17beta-Hydroxysteroid dehydrogenase type 3 (17beta-HSD-3) is a member of the short-chain dehydrogenase/reductase (SDR) family and is essential for the reductive conversion of inactive C(19)-steroid, androstenedione, to the biologically active androgen, testosterone, which plays a central role in the development of the male phenotype. Mutations that inactivate this enzyme give rise to a rare form of male pseudohermaphroditism, referred to as 17beta-HSD-3 deficiency. One such mutation is the replacement of arginine at position 80 with glutamine, compromising enzyme activity by increasing the cof
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
An inherited deficiency in beta-galactosidase can result in GM1 gangliosidosis, with several phenotypes of generalized or chronic psychomotor deterioration, as well as in Morquio disease type B, a characteristic mucopolysaccharidosis free of neurological symptoms. We performed mutation analyses in 17 juvenile and adult patients from various European regions with a deficiency in beta-galactosidase and skeletal abnormalities. Fifteen of these had the Morquio B phenotype and have remained neurologically healthy until now while the two others exhibited psychomotor retardation of juvenile onset. A
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology2000eng
In the present study, the potential involvement of Streptococcus oralis in the aetiology of recurrent aphthous stomatitis (RAS) was investigated using the polymerase chain reaction (PCR). Biopsies from 28 RAS patients were analysed, in addition to 20 oral lichen planus (OLP) and 13 normal biopsies that were used as controls. PCR was carried out using a primer pair that targets the D-alanine:D-alanine ligase gene and detects DNA from both S. oralis and the closely related species Streptococcus mitis. Discrimination between these two species was achieved by digestion of PCR products with the res
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The soluble MMO (sMMO) gene clusters from group I methanotrophs were characterized. An 8.1-kb KpnI fragment from Methylomonas sp. strain KSWIII and a 7.5-kb SalI fragment from Methylomonas sp. strain KSPIII which contained the sMMO gene clusters were cloned and sequenced. The sequences of these two fragments were almost identical. The sMMO gene clusters in the fragment consisted of six open reading frames which were 52 to 79% similar to the corresponding genes of previously described sMMO gene clusters of the group II and group X methanotrophs. The phylogenetic analysis of the predicted amino
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The proto-oncogene, BCL-2, has been suggested to participate in cell survival during development of, and after injury to, the CNS. Transgenic (TG) mice overexpressing human Bcl-2 (n = 21) and their wild-type (WT) littermates (n = 18) were subjected to lateral controlled cortical impact brain injury. Lateral controlled cortical impact brain injury resulted in the formation of a contusion in the injured cortex at 2 days, which developed into a well-defined cavity by 7 days in both WT and TG mice. At 7 days after injury, brain-injured TG mice had a significantly reduced cortical lesion (volume =
СтатьяПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Germline mutations in PKD2 cause autosomal dominant polycystic kidney disease. We have introduced a mutant exon 1 in tandem with the wild-type exon 1 at the mouse Pkd2 locus. This is an unstable allele that undergoes somatic inactivation by intragenic homologous recombination to produce a true null allele. Mice heterozygous and homozygous for this mutation, as well as Pkd+/- mice, develop polycystic kidney and liver lesions that are indistinguishable from the human phenotype. In all cases, renal cysts arise from renal tubular cells that lose the capacity to produce Pkd2 protein. Somatic loss o
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Salicylate is a precursor of pyochelin in Pseudomonas aeruginosa and both compounds display siderophore activity. To elucidate the salicylate biosynthetic pathway, we have cloned and sequenced a chromosomal region of P. aeruginosa PAO1 containing two adjacent genes, designated pchB and pchA, which are necessary for salicylate formation. The pchA gene encodes a protein of 52 kDa with extensive similarity to the chorismate-utilizing enzymes isochorismate synthase, anthranilate synthase (component I) and p-aminobenzoate synthase (component I), whereas the 11 kDa protein encoded by pchB does not s
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Laminin 5 consists of three polypeptides, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. In this study, we have elucidated the exon-intron organization of the human LAMB3 gene. Characterization of five overlapping lambda phage DNA clones revealed that the gene was approximately 29 kb in size. Subsequent sequence data revealed that the gene consisted of 23 exons that varied from 64 to 379 bp in size, accounting for the full-length cDNA with an open reading frame of 3516 bp encoding 1172 amino acids. Comparison of the LAMB3 gene structure with the previ
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were diff
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A functionally active 17.5 kDa peptidyl-prolyl cis-trans isomerase was purified to homogeneity from Streptomyces chrysomallus, a Gram-positive filamentous bacterium. Characterization of the enzyme revealed inhibition and binding characteristics, against the immunsuppressive drug cyclosporin A, which were similar to cyclophilins from eukaryotes such as mammals, plants, fungi and yeasts, but different from those of cyclophilins from enterobacteria such as Escherichia coli. The amino acid sequence of the S. chrysomallus cyclophilin, as deduced from the gene sequence, revealed a striking degree of
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The N-terminal amino acid sequence of purified acetaldehyde dehydrogenase II (AcDH-II) from ethanol-grown cells of Alcaligenes eutrophus was determined. By using oligonucleotides deduced from this sequence the structural gene for AcDH-II, which was referred to as acoD, was localized on a 7.2-kbp EcoRI restriction fragment (fragment D), which has been cloned recently (C. Fründ, H. Priefert, A. Steinbüchel, and H. G. Schlegel, J. Bacteriol. 171:6539-6548, 1989). A 2.8-kbp PstI subfragment of D, which harbored acoD, was sequenced. It revealed an open reading frame of 1,518 bp, encoding a protein
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Two gross intragenic deletions of the retinoblastoma (RB) gene from patients with sporadic hereditary disease were analysed in detail. This study was undertaken to determine whether there were common mechanisms for these deletions and whether changes found in the tumors were identical to those found in the constitutional cells. Short repeats at the deletion breakpoints were found in both tumors, one resulting in a 2.0 kb deletion including exons 21 and 22, and the other producing a 3.7 kb deletion including exons 14-17. In addition, the identical sequence changes documented in genomic DNAs and
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The purpose of the present study was to validate the reliability of audiometric testing procedures in the identification of carriers of Norrie's disease by using DNA analysis. Potential female carriers of Norrie's disease were investigated by means of Békésy tracing audiometry and stapedial reflex thresholds previously found to reveal carriers of recessively inherited hearing impairment by means of peculiar 'dips' and elevation in the thresholds. Relating the audiometric test results to the outcome of the DNA analysis the previous findings could not be confirmed. In addition no concordance bet
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The kefC gene of Escherichia coli encodes a potassium-efflux system that is regulated by glutathione metabolites. The close proximity of the E. coli kefC gene to the folA gene, encoding dihydrofolate reductase, has been utilized to clone the structural gene for the system from a Clarke-Carbon plasmid. The cloned gene has been refined to a region of DNA approximately 2.1 kb in length using exonuclease III-generated deletions and random MudII1734 (lacZ) insertions. The direction of transcription has been deduced from the orientation of the Mu insertions in the cloned DNA. A hybrid protein consis
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Malignant hyperthermia (MH) causes neurological, liver, and kidney damage and death in humans and major economic losses in the swine industry. A single point mutation in the porcine gene for the skeletal muscle ryanodine receptor (ryr1) was found to be correlated with MH in five major breeds of lean, heavily muscled swine. Haplotyping suggests that the mutation in all five breeds has a common origin. Assuming that this is the causal mutation for MH, the development of a noninvasive diagnostic test will provide the basis for elimination of the MH gene or its controlled inclusion in swine breedi
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Four Y-specific DNAs of different sizes were isolated by screening a human Y-chromosome gene-library. After determining their structural characteristics, the possibility for their clinical application was examined. The results are as follows: 1. The 4 cloned DNAs had inserts of 3.3, 2.0, 1.9 and 1.4 kb; they were subcloned into plasmid pUC19, and designated pKY-2, pKY-3, pKY-4 and pKY-5, respectively. 2. All four clones hybridized specifically with the Y-specific 3.5 kb DNA but not with female DNA. However, they did not cross-hybridize with the 2.1 kb fragment known to be another Y-specific re
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Overexpression of an activated form of the p53 protein may be involved in neoplastic transformation. We found widespread overexpression of p53 by immunohistochemical staining in 11 (22%) of 49 primary invasive human breast cancers. Northern blot analysis showed that this overexpression was not due to an increase in the steady-state level of p53 mRNA. The p53 gene was directly sequenced in 7 of these tumors with elevated levels of the protein and, in each case, a mutation that altered the coding sequence for p53 was found in a highly conserved region of the gene. Whereas 4 of these tumors conta
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genes encoding proteins involved in the function of the nervous system can be identified via mutations causing behavioral abnormalities. An example is ether à go-go (eag) in Drosophila melanogaster, which was identified originally as an X-linked mutation that displayed ether-induced leg-shaking behavior. Electrophysiological and genetic evidence suggests that the product of the eag locus is intimately involved in the normal functioning of one or more types of voltage-gated potassium channels. To initiate a molecular analysis of eag we first generated a collection of deletions to pinpoint its c
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A large outbreak of epidemic keratoconjunctivitis occurred in Alice Springs, Australia, between July and September 1989. Initially, there was a large outbreak within two child care centers, followed by a more prolonged outbreak within the community. A simultaneous outbreak occurred among staff at the local hospital. Infected children developed mild conjunctivitis, whereas adults developed typical keratoconjunctivitis. Conjunctival swabs from 30 cases were cultured and adenovirus was recovered from 18, all of which were typed by neutralization assay as adenovirus type 8. DNA restriction fragmen
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования