B cells are crucial for adaptive immunity, orchestrating humoral responses by producing antibodies essential for pathogen clearance. Here, we show that Poly(rC) binding protein 1 (Pcbp1), a multifunctional RNA binding protein, is a key regulator of antibody production in B cells. Pcbp1 deficiency in B cells resulted in significant reductions in immunoglobulin M expression at steady state and compromised differentiation of germinal center B cells and production of high-affinity antibodies upon immunization. These effects were caused by defective mitochondrial integrity in Pcbp1-deficient B cell
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abnormalities of one carbon, glutathione and sulfide metabolisms have recently emerged as novel pathomechanisms in diseases with mitochondrial dysfunction. However, the mechanisms underlying these abnormalities are not clear. Also, we recently showed that sulfide oxidation is impaired in Coenzyme Q10 (CoQ10) deficiency. This finding leads us to hypothesize that the therapeutic effects of CoQ10, frequently administered to patients with primary or secondary mitochondrial dysfunction, might be due to its function as cofactor for sulfide:quinone oxidoreductase (SQOR), the first enzyme in the sulfi
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondria are specialized organelles, which serve as the "Power House" to generate energy for maintaining heart function. These organelles contain various enzymes for the oxidation of different substrates as well as the electron transport chain in the form of Complexes I to V for producing ATP through the process of oxidative phosphorylation (OXPHOS). Several studies have shown depressed OXPHOS activity due to defects in one or more components of the substrate oxidation and electron transport systems which leads to the depletion of myocardial high-energy phosphates (both creatine phosphate
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Chronic progressive external ophthalmoplegia (CPEO) is a common mitochondrial disease. The different conditions in this group of diseases overlap clinically, enzymatically and genetically. There is no effective treatment. Ptosis improves with corrective surgery involving tarsorrhaphy as a palliative measure.
CASE REPORTS: Code numbers were examined in a retrospective study conducted in order to search for patients with ptosis or ophthalmoplegia who had either visited or been admitted to the neurology department over the last 10 years. Data concerning these patients' clinical fea
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abnormal mitochondrial function is present in patients with peripheral arterial disease and may contribute to its clinical manifestations. However, the specific biochemical mitochondrial defects and their association with increased oxidative stress have not been fully characterized. Gastrocnemius muscle was obtained from peripheral arterial disease patients (n = 25) and age-matched controls (n = 16) and mitochondrial parameters were measured. Complexes I through IV of the electron transport chain were individually evaluated to assess for isolated defects. Muscle was also evaluated for protein
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hepatocellular carcinoma (HCC) displays mitochondrial dysfunction characterized by disrupted redox homeostasis and cristae disorganization, yet the underlying molecular mechanisms are unclear. We reveal that Src kinase phosphorylates prohibitin 2 (PHB2) at tyrosines Y34 and Y77 under oxidative stress, disrupting its interaction with cardiolipin and triggering PHB1/2 complex disassembly. This event activates the mitochondrial protease OMA1, promoting excessive cleavage of the cristae-shaping protein OPA1, leading to severe cristae remodeling. Consequent impairment of electron transport chain su
Поиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The pathobiology of acute kidney injury during diabetic ketoacidosis (DKA) is not completely understood. We hypothesized that mitochondrial function is impaired during DKA as a mechanism of acute kidney injury.
METHODS: We isolated kidney samples from 4 to 5 week-old rats with normoglycemia (NG, controls; n = 7), hyperglycemia (HG; n = 5), acute DKA (DKA; n = 5), and after 24 h of DKA treatment (DKA-24; n = 5). Kidney tissue homogenates were prepared from frozen tissue for measurement of mitochondrial electron transport system (ETS) complex I + III, II + III, and IV activity and c
Письмо в редакциюПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The endogenous neurotoxin 1-methyl-6,7-dihydroxy-1,2,3, 4-tetrahydroisoquinoline (salsolinol), which is structurally similar to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), has been reported to inhibit mitochondrial complex I (NADH-Q reductase) activity as does the MPTP metabolite 1-methyl-4-phenylpyridinium ion (MPP(+)). However, the mechanism of salsolinol leading to neuronal cell death is still unknown. Thus, we correlated indices of cellular energy production and cell viability in human dopaminergic neuroblastoma SH-SY5Y cells after exposure to salsolinol and compared these results
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Intrauterine growth restriction (IUGR) is an obstetric complication characterised by placental insufficiency and secondary cardiovascular remodelling that can lead to cardiomyopathy in adulthood. Despite its aetiology and potential therapeutics are poorly understood, bioenergetic deficits have been demonstrated in adverse foetal and cardiac development. We aimed to evaluate the role of mitochondria in human pregnancies with IUGR. In a single-site, cross-sectional and observational study, we included placenta and maternal peripheral and neonatal cord blood mononuclear cells (PBMC and CBMC) from
СтатьяНаблюдательное исследованиеПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Mitochondrial DNA (mtDNA) mutations, which are present in all mitochondria-containing cells, paradoxically cause tissue-specific disease. For example, Leber's hereditary optic neuropathy (LHON) results from one of three point mutations mtDNA coding for complex I components, but is only manifested in retinal ganglion cells (RGCs), a central neuron contained within the retina. Given that RGCs use superoxide for intracellular signaling after axotomy, and that LHON mutations increase superoxide levels in non-RGC transmitochondrial cybrids, we hypothesized that RGCs regulate superoxide
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial Complex I (NADH Coenzyme Q oxidoreductase) is the least understood of respiratory complexes. In this review we emphasize some novel findings on this enzyme that are of relevance to the pathogenesis of neurodegenerative diseases. Besides Coenzyme Q (CoQ), also oxygen may be an electron acceptor from the enzyme, with generation of superoxide radical in the mitochondrial matrix. The site of superoxide generation is debated: we present evidence based on the rational use of several inhibitors that the one-electron donor to oxygen is an iron-sulphur cluster, presumably N2. On this assu
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The use of PCR to identify mtDNAs containing a partial duplication (dup-mtDNA) in the presence of a heteroplasmic population of mtDNAs harboring the corresponding deletion (delta-mtDNA) leads to ambiguous results: when the primers anneal in the duplicated portion of the dup-mtDNA (which is also the non-deleted region of the delta-mtDNA) and point towards the abnormal breakpoint junction, both templates are amplified indiscriminately. We have developed two different 'long PCR' approaches to amplify dup-mtDNA even in the presence of delta-mtDNA and wild-type mtDNA (wt-mtDNA). Long PCR with two p
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: Isoniazid (INH) is a first-line drug for treating drug-susceptible tuberculosis. The genome of Mycobacterium smegmatis encodes two cAMP receptor proteins (Crp), MSMEG_6189 (Crp1) and MSMEG_0539 (Crp2). The deletion of crp1 markedly increased susceptibility to INH, whereas the deletion of crp2 had no effect. In contrast, susceptibility to rifampicin was unchanged in the Δcrp1 mutant. Gene expression analysis revealed strong upregulation of katG1, which encodes the INH-activating catalase-peroxidase, and an almost complete abolishment of ahpC expression, which encodes alkyl hydropero
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The authors describe a newborn with postnatal myopathy who subsequently developed feeding difficulties, ophthalmoplegia, ptosis, encephalopathy, and seizures. She became ventilator dependent after sudden apnea. The myopathy was without ragged red fibers in the muscle biopsy. An electron transport chain study showed a markedly generalized low level of enzyme activity, particularly in complexes I, I + III, and IV. An initial electroencephalogram finding was normal; subsequent electroencephalograms showed suppression bursts. The mitochondrial copy number in skeletal muscle was 2% of normal.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Biological methane-to-methanol conversion is fundamentally constrained by an intrinsic trade-off between methanol accumulation and intracellular NADH regeneration, often motivating external electron supplementation, which can be inefficient. Herein, a biochar-mediated photocatalytic biohybrid system was constructed by integrating a biochar-TiO2 composite with Methylosinus trichosporium OB3b for methane-to-methanol conversion. The system achieved a peak methanol yield of 10.89 mmol·L-1 with a selectivity of 99.4%, combining relatively high methanol accumulation with high selectivity without the
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Thickness of cotton fiber, referred to as fiber maturity, is a key determinant of fiber quality, lint yield, and textile performance. The cotton immature fiber (im) mutant has been used to study fiber maturity since its fiber is thinner than the wild type near isogeneic line (NIL), Texas Marker-1 (TM-1). The im phenotype is caused by a single recessive mutation of a pentatricopeptide repeat (PPR) gene that reduces the activity of mitochondrial complex I and up-regulates stress responsive genes. However, the mechanisms altering the stress responses in im mutant are not well understood. Thus, we
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Muscle dysfunction in acute organophosphorus (OP) poisoning is a cause of death in human. The present study was conducted to identify the mechanism of action of OP in terms of muscle mitochondrial dysfunction. Electromyography (EMG) was conducted on rats exposed to the acute oral dose of malathion (400 mg/kg) that could inhibit acetylcholinesterase activity up to 70%. The function of mitochondrial respiratory chain and the rate of production of reactive oxygen species (ROS) from intact mitochondria were measured. The bioenergetic pathways were studied by measurement of adenosine triphosphate (
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mitochondrial respiratory chain disorders are a heterogeneous group of disorders in which the underlying genetic defect is often unknown. We have identified a pathogenic mutation (c.156C>G [p.F52L]) in YARS2, located at chromosome 12p11.21, by using genome-wide SNP-based homozygosity analysis of a family with affected members displaying myopathy, lactic acidosis, and sideroblastic anemia (MLASA). We subsequently identified the same mutation in another unrelated MLASA patient. The YARS2 gene product, mitochondrial tyrosyl-tRNA synthetase (YARS2), was present at lower levels in skeletal muscle w
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Mitochondrial dysfunction has been implicated in the pathophysiology of autism spectrum disorder (ASD) in previous studies of postmortem brain or peripheral samples. The authors investigated whether and where mitochondrial dysfunction occurs in the living brains of individuals with ASD and to identify the clinical correlates of detected mitochondrial dysfunction.
METHODS: This case-control study used positron emission tomography (PET) with 2-tert-butyl-4-chloro-5-{6-[2-(2-[18F]fluoroethoxy)-ethoxy]-pyridin-3-ylmethoxy}-2H-pyridazin-3-one ([18F]BCPP-EF), a radioligand that binds to
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a
Клинический случайСравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования