tumor microenvironment (TME), cancer-associated fibroblasts (CAFs)-the dominant stromal component-actively shape cancer progression through exosome-mediated communication. Here, we identify hsa_circ_0003892 (circLDLR), a CAF-derived circRNA, as a key factor associated with poor prognosis in colorectal cancer (CRC). During interactions between CAFs and CRC cells, circLDLR is packaged into exosomes and transferred to tumor cells, where it enhances proliferation and metastasis primarily by reducing susceptibility to ferroptosis. Mechanistically, circLDLR stabilizes Polypeptide N-Acetylgala
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dysregulation of the epitranscriptomic landscape is closely linked to pathological proliferation, but its specific role in benign prostatic hyperplasia (BPH) remains unclear. Here, we identify the tRNA methyltransferase TRMT61A as a critical driver of BPH progression. We found that TRMT61A and global N1-methyladenosine (m1A) levels are aberrantly upregulated in human BPH tissues. Functionally, TRMT61A knockdown potently suppresses prostate cell proliferation and reduces stromal fibrosis, inducing G1 cell cycle arrest and reversing pathological remodeling both in vitro and in vivo. By integrati
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe six persons from three families with three homozygous protein truncating variants in PUS7: c.89_90del (p.Thr30Lysfs∗20), c.1348C>T (p.Arg450∗), and a deletion of the penultimate exon 15. All these individuals have intellectual disability with speech delay, short stature, microcephaly, and aggressive behavior. PUS7 encodes the RNA-independent pseudouridylate synthase 7. Pseudouridylation is the most abundant post-transcriptional modification in RNA, which is primarily thought to stabilize secondary structures of RNA. We show that the disease-related variants lead to abolishment of P
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cell-derived exosomes have been demonstrated to be efficient carriers of small RNAs to neighbouring or distant cells, highlighting the preponderance of exosomes as carriers for gene therapy over other artificial delivery tools. In the present study, we employed modified exosomes expressing the neuron-specific rabies viral glycoprotein (RVG) peptide on the membrane surface to deliver opioid receptor mu (MOR) siRNA into the brain to treat morphine addiction. We found that MOR siRNA could be efficiently packaged into RVG exosomes and was associated with argonaute 2 (AGO2) in exosomes. These exoso
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The phylogenetic relationships among extant species of Crocodylus (Crocodylia) have been inconsistently resolved by previous systematic studies. Here we used nearly complete mitochondrial (mt) genomes (∼16,200 base pairs) for all described Crocodylus species, eight of which are new to this study, to derive a generally well-supported phylogenetic hypothesis for the genus. Model-based analyses support monophyly of all Asian+Australian species and paraphyly of Crocodylus niloticus (Nile crocodile) with a monophyletic New World clade nested within this species. Wild-caught Nile crocodiles from eas
СтатьяПоддержка правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hematoporphyrin (HP), at concentrations as low as 0.5 microgram/ml, was found to inhibit the in vitro replication of influenza A and herpes simplex viruses, but not of several other viruses. The effect required exposure of the viruses or cells to visible light and was demonstrable when HP was administered shortly before virus inoculation or during the infection. In studies on the mechanism of action of HP, we found that in the presence of light, HP caused decomposition of GMP but not of various other nucleosides. It caused breakdown of yeast tRNA and inhibited polymerization of RNA and DNA by
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70%
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial cytopathy is a heterogeneous group of disorders with a wide range of clinical features. To evaluate the incidence and clinical heterogeneity of A3243G mitochondrial tRNA mutation in the Korean population, we evaluated patients who were clinically suggestive of having mitochondrial encephalomyopathy. Eighty-five patients were included in this study. All showed clinical features of mitochondrial encephalomyopathy and had three or more of the following clinical manifestations: (1) psychomotor regression, (2) hyperlacticacidemia, (3) recurrent stoke-like episodes, (4) idiopathic card
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dianthus helenae Vved. is an endemic medicinal species of the Nuratau Mountains, Uzbekistan, and its genomic resources have remained largely unavailable. In this study, we sequenced, assembled, and characterized the complete chloroplast genome of D. helenae and evaluated its phylogenetic position within Dianthus. The plastome exhibited a typical circular quadripartite structure with a total length of 149,567 bp, comprising a large single-copy (LSC) region of 82,856 bp, a small single-copy (SSC) region of 17,105 bp, and a pair of inverted repeats (IRs) of 24,803 bp each. The genome contained th
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: Leuconostoc lactis is a heterofermentative lactic acid bacterium widely used as a starter culture in fermented foods. The L. lactis B34-1-7-1 strain, isolated from Panax ginseng sprouts cultivated under white LED light, has demonstrated promising probiotic potential, including antioxidant, anti-inflammatory, and anti-cancer activities, in previous studies. The genome of L. lactis B34-1-7-1 was sequenced and analyzed to evaluate its probiotic potential and safety for industrial applications, focusing on its genomic features and functional characteristics.
DATA DESCRIPTION: The geno
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tuberculosis and sepsis represent opposing extremes of host immune regulation: one characterised by sustained immune adaptation that permits Mycobacterium tuberculosis persistence, the other by rapid immune collapse that precipitates life-threatening inflammation. Examining these divergent outcomes through a shared regulatory lens highlights microRNAs (miRNAs) as pivotal, yet context-dependent, modulators of antimicrobial defence and immunopathology. Rather than acting as linear switches, miRNAs operate within densely interconnected networks, simultaneously shaping inflammatory signalling, met
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tylototriton anguliceps and T. ngoclinhensis are two species of crocodile newts native to Vietnam. In this study, we assemble and describe for the first time the complete mitochondrial genomes of T. anguliceps (16,720 bp) and T. ngoclinhensis (16,260 bp). Both genomes consist of 37 genes, which is consistent with most other vertebrates, including 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), and two ribosomal RNAs (rRNAs). The arrangements of these mitochondrial genes are the same in T. anguliceps and T. ngoclinhensis, but some genes have slight differences in their lengths, start
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Oral squamous cell carcinoma (OSCC) is a heterogeneous malignancy with rapid progression, limited therapeutic options, and poor prognosis. Epigenetic alterations - including DNA methylation, histone modifications, and noncoding RNA (ncRNA) regulation - are key drivers of oncogene activation and tumor suppressor silencing, offering novel therapeutic opportunities.
AREAS COVERED: This review summarizes the major epigenetic mechanisms in OSCC and highlights recent progress in therapeutic agents and molecular targets. In particular, we emphasize ncRNA-based modulators, such as micro
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Acute myeloid leukemia (AML), the most prevalent type of blood cancer, is initiated in the bone marrow and eventually migrates into the blood. It accounts for a 5-year overall survival rate of 29.8 %. AML results from the formation of immature white blood cells, also called AML blasts, from hematopoietic stem cells which eventually give rise to abnormal white blood cells, termed AML cells. The interaction of AML cells with their microenvironment appears to be significantly important in the pathogenesis of AML. A growing body of evidence identifies extracellular vesicles (EVs) to be a key compo
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Exosomes play a crucial role in regulating extracellular communication between normal and cancer cells within the tumor microenvironment, thereby affecting tumor progression through their cargo molecules. However, the specific impact of exosomal circular RNAs (circRNAs) on the development of cadmium-induced carcinogenesis remains unclear. To address this, we investigated whether exosomes derived from normal human bronchial epithelial BEAS-2B (N-B2B) cells could transmit circRNA to cadmium-transformed BEAS-2B (Cd-B2B) cells and the potential effects on Cd-B2B cells. Our findings demonstrated a
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Lowering the levels of LDL cholesterol in the plasma has been shown to reduce the risk of atherosclerotic cardiovascular disease (ASCVD). Several other lipoproteins, such as triglyceride-rich lipoproteins, HDL and lipoprotein(a) are associated with atherosclerosis and ASCVD, with strong evidence supporting causality for some. In this Review, we discuss novel and upcoming therapeutic strategies targeting different pathways in lipid metabolism to potentially attenuate the risk of cardiovascular events. Key proteins involved in lipoprotein metabolism, such as PCSK9, angiopoietin-related protein 3
СтатьяОбзорПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования