Metalloproteinases are among the most abundant toxins in many Viperidae venoms. Snake venom metalloproteinases (SVMPs) are the primary factors responsible for hemorrhage and may also interfere with the hemostatic system, thus facilitating loss of blood from the vasculature of the prey. SVMPs are phylogenetically most closely related to mammalian ADAM (a disintegrin and metalloproteinase) and ADAMTS (ADAM with thrombospondin type-1 motif) family of proteins and, together with them, constitute the M12B clan of metalloendopeptidases. Large SVMPs, referred to as the P-III class of SVMPs, have a mo…
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snakebite envenomation (SBE) remains a major neglected tropical disease in sub-Saharan Africa, with West Africa accounting for a substantial proportion of global cases. In Benin, the true impact of SBE is underestimated due to limited epidemiological surveillance, delayed healthcare access, and limited availability of adequate urgent care. We report two fatal pediatric cases of severe Viperidae snakebite envenomation in children aged three and twelve years old managed at a rural hospital in Benin. Both patients died during hospitalization after developing severe coagulopathy despite antivenom …
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Venom is a dynamic trait that has contributed to the success of numerous organismal lineages. Predominantly composed of proteins, these complex cocktails are deployed for predation and/or self-defence. Many non-toxic physiological proteins have been convergently and recurrently recruited by venomous animals into their toxin arsenal. Phospholipase A2 (PLA2) is one such protein and features in the venoms of many organisms across the animal kingdom, including snakes of the families Elapidae and Viperidae. Understanding the evolutionary history of this superfamily would therefore provide insight i…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Protobothrops flavoviridis (habu) (Crotalinae, Viperidae) is a Japanese venomous snake, and its venom contains the enzymes with a variety of physiological activities. The phospholipases A2 (PLA2s) are the major components and exert various toxic effects. They are expressed abundantly in the venom gland. It is thought that the venom gland-specific transcription factors play a key role for activation of PLA2 genes specifically expressed in the venom gland. Thus, the full-length cDNA library for P. flavoviridis venom gland after milking of the venom was made to explore the transcription factors t…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the ve…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The EF-hand protein family is comprised of many proteins with conserved Ca(2+)-binding motifs with important biological roles in intracellular communication. During the generation of Expressed Sequence Tags (ESTs) from the venom glands of the Viperidae snake Bothrops insularis, we identified a cDNA coding for a putative Ca(2+) binding protein with four EF-hand motifs, named here calglandulin. The deduced amino acid sequence displayed the greatest sequence similarity with calmodulin (59%), followed by troponin-C (52%). The encoded polypeptide was first expressed in Escherichia coli as a 6XHis-t…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snake venoms have evolved over millions of years to subdue prey and deter predators rapidly. The potency and amount of venom differ both within and across species, and are primarily influenced by their ecology and environment. Understanding venom yields in clinically relevant species is essential for refining treatment approaches for snakebite. Despite this, venom yields have seldom been documented, especially in snakes of the Indian subcontinent. To address this knowledge gap, we analysed venom yields from 338 specimens of the clinically most important "big four" Indian snakes-Naja naja, Dabo
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snakebite primarily impacts rural communities of Africa, Asia, and Latin America. The sharp-nosed viper (Deinagkistrodon acutus) is among the snakes of highest medical importance in Asia. Despite various studies on its venom using modern venomics techniques, a comprehensive understanding of composition and function of this species' venom remains lacking. We combined proteogenomics with extensive bioactivity profiling to present the first genome-level catalogue of D. acutus venom proteins and their exochemistry. Our analysis identified an unusually simple venom containing 45 components from 20
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Puff Adder (Bitis arietans) is a viper native to Africa and the Middle East. Envenomation by this species often requires the administration of appropriate antivenom in order to achieve a favorable outcome. A patient was bitten in both hands by a captive B. arietans presented to a teaching hospital in Malaysia. The patient developed painful progressive swelling on both limbs that extended to the chest, hypotension, hypokalemia with worsening anemia, thrombocytopenia, coagulopathy, and severe metabolic acidosis. The patient was managed supportively while waiting for the appropriate antivenom
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This report describes three cases of human envenomation by the asp viper (Vipera aspis) in Piedmont, north-west Italy. A woman was bitten on the ankle while she was hiking and two herpetologists received bites on the hand while they were manipulating the animals. In the first case, the victim presented severe systemic symptoms (abdominal pain, vomiting, diarrhea) that required treatment with two vials of antivenom and hospitalization for one week. In the second case, the patient manifested neurological symptoms (blepharoptosis, ophtalmoplegia); he was treated with antivenom and discharged afte
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coagulopathy with defibrination is one of symptoms accompanying snakebite envenoming, where life-threatening complications such as massive bleeding and organ hematomas formation can occur. Here, we report a case of hemocoagulation failure due to bite by African Great Lakes bush viper Atheris nitschei with impossibility of specific treatment for absence of antivenom and its life-threatening complication: very rare and unexpected atraumatic splenic rupture with massive hemoperitoneum and necessity of urgent splenectomy.
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ecarin is one of the most widely used drug compounds in blood clotting experiments and is used to monitor and treat many diseases such as cancer, liver, lupus, and cardiovascular disease. The metalloproteinase domain is known as the active site of ecarin. In this study, an ecarin metalloproteinase cassette was designed and synthesized in the pUC57 vector. The gene fragment was released and cloned into the pET-28a vector and expressed in Escherichia coli. The recombinant protein was confirmed by western blotting. Enzyme activity was estimated by a laboratory coagulation test, and prothrombin ti
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Skeletal muscle regeneration after myonecrosis involves the activation, proliferation and fusion of myogenic cells, and a coordinated inflammatory response encompassing phagocytosis of necrotic cell debris, and the concerted synthesis of cytokines and growth factors. Myonecrosis often occurs in snakebite envenomings. In the case of venoms that cause myotoxicity without affecting the vasculature, such as those of many elapid snakes, regeneration proceeds successfully. In contrast, in envenomings by most viperid snakes, which affect the vasculature and extracellular matrix in addition to muscle
СтатьяПоддержка исследования: вне правительства СШАОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In our previous work, a thrombin-like enzyme (TLE), agkihpin, was successfully isolated, purified, cloned and named from the venom of Gloydius halys Pallas, having fibrinolytic, fibrinogenolytic and thrombosis-reduced activities, attenuating migration of liver cancer cell, and without bleeding risk. To explore the possibility of agkihpin as a thrombolytic and/or anti-metastasis agent in the future, in this study recombinant agkihpin was expressed and purified in Escherichia coli, and its biological activities investigated. Thus, r-agkihpin-2 was successfully expressed and purified and confirme
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Snake venoms constitute a very promising resource for the development of new medicines. They are mainly composed of very complex peptide and protein mixtures, which composition may vary significantly from batch to batch. This latter consideration is a challenge for routine quality control (QC) in the pharmaceutical industry. In this paper, we report the use of capillary zone electrophoresis for the development of an analytical fingerprint methodology to assess the quality of snake venoms. The analytical fingerprint concept is being widely used for the QC of herbal drugs but rarely for venoms Q
Оценочное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Venoms are among the most biologically active secretions known, and are commonly believed to evolve under extreme positive selection. Many venom gene families, however, have undergone duplication, and are often deployed in doses vastly exceeding the LD50 for most prey species, which should reduce the strength of positive selection. Here, we contrast these selective regimes using snake venoms, which consist of rapidly evolving protein formulations. Though decades of extensive studies have found that snake venom proteins are subject to strong positive selection, the greater action of drift has b
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: We conducted an in-depth analysis of the proteomic and biochemical profiles of the venom of neonate and adult short-tailed pit vipers (Gloydius brevicaudus). Identified proteins were assigned to a few main toxin families. Disintegrin, phospholipase A2 (PLA2), serine proteinase, cysteine-rich secretory protein, C-type lectin-like protein, l-amino acid oxidase and snake venom metalloproteinase (SVMP) were detected in both venoms, while 5'-nucleotidase was detected only in the adult venom. SVMP was the predominant protein family in both venoms (neonate: 65.7%; adult: 64.4%), followed
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite being large, heavy-bodied snakes, puff adders (Bitis arietans) are capable of achieving strike velocities and accelerations similar to, or greater than, those of much smaller snakes (means of 2.6 and 72 m/sec(2), respectively). The mechanistic basis of the strike was examined using high-speed digital videography, coupled with electromyographic (EMG) analysis, of the two main extensors of the vertebral column, the semispinalis and longissimus. Although the strike involves the rapid extension of preformed body curves, the extensor muscles were not electrically active during body extensio
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Isolate and characterize in silico gene phospholipase A(2) (PLA(2)) isolated from Lachesis muta venom of the Peruvian Amazon.
MA … ) from Lachesis stenophrys (93%) and other PLA(2) snake venoms and over 80% of other sPLA(2) family Viperidae venoms. A phylogenetic analysis showed that Lm-PLA(2)-Peru grouped with other acidic [Asp(49)] sPLA(2) previously isolated from Bothriechis schlegelii venom showing 89 % nucleotide sequence identity. Finally, the computer modeling indicated that enz …
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bites from the adder, Vipera Berus, can have serious clinical consequences due to systemic effects. Meanwhile, the local swelling calls for attention as well. Two cases of seven- and eleven-year-old boys are reported. The first patient was bitten in the 5th toe, the second in the thumb. Both developed fasciotomy-requiring compartment syndrome of the lower and upper limb, respectively. Recognition of this most seldom complication of an adder bite is vital to save the limb. We recommend that the classical signs and symptoms of compartment syndrome serve as indication for surgery. However, compar
Клинический случайАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования