Autoantibodies to five aminoacyl-tRNA synthetases have been reported, and all have been associated with a syndrome of myositis and interstitial lung disease. Four of these synthetases exist free in the cytoplasm, but the fifth, isoleucyl-tRNA synthetase (recognized by anti-OJ autoantibodies), is a component of the multi-enzyme complex containing at least seven synthetases. In an effort to better understand the origins of these antibodies, we examined sera from 11 patients with anti-OJ autoantibodies for evidence of reaction with other components of the complex. All sera showed a characteristic
СтатьяПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The mechanism of the antiproliferation effect of N1,N12-bis(ethyl)spermine (BESPM) was studied in detail using mouse FM3A cells, since this polyamine analogue mimics the functions of spermine in several aspects [Igarashi, K., Kashiwagi, K., Fukuchi, J., Isobe, Y., Otomo, S. & Shirahata, A. (1990) Biochem. Biophys. Res. Commun. 172, 715-720]. Our results indicate that not only the decrease in sperimine and spermine caused by BESPM but also its accumulation play important roles on the inhibition of cell growth by BESPM, since BESPM accumulated in cells at a concentration fivefold that of spermid
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hy
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Umbrella sampling is widely used to estimate biomolecular free energy landscapes and relative folding stabilities. Although equilibration is a critical component of umbrella sampling workflows, the impact of equilibration length on thermodynamic predictions remains poorly understood. Here, we investigate the effect of equilibration length on relative folding free energy predictions for four RNA hairpins with loop sequences GUGAAA, CUGGGA, GUAAUA, and UUAAUU with helical stems of three base pairs. Umbrella sampling simulations were performed using an end-to-end distance reaction coordinate span
СтатьяПрепринтПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Allogeneic bone marrow transplant (alloBMT) is curative for hematologic malignancies through the graft-versus-tumor (GVT) effect but has been ineffective for solid tumors like osteosarcoma (OS). OS expresses CD155 which interacts strongly with inhibitory receptors TIGIT and CD96 but also binds to activating receptor DNAM-1 on natural killer (NK) cells. CD155 has never been targeted after alloBMT. Combining adoptively transferred allogeneic NK (alloNK) cells with CD155 blockade after alloBMT may enhance a GVT effect against OS.
METHODS: Murine NK cells were activated and expanded e
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Macrophages have been shown to contribute to renal injury and fibrosis as well as repair. Recently, Triggering Receptor Expressed on Myeloid Cells 2 (TREM2)-positive macrophages have been shown to play important roles in regulating tissue inflammation and repair. However, it remains unclear whether they can mitigate the transition from acute kidney injury to chronic kidney disease (the AKI-CKD transition).
METHODS: The AKI-CKD transition was generated by unilateral ischaemia-reperfusion injury (UIRI) in wild-type (WT) and Trem2 knockout mice. F4/80 magnetic beads were used to isol
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Viridans streptococci were obtained from primates (great apes, rhesus monkeys, and ring-tailed lemurs) held in captivity, as well as from free-living animals (chimpanzees and lemurs) for whom contact with humans is highly restricted. Isolates represented a variety of viridans streptococci, including unknown species. Streptococcus oralis was frequently isolated from samples from great apes. Genotypic methods revealed that most of the strains clustered on separate lineages outside the main cluster of human S. oralis strains. This suggests that S. oralis is part of the commensal flora in higher p
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Studying mitochondrial (mt) genomics has important implications for various fundamental areas, including mt biochemistry, physiology and molecular biology. In addition, mt genome sequences have provided useful markers for investigating population genetic structures, systematics and phylogenetics of organisms. Toxocara canis, Toxocara cati and Toxocara malaysiensis cause significant health problems in animals and humans. Although they are of importance in human and animal health, no information on the mt genomes for any of Toxocara species is available.
RESULTS: The sizes of the en
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Mesenchymal stem cells (MSCs) exosomes were previously shown to be effective in articular cartilage repairing. However, whether MSCs exosomes promote mature cartilage formation of microtia chondrocytes and the underlying mechanism of action remains unknown. Additionally, some hurdles, such as the low yield and unsatisfactory therapeutic effects of natural exosomes have emerged when considering the translation of exosomes-therapeutics to clinical practices or industrial production. Herein, we investigated the roles of human adipose-derived stem cells (ADSCs) exosomes in modulating m
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Cancer patients have been reported to be at higher risk of COVID-19 complications and deaths. We report the characteristics and outcome of patients diagnosed with COVID-19 during breast cancer treatment at Institut Curie hospitals (ICH, Paris area, France).
METHODS: An IRB-approved prospective registry was set up at ICH on March 13, 2020, for all breast cancer patients with COVID-19 symptoms or radiologic signs. Registered data included patient history, tumor characteristics and treatments, COVID-19 symptoms, radiological features, and outcome. Data extraction was done on April 25
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The influenza-A virus (IAV) causes seasonal epidemics and presents a pandemic risk with the possibility of genetic re-assortment, allowing the emergence of new strains. The evolution of IAVes is done most often by relatively frequent re-assortment between gene segments, but the hypothesis of their evolution by recombination between RNA segments has not been justified to this date. Here, we examine this hypothesis by Bayesian phylogenetic analysis, to test if recombination events have occurred between genomic RNA segments. Different IAV subtypes are observed in co-circulation in Tunisia, which
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Neurodegenerative diseases are a spectrum of progressive disorders unified by chronic neuroinflammation, oxidative and mitochondrial stress, and accumulation of misfolded proteins that ultimately drive neuronal dysfunction and loss. Despite recurring convergence on these pathogenic processes, therapeutic progress has remained limited, underscoring the need for interventions capable of targeting convergent pathogenic pathways rather than single downstream features. Mesenchymal stromal/stem cells (MSCs) have emerged as promising therapeutic candidates through their paracrine actions that modulat
СтатьяОбзорПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Temozolomide (TMZ) resistance in glioblastoma (GBM) involves dynamic crosstalk of cancer cells with tumor-associated microglia, but the role of exosomal long non-coding RNAs (lncRNAs) remains poorly defined.
MATERIAL AND METHODS: We isolated exosomes from TMZ-sensitive (U251) and TMZ-resistant (U251TR) GBM cells. Lnc-DLK1-35 expression was modulated by overexpression/knockdown and validated by RT-qPCR. Exosome internalization by microglia (HMC3 cells) was tracked via PKH67 labeling. Microglial polarization was assessed by studying morphology, marker expression (CD16/CD32/iNOS/Ar
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Regnase-1 is a CCCH-type RNA-binding protein that constantly degrades mRNA species via its ribonuclease domain to maintain immune quiescence. But how and by what mechanisms Regnase-1 regulates Foxp3+ Tregs remains poorly studied. Here, we generated a conditional knock-in strain in which a degradation-resistant Regnase-1 mutant (R111A) was selectively expressed in Foxp3+ Tregs as a transgene (Foxp3YFP-CreLSL-R111Afl/fl) to investigate the roles of Regnase-1 in Tregs. We found that all male Foxp3YFP-CreLSL-R111Afl/fl mice died of fatal autoimmune diseases by 4 weeks of age, which was accompanied
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Codon optimality couples translation elongation to decay and is among the strongest reported sequence determinants of mRNA half-life. Long non-coding RNAs (lncRNAs) are largely untranslated. Is lncRNA stability sequence-encoded in the way mRNA stability is? We compared the classes on half-lives from the same assays, re-estimating the codon stabilization coefficient (CSC) inside each cross-validation fold to remove label leakage. Performance is the cross-validated coefficient of determination R² - 1 for perfect prediction, 0 for the training mean, negative for worse - and the Spearman rank corr
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Improving cellulase production in Trichoderma reesei remains essential for reducing enzyme costs in lignocellulosic biorefineries, whereas effective rational point engineering of ACE3, an essential transcription factor for cellulase production, remains largely unexplored. In this study, we identified serine 705 (S705) in the C-terminal region of ACE3 as an effective engineering site for enhancing cellulase production. Acidic substitutions at S705, such as S705E, severely reduced pNPCase and FPase activities and markedly repressed cellulase-related gene expression. Further analysis showed that
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A key challenge in single-cell RNA sequencing (scRNA-seq) data analysis is accurately and efficiently identifying the cell type of each cell. Cell type annotation for scRNA-seq data not only needs to overcome batch effects caused by various factors but also requires effective handling of large-scale scRNA-seq datasets. Although deep learning has achieved remarkable progress in cell type annotation tasks, it still exhibits limitations in interpretability and robustness against batch effects. To tackle these issues, we propose a supervised framework based on the Transformer architecture, named s
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We evaluated kidney fibrosis in renovascular disease (RVD) using quantitative (q) and semi-quantitative magnetization-transfer (MT) magnetic resonance imaging (MRI). Ten RVD patients and 22 healthy volunteers (HVs) were prospectively enrolled. Of HVs, 10 (HV-1) underwent imaging studies whereas plasma samples were collected from 12 others (HV-2). The qMT-derived bound-pool fraction (f) was compared to MRI-based MT imaging (MTI)-derived MT ratio (MTR), blood oxygenation-level-dependent (BOLD) R2*, and diffusion-weighted imaging (DWI) apparent diffusion coefficient (ADC). MTR was assessed at off
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Evolution is an intrinsic property of autopoietic systems performing natural computation, which is based on an internal formal self-description representing the arrangement of digital and analog coding structures. Autopoietic systems are capable of assigning new values to previously unproven (ambiguous) statements, which occurs, in particular, in conditions beyond the limits of adaptability. This process, defined by Marcello Barbieri as codepoiesis, occurs through the introduction of new codes or the rearrangement of existing ones, increasing the computing power of biological systems. Formally
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования