Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Serum amyloid A (SAA) is the principal precursor of AA amyloidosis, yet the early molecular steps that trigger its pathological misfolding remain unclear. Here, we combine harmonic linear discriminant analysis (HLDA) and parallel-tempering metadynamics (PT-MetaD) to dissect the earliest conformational transitions of the disease-relevant SAA1-76 fragment. By constructing an optimized one-dimensional collective variable (sHLDA) from interhelix contacts and helical root-mean-square deviations, we perform 4 μs of enhanced sampling across 79 replicas (300-450 K). Free-energy surfaces reveal a misfo
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This article critically analyses provisions in the Mental Health Bill 2025 that, if passed, will amend the Mental Health Act (MHA) 1983 to create a power for tribunals and the Justice Secretary to discharge restricted patients from hospital subject to conditions that deprive them of their liberty in the community. These provisions pose a threat to the human rights of patients who straddle the divide between the mental health and criminal justice systems. Furthermore, the provisions and the cases that preceded them expose the limits of policies of de-institutionalisation and official ambitions
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A synthesis of free-air CO2 enrichment (FACE) experiments describing the response of forest net primary productivity (NPP) to elevated atmospheric CO2 published in 2005 has provided a valuable benchmark for ecosystem models used to address the impact of future atmospheric CO2 levels on forest productivity and the feedback to the atmosphere and climate change. However, that analysis was limited to young, temperate zone tree plantations, and its applicability to other biomes can be questioned. Now, after 20 years, this new analysis includes two sites in much older, mature forests and expanded an
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The neurotoxin methylmercury (MeHg) is produced mainly from the transformation of inorganic Hg by microorganisms carrying the hgcAB gene pair. Paddy soils are known to harbor diverse microbial communities exhibiting varying abilities in methylating inorganic Hg, but their distribution and environmental drivers remain unknown at a large spatial scale. Using hgcA gene amplicon sequencing, this study examined Hg-methylating communities from major rice-producing paddy soils across a transect of ∼3600 km and an altitude of ∼1300 m in China. Results showed that hgcA+ OTU richness was higher in tropi
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Perimenopause is characterized by ovarian hormone fluctuation and associated with elevated risk for depression. Perimenopausal-onset major depression (PO-MDD) can be alleviated with estrogen treatment. However, due to potential risk for breast and uterine cancer, traditional hormone treatments may not be suitable for some. Conjugated estrogen combined with the selective estrogen receptor modulator (SERM) bazedoxifene (CEB) is a tissue selective estrogen complex (TSEC) used to target hot flashes and postmenopausal osteoporosis. CEB's effect on mood during perimenopause remains under
СтатьяКлиническое исследованиеПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hard-bodied ticks (Acari: Ixodidae) pose a major public health threat, transmitting multiple pathogens among humans and wildlife worldwide. Research has investigated how anthropogenic land use change impacts tick density and infection prevalence in temperate forests, including the effects of active forest management practices like prescribed burning, invasive vegetation removal and timber harvesting. However, studies' results are inconsistent and seemingly context-dependent, making it difficult for land managers, landowners and policy makers to identify whether management addresses the public
СтатьяСистематический обзорМетаанализПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Allium ursinum (wild garlic) has long been collected and consumed as food and medicine in the north temperate zone, where its popularity is growing. Colchicum autumnale and Convallaria majalis contain toxic alkaloids. Their habitats overlap, and without flowers, their vegetative organs are similar. Confusing the leaves of Colchicum or Convallaria with the leaves of wild garlic has repeatedly led to serious human and animal poisonings. Our goal was to find a histological characteristic that makes the separation of these leaves clear. We compared the anatomy of foliage leaves of these three spec
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This case study evaluated Ayurvedic and yoga treatment for Generalized Anxiety Disorder (GAD) in a 14-year-old female with a short temper. Symptoms were assessed using the Clinical Anger Scale and the Hamilton Anxiety Rating Scale (HAM-A). Before treatment, the patient scored 31 out of 48 on the HAM-A and 31 out of 63 on the Clinical Anger Scale. After 30 days, the patient's scores improved to 8 out of 48 on the HAM-A and 10 out of 63 on the Clinical Anger Scale. Cortisol levels decreased from 25.1 µg/dl to 15.8 µg/dl. Ayurvedic oral medicine (like Kushmanda Ghrita,Bhrami Vati), Panchakarma th
СтатьяКлинический случайПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The COVID-19 pandemic disrupted medical conferences, where restrictions on public gatherings resulted in the postponement or cancellation of in-person meetings. Virtual events emerged as a substitute, providing a mechanism for scientific collaboration and continuing medical education with the additional benefit of low environmental impact. However, digital events may not meet all the needs of delegates, such as professional networking and social connection. In this report, we describe the methods used to minimise the carbon footprint of the 2023 Australian and New Zealand College of Anaestheti
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The amyloid cascade hypothesis as the etiological underpinning of Alzheimer disease (AD) is supported by a large body of literature, the most influential of which are genetic studies of the 1980s and 1990s. Other evidence includes the neuropathology of Down syndrome, apparent toxicity of oligomeric amyloid-β (Aβ), interactions with apolipoprotein E, and the analogy of cardiac amyloidosis. However, there is considerable phenotypic heterogeneity among the rare familial AD kindreds, which tempers extrapolation to sporadic AD. Oligomer biology is still in the theoretical realm, with no clinical va
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cyathostomins are globally important equine parasites, responsible for both chronic and acute pathogenic effects. The occurrence of mixed infections with numerous cyathostomin species hinders our understanding of parasite epidemiology, host-parasite dynamics, and species pathogenicity. There have been few studies of cyathostomin species occurring in horses in Ireland, where temperate climatic conditions with year-round rainfall provide suitable conditions for infection of grazing animals with bursate nematodes. Here, we amplified and sequenced the ITS-2 region of adult worms harvested at post-
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Canine dirofilariosis is a mosquito-borne zoonotic disease largely caused by Dirofilaria immitis. Mainly present in temperate, semitropical, and tropical areas, its worldwide emergence and spread are causing concern. In Argentina, most cases have been reported in humid regions of the center and northeast of the country. The occurrence of canine dirofilariosis in an arid environment of western Argentina was investigated by blood smears, microhematocrit tube test, and Knott's technique. Association and odds ratio were determined in relation to dog characteristics. Thirty-three dogs (51.6%) had m
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dengue fever is an infectious disease caused by the dengue virus (DENV), an RNA Flavivirus transmitted by the mosquitoes Aedes aegypti and Aedes albopictus widespread in tropical, subtropical and also temperate regions. Symptoms range from a simple cold to a severe, life-threatening haemorrhagic fever. According to the WHO, it affects around 390 million people per year. No antiviral treatment for DENV is available, and the Dengvaxia vaccine is only intended for people over 9 years of age who have contracted dengue one time in the past, and shows serotype-specific effectiveness. There is theref
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aedes aegypti and Aedes albopictus are the main vectors of arboviruses such as dengue, Zika virus, and chikungunya. Ae. aegypti is a widely spread mosquito in tropical and subtropical regions, whereas Ae. albopictus is a culicid of Asian origin that shows exophilic behavior and can be found in subtropical and temperate areas. Climatic factors could influence the distribution of both species, making them use genetic and environmental resources to adapt to the environment, activating survival mechanisms (embryonic dormancy) that increase the developmental period and keep their offspring in the e
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Rabies is often described as the quintessential One Health problem, linking especially animal health to human health. I examined how rabies is managed in the circumpolar North through semi-structured interviews of key informants in three cases: Alaska, Northwest Territories, and Svalbard. While rabies is controlled at the territorial or state level in the Northwest Territories and Alaska, respectively, the perception of where authority lies in rabies management is less evident in Norway concerning Svalbard than in the other two cases. Respondents generally characterised the working relationshi
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Amphibians are considered critical species in the nutrient flow within and across ecosystems, and knowledge on their trophic ecology and niches is crucial for their conservation. For the first time we studied the trophic ecology of the rare and endemic Salamandra atra aurorae in a mixed temperate forest in northern Italy. We aimed to define the realized trophic niche, investigate the prey selectivity and explore possible levels of individual specialization. In summer 2022 we obtained stomach contents from 53 salamanders by stomach flushing and prey availability using pitfall traps. We used the
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The treatment landscape for hematologic malignancies has changed since the recent approval of highly effective chimeric antigen receptor T-cell therapies (CAR-T). Moreover, more than 600 active trials are currently ongoing. However, early enthusiasm should be tempered since several issues are still unsolved and represent the challenges for the coming years. The lack of initial responses and early relapse are some hurdles to be tackled. Moreover, new strategies are needed to increase the safety profile or shorten the manufacturing process during CAR-T cells therapy production. Nowadays, most cl
Полный текст найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The use of pharmacokinetic-pharmacodynamic models has improved anaesthesia practice in children through a better understanding of dose-concentration-response relationships, developmental pharmacokinetic changes, quantification of drug interactions and insights into how covariates (e.g., age, size, organ dysfunction, pharmacogenomics) impact drug prescription. Simulation using information from these models has enabled the prediction and learning of beneficial and adverse effects and decision-making around clinical scenarios. Covariate information, including the use of allometric size scaling, a
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Peripheral artery disease (PAD) impacts an estimated 230 million adults worldwide, including more than 9.5 million adults older than 40 years in the United States. PAD remains more underdiagnosed and undertreated than manifestations of atherosclerosis elsewhere in the body, such as coronary artery disease and cerebrovascular disease. Medical therapies benefit all patients with PAD, including those who are asymptomatic, as well as those with symptoms and advanced disease requiring intervention. Comprehensive medical management of PAD is based on tempering atherosclerotic disease processes and s
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования