The filarioid nematode Dirofilaria immitis is the causative agent of heartworm disease, a major parasitic infection of canids, felids and occasionally humans. Current prevention relies on macrocyclic lactone-based chemoprophylaxis, but the emergence of drug resistance highlights the need for new intervention strategies. Here, we applied a machine learning (ML)-based framework to predict and prioritise essential genes in D. immitis in silico, using genomic, transcriptomic and functional datasets from the model organisms Caenorhabditis elegans and Drosophila melanogaster. With a curated set of 2
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MicroRNAs have emerged as key regulators of immune responses. They influence immune cells' function and probably the outcome of several infections. Currently, it is largely unknown if helminth parasites and their antigens modify host microRNAs expression. The aim of this study was to explore if excreted/secreted antigens of Taenia crassiceps regulate LPS-induced miRNAs expression in human dendritic cells. We found that these antigens repressed LPS-let-7i induction but not mir-146a or mir-155 and this correlates with a diminished inflammatory response. This let-7i downregulation in dendritic ce
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Nematodes include species that are significant parasites of man, his domestic animals and crops, and cause chronic debilitating diseases in the developing world; such as lymphatic filariasis and river blindness caused by filarial species. Around one third of the World's population harbour parasitic nematodes; no vaccines exist for prevention of infection, limited effective drugs are available and drug resistance is an ever-increasing problem. A critical structure of the nematode is the protective cuticle, a collagen-rich extracellular matrix (ECM) that forms the exoskeleton, and is critical fo
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The coevolution of humans and infectious agents has exerted selective pressure on the immune system to control potentially lethal infections. Correspondingly, pathogens have evolved with various strategies to modulate and circumvent the host's innate and adaptive immune response. Schistosoma species are helminth parasites with genes that have been selected to modulate the host to tolerate chronic worm infections, often for decades, without overt morbidity. The modulation of immunity by schistosomes has been shown to prevent a range of immune-mediated diseases, including allergies and autoimmun
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Germline transformation of a parasitic nematode of mammals has proven to be an elusive goal. We report here the heritable germline transformation of Parastrongyloides trichosuri, a nematode parasite whose natural hosts are Australian possums of the genus Trichosurus. This parasite can undergo multiple free-living life cycles and these replicative cycles can be maintained indefinitely in the laboratory. Transformation was achieved by microinjection of DNA into the ovary syncytium of either free-living or parasitic adult females. By selecting for the transgenic progeny of successive free-living
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Herein we describe, to our knowledge for the first time the use of the clustered regularly interspaced short palindromic repeats/CRISPR-associated gene 9 (CRISPR/Cas9) system for genome editing of Neospora caninum, an apicomplexan parasite considered one of the main causes of abortion in cattle worldwide. By using plasmids containing the CRISPR/Cas9 components adapted to the closely related parasite Toxoplasma gondii, we successfully knocked out a green fluorescent protein (GFP) in an Nc-1 GFP-expressing strain, and efficiently disrupted the NcGRA7 gene in the Nc-Spain7 isolate by insertion of
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Schistosomiasis is a prevalent, socioeconomically important disease of humans caused by parasites of the genus Schistosoma (schistosomes or blood flukes). Currently, more than 200 million people worldwide are infected with schistosomes. Despite major research efforts, there is only one drug routinely used for effective treatment, and no vaccine is available to combat schistosomiasis. The purpose of the present article is to (1) provide a background on the parasites and different forms of disease; (2) describe key immunomolecular aspects of disease induced in the host; and (3) critically apprai
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The possible emergence of resistance to the only available drug for schistosomiasis spurs drug discovery that has been recently incentivized by the availability of improved transcriptome and genome sequence information. Transient RNAi has emerged as a straightforward and important technique to interrogate that information through decreased or loss of gene function and identify potential drug targets. To date, RNAi studies in schistosome stages infecting humans have focused on single (or up to 3) genes of interest. Therefore, in the context of standardizing larger RNAi screens, data
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human filarial nematodes cause river blindness and lymphatic filariasis, both of which are diseases that produce considerable morbidity. Control of these diseases relies on drug treatments that are ineffective against macrofilariae and are threatened by the development of resistance. New validated drug targets are required to allow development of new classes of antifilarial drugs. To identify and validate potential new drug targets, we propose a collaborative research strategy utilizing bioinformatic filters and assessment of gene function by RNA interference in Caenorhabditis elegans and Brug
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The identification and characterization of a recombinant cDNA clone, designated OV9M, expressing an antigen present in Onchocerca volvulus infective larvae and adult stages is described. Clone OV9M was identified by screening a lambda gt11 cDNA expression library derived from adult O. volvulus mRNA using pooled rabbit antisera raised against the third (L3) and fourth (L4) stage larvae of the parasite. The cDNA clone encodes an open reading frame of 238 amino acids corresponding to a 27-kDa polypeptide. This polypeptide contains a series of five highly conserved repeats of 25 amino acids that a
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Helminth infections continue to pose major challenges in human and veterinary medicine, with additional complications arising from the emergence of anthelmintic resistance. Anisakis simplex sensu stricto (A. simplex s.s.), a zoonotic nematode transmitted through the consumption of fish, is of growing concern due to its allergenic potential and clinical relevance. However, the molecular mechanisms underlying the parasite's response to anthelmintic treatment remain poorly defined.
METHODS: Third-stage larvae (L3) of A. simplex s.s. were exposed to three widely used anthelmintics: al
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Khawia sinensis is an important species in freshwater fish causing considerable economic losses to the breeding industry. This is the first mt genome of a caryophyllidean cestode characterised. The entire mt genome of K. sinensis is 13,759 bp in length. This mt genome contains 12 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes and two non-coding regions. The arrangement of the K. sinensis mt genome is the same as other tapeworms, however, the incomplete stop codon (A) is more frequent that other species. Phylogenetic analyses based on concatenated amino-acid sequences of t
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To examine the expression profile and immunofluorescence localization of the major egg antigen p40 of Schistosoma japonicum (Sjp40) during granuloma formation in the liver of infected New Zealand white rabbits.
METHODS: New Zealand white rabbits were infected with S. japonicum cercariae, and the livers were harvested at 29 and 45 days post-infection (dpi). The total RNA of the liver tissues was extracted for expression profiling of Sjp40 by quantitative reverse transcription-PCR (qRT-PCR) with GAPDH of S. japonicum as the endogenous reference gene. The expression of Sjp40 in the li
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To clone and express Schistosoma japonicum P7 antigen (GenBank accession No. EU121231), analyze stage-specific transcription and expression of the antigen, and evaluate its value in early diagnosis.
METHODS: The positive clone (P7) screened from schistosomula cDNA library was amplified by PCR. The PCR product was subcloned into prokaryotic expression vector pET28a. The recombinant plasmids were identified by restrictive enzymes digestion. The positive recombinant plasmids were transformed into E. coli BL21 (DE3), induced by IPG for expression and purified. The diagnostic value of P
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degr
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor mutations arose at a very low frequency per gene, 10-50 times below the typical loss-of-function mutati
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A recombinant lambda gt11 clone, IVGS3, encoding part of a 55-kDa antigen was isolated from an adult Schistosoma japonicum cDNA library. The protein expressed by this clone was recognised strongly by serum from rats that had been vaccinated with irradiated cercariae (VrS) rendering them highly immune to a challenge infection. Antibodies in VrS which were specific for IVGS3 did not recognise adult worm antigens of S. mansoni, suggesting that the recombinant antigen contains species-specific epitopes, although IVGS3 was weakly recognised by rat serum raised against irradiated S. mansoni cercaria
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The human liver fluke, Opisthorchis viverrini, is designated as a group 1 carcinogen, and is the major risk factor for cholangiocarcinoma in endemic countries throughout Southeast Asia. Proteins in the excretory-secretory products and tegumental surface membranes of the fluke have been proposed to play pivotal roles in parasite survival in the host, and subsequent pathogenesis. These macromolecules are therefore valid targets for the development of vaccines and new drugs to control the infection. Tetraspanins (TSP) are prominent components of the tegument of blood flukes where they
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The cDNA encoding a putative serine protease, TsSerP, was cloned by degenerative polymerase chain reaction and screening of the cDNA library from Trichinella spiralis adult-newborn larvae stage. Sequence analysis revealed the presence of two trypsin-like serine protease domains flanking a hydrophilic domain, with the catalytic triad residue histidine in the alpha domain substituted by an arginine residue. Southern blots indicated that this was a single copy gene in the parasite genome. Northern blots demonstrated a single 2.3-kb transcript during the muscle larvae and adult stages of T. spiral
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A cDNA expression library of Clonorchis sinensis adult worm was constructed, and screened out immunologically. One clone, pBCs31, was selected in view of its predominant reactivity with an experimentally infected rabbit serum. Recombinant C. sinensis antigen with 28 kDa as a beta-galactosidase fusion protein produced in Escherichia coli was identified by immunoblot analysis. The cloned gene was composed of 16 copies of a 30 base pair repeat and an additional 320 bases. The deduced amino acid sequence of the tandem repeat was AQPPKSGDGG. On RNA slot blot analysis. C. sinensis adult worm RNA sho
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования