BACKGROUND: The fungal pathogen Histoplasma capsulatum is thought to be the most common cause of fungal respiratory infections in immunocompetent humans, yet little is known about its biology. Here we provide the first genome-wide studies to experimentally validate its genome annotation. A functional interrogation of the Histoplasma genome provides critical support for continued investigation into the biology and pathogenesis of H. capsulatum and related fungi.
RESULTS: We employed a three-pronged approach to provide a functional annotation for the H. capsulatum G217B strain. First, we probed
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
An outbreak of rabies affected domestic raccoon dogs on an animal farm in Inner Mongolia, China in 2007. A study was conducted to characterize the aetiological agent and clarify the origin of the rabies virus. Brain tissues were obtained from five rabid raccoon dogs. Viral nucleoprotein antigen was detected in the brain tissues and five rabies viruses were isolated from these rabid animals. Phylogenetic analysis of the N and G gene sequences showed that these isolates were closely related to Arctic-like rabies viruses isolated from the far-eastern region of Russia and South Korea, but distinct
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Venoms from the Armenian mountain vipers Macrovipera lebetina obtusa and Vipera raddei were analyzed by RP-HPLC, N-terminal sequencing, MALDI-TOF mass fingerprinting and CID-MS/MS. The venom proteins of M.l. obtusa and V. raddei belong to 9 and 11 families, respectively. The two mountain viper venoms share bradykinin-potentiating/C-natriuretic peptides, and proteins from the dimeric distegrin, DC-fragment, CRISP, PLA(2), serine proteinase, C-type lectin-like, L-amino acid oxidase, and Zn(2+)-dependent metalloproteinase families, albeit each species exhibits distinct relative abundances. M.l. o
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Elongation factor Tu (EF-Tu), encoded by tuf genes, carries aminoacyl-tRNA to the ribosome during protein synthesis. Duplicated tuf genes (tufA and tufB), which are commonly found in enterobacterial species, usually coevolve via gene conversion and are very similar to one another. However, sequence analysis of tuf genes in our laboratory has revealed highly divergent copies in 72 strains spanning the genus Yersinia (representing 12 Yersinia species). The levels of intragenomic divergence between tufA and tufB sequences ranged from 8.3 to 16.2% for the genus Yersinia, which is significantly gre
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Actinomyces spp., predominant members of human oral biofilms, may use extracellular sialidase to promote adhesion, deglycosylate immunoglobulins and liberation of nutrients. Partial nanH gene sequences (1,077 bp) from Actinomyces oris (n=74), Actinomyces naeslundii (n=30), Actinomyces viscosus (n=1) and Actinomyces johnsonii (n=2) which included the active-site region and the bacterial neuraminidase repeats (BNRs) were compared. The sequences were aligned and each species formed a distinct cluster with five isolates having intermediate positions. These five isolates (two A. oris and three A. n
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The complete sequence of the Taenia saginata mitochondrial genome was determined, and its organization and structure were compared to other human-tropic Taenia tapeworms for which complete mitochondrial sequence data were available. The mitochondrial genome was 13,670 bp long, contained 12 protein-coding genes, two ribosomal RNAs (rRNAs, a small and a large subunit), and 22 transfer RNAs (tRNAs). It did not encode the atp8 gene. Overlapping regions were found between nad4L and nad4, nad1 and trnN, and cox1 and trnT. The ATG initiation codon was used for 10 protein-coding genes, and the GTG ini
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A seventh member of the human beta4-galactosyltransferase family, beta4Gal-T7, was identified by BLAST analysis of expressed sequence tags. The coding region of beta4Gal-T7 depicts a type II transmembrane protein with sequence similarity to beta4-galactosyltransferases, but the sequence was distinct in known motifs and did not contain the cysteine residues conserved in the other six members of the beta4Gal-T family. The genomic organization of beta4Gal-T7 was different from previous beta4Gal-Ts. Expression of beta4Gal-T7 in insect cells showed that the gene product had beta1,4-galactosyltransf
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Anticancer peptides (ACPs) have emerged as promising therapeutic candidates for cancer treatment due to their high efficacy and low propensity for inducing drug resistance. However, existing ACP identification methods primarily rely on peptide sequence features while neglecting spatial structural characteristics. Moreover, few approaches can simultaneously predict the functional activity of ACPs. To address these limitations, this study proposes Multi-ACPNet, a novel dual-function predictor capable of both ACP identification and activity type classification. This model innovatively integrates
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Solving the structure of mRNA transcripts is a major challenge for both research and molecular diagnostic purposes. Current approaches based on short-read RNA sequencing and RT-PCR techniques cannot fully explore the complexity of transcript structure. The emergence of third-generation long-read sequencing addresses this problem by solving this sequence directly. However, genes with low expression levels are difficult to study with the whole transcriptome sequencing approach. To fix this technical limitation, we propose a novel method to capture transcripts of a gene panel using a
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To identify the pathogenic mutation in a family affected with tuberous sclerosis.
METHODS: For the proband and its parents, mutational hotspots in the 11 exons of TSC1 and TSC2 gene were analyzed with DNA sequencing and bioinformatics tools.
RESULTS: A heterozygous c.4493G>C missense mutation was identified in the proband. The same mutation was however not found in the parents.
CONCLUSION: The missense mutation c.4493G>C probably underlie the tuberous sclerosis complex seen in the child.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Rickettsia prowazekii, an obligate intracellular Gram-negative bacterium, is the etiologic agent of epidemic typhus. We analyzed the proteome of the virulent Breinl strain of R. prowazekii purified from infected egg yolk sacs. Total proteins from purified R. prowazekii Breinl strain were reduced by dithiothreitol, alkylated by iodoacetic acid and digested with trypsin followed by analysis with an integrated two-dimensional liquid chromatography and mass spectrometry system (2D-LC/MS/MS). A comparison was made using previously analyzed proteome of the Madrid E strain and current analysis of the
Сравнительное исследованиеСтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Norrie disease (ND) is a rare X-linked recessive disorder characterized by congenital blindness and in some cases, mental retardation and deafness. Other neurological complications, particularly epilepsy, are rare. We report on a novel mutation identified in a patient with ND and profound mental retardation. The patient was diagnosed at the age of 6 months due to congenital blindness. At the age of 8 months he developed infantile spasms, which were diagnosed at 11 months as his EEG demonstrated hypsarrhythmia. Mutation analysis of the ND gene (NDP) of the affected child and his mother revealed
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report a nonfatal case of streptococcal toxic shock syndrome (STSS) caused by a Streptococcus pyogenes emm118 strain encoding a novel variant of streptococcal mitogenic exotoxin Z (SMEZ-34). This variant was responsible for the major mitogenic activity in the cell culture supernatant. Patient sera showed seroconversion toward SMEZ, implying a role for this toxin in STSS.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dermatan sulfate (DS) proteoglycans (PGs) were extracted from human post-burn scar (Sc) tissues with 4M guanidinium chloride and isolated from the extracts by DEAE-cellulose chromatography and by differential ethanol precipitation. The DS.PGs were further purified by Sepharose CL-6B column chromatography. The average molecular weight (Mr) of hypertrophic scar (HSc) tissue DS.PGs was 39,000 based on sedimentation equilibrium measurements. Alkaline borohydride treatment of DS.PGs liberated glycosaminoglycan (GAG) chains and the presence of xylitol indicated that these chains were attached to pro
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A panel of 12 Burkitt's lymphoma cell lines and four other B cell lines were tested for the presence of mutations in p53. Protein analysis using a mutant-specific antibody and sequencing of both cDNA and genomic DNA revealed changes relative to the standard p53 protein sequence in 12 of the 16 lines studied, including 10 of the BL lines. Mutation of p53 in the BL lines was usually accompanied by loss of the other allele of p53. Testing of the mutated p53 cDNAs for gain of transforming activity or loss of growth suppression activity showed that several of the BL mutants were functionally altere
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Peste des petits ruminants virus (PPRV) causes an acute febrile illness in small ruminant species, mostly sheep and goats. PPRV is a member of the Morbillivirus genus which includes measles, rinderpest (cattle plague), canine distemper, phocine distemper and the morbilliviruses found in whales, porpoises and dolphins. Full length genome sequences for these morbilliviruses are available and reverse genetic rescue systems have been developed for the viruses of terrestrial mammals, with the exception of PPRV. This paper presents the first published full length genome sequence for PPRV. The genome
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snake venom thrombin-like enzymes (SVTLEs) constitute the major portion (10-24%) of snake venom and these are the second most abundant enzymes present in the crude venom. During envenomation, these enzymes had shown prominently the various pathological effects, such as disturbance in hemostatic system, fibrinogenolysis, fibrinolysis, platelet aggregation, thrombosis, neurologic disorders, activation of coagulation factors, coagulant, procoagulant etc. These enzymes also been used as a therapeutic agent for the treatment of various diseases such as congestive heart failure, ischemic stroke, thr
Сравнительное исследованиеСтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Genome-wide association studies (GWAS) have pinpointed a multitude of risk loci associated with Juvenile Idiopathic Arthritis (JIA), but it is challenging to decipher novel plasma proteins. To address this, we applied an integrative omics pipeline to uncover novel proteins associated with JIA risk.
METHODS: In this research, we utilized an integrative omics method to identify new plasma proteins associated with JIA. Complementary results from an independent cohort were analyzed through Whole Genome Sequencing (WGS), single-cell RNA sequencing (scRNA-seq), and bulk RNA sequencing (
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Rheumatoid arthritis (RA) is a chronic autoimmune disease characterized by symmetric joint swelling, pain, and progressive bone destruction. Although the advent of biologic therapies has significantly improved treatment outcomes, challenges remain in early detection and timely intervention. This study utilizes a nested case-cohort design from the UK Biobank (UKB), integrating proteomics, genome-wide association studies (GWAS), and single-cell RNA sequencing data from the GEO database to systematically evaluate proteins associated with RA risk and identify novel therapeutic targets. Through Cox
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования