Результаты поиска

Regulation of ASAP1 by phospholipids is dependent on the interface between the PH and Arf GAP domains.

ASAP1 is an Arf GAP with a PH domain immediately N-terminal to the catalytic Arf GAP domain. PH domains are thought to regulate enzymes by binding to specific phosphoinositide lipids in membranes, thereby recruiting the enzyme to a site of action. Here, we have examined the functional relationship between the PH and Arf GAP domains. We found that GAP activity requires the cognate PH domain of ASAP1, leading us to hypothesize that the Arf GAP and PH domains directly interact to form the substrate binding site. This hypothesis was supported by the combined results of protection and hydrodynamic

Penfluridol inhibits melanoma growth and metastasis through enhancing von Hippel‒Lindau tumor suppressor-mediated cancerous inhibitor of protein phosphatase 2A (CIP2A) degradation.

Melanoma's high metastatic potential, especially to the brain, poses significant challenges to patient survival. The blood‒brain barrier (BBB) is a major obstacle to the effective treatment of melanoma brain metastases. We screened antipsychotic drugs capable of crossing the BBB and identified penfluridol (PF) as the most active candidate. PF reduced melanoma cell viability and induced apoptosis. In animal models, PF effectively inhibited melanoma growth and metastasis to the lung and brain. Using immunoprecipitation combined with high-resolution mass spectrometry, and other techniques such as

Совпадение в полном тексте источника
… (B) The inhibitory effects of PF‐Biotin on the proliferation of B16 and A375 cells after treatment for 72 h. (C) After treating A375 cells with PF‐Biotin (1 µM) or PEG3‐Biotin (1 µM) for 12 h, proteins were extracted for streptavidin‒biotin‐based immunoprecipitation. … (F) After PF‐Biotin treatment of B16 and A375 cells, a streptavidin‒biotin pull‐down assay was performed. Subsequently, immunoblot assays analysis was conducted to detect the interaction between PF‐Biotin and CIP2A and VHL in the cells. …

The Current Landscape of Modular CAR T Cells.

Despite the groundbreaking impact of currently approved CAR T-cell therapies, substantial unmet clinical needs remain. This highlights the need for CAR T treatments that are easier to tune, combine, and program with logic rules, in oncology and autoimmunity. Modular CAR T cells use a two-part system: the CAR on the T cell binds an adaptor molecule (AM), and that adaptor binds the tumour-associated antigen (TAA). This design separates recognition of the target antigen and activation of the T cells, resulting in a cellular therapy concept with better control, flexibility, and safety compared to

Совпадение в полном тексте источника
… (mBio3) | mAb | Biotin-LLE | Multivalent | [ 19 ] mSA2 CAR | Biotin | mAb | Biotin | Multivalent | [ 20 ] BBIR CAR | Biotin | scFv, mAb | Biotin | Multivalent | [ 21 ] BsAb-IR CAR | FRα mAb | Two conjugated mAbs | FRα mAb | Bivalent | [ 42 ] Antibody domain recognition | CD16 CAR | Fc part of mAb | … Biotin-Based CAR Biotin-based modular CAR T cells are some of the earliest designs in the adaptor CAR field. As biotin conjugation is simple, fast, and reliable, developing CAR T cells that recognise biotinylated adaptors is straightforward. …

От профилактики к управлению: изучение воздействия рациона питания на множественный склероз.

Множественный склероз (MS) — хроническое имунное заболевание центральной нервной системы, характеризующееся нейроинфламмацией и прогрессивным нейродегенерацией. Растущие данные свидетельствуют о том, что диетическое вмешательство может влиять на прогресс и управление симптомами MS, изменяя воспаление, окислительный стресс и кишечный микробиотический состав. В настоящем описательном обзоре рассматриваются последствия средиземноморского, растительного, кетогенного, вальса, сванка, периодического постирования и без глютена наряду с такими ключевыми питательными веществами, как жирные кислоты омег

Совпадение в полном тексте источника
… Similarly, in an observational study assessing high-dose biotin as a potential therapy for MS, 43 patients with different types of MS were administered 300 mg/day of biotin daily [ 71 ]. No improvements were evident. … Biotin Several studies have reported that high-dose biotin supplementation may improve certain clinical symptoms in patients with MS, though findings remain inconsistent. In an open-label pilot study, 23 patients with primary or SPMS received biotin (100–300 mg/day) for an average of 9.2 months. …

[Regulatory effects and signaling mechanism of sodium ferulate on the proliferation and apoptosis of human skin hypertrophic scar fibroblasts].

Objective: To investigate the regulatory effects and signaling mechanism of sodium ferulate on the proliferation and apoptosis of human skin … ved by transmission electron microscope (n=3), the cell apoptosis was detected by TdT-mediated dUTP-biotin nick end labeling (TUNEL) assay and the apoptosis index was calculated (n=4), the protein expressions of B lymphocystoma-2 (Bcl-2), Bcl-2-associated X protein (Bax), and cysteine aspartic acid specific protease-3 (caspase-3) were determined by immun …

Endocrine cells in the oxyntic mucosa of the stomach in patients with irritable bowel syndrome.

AIM: To study the different endocrine cell types in the oxyntic mucosa of patients with irritable bowel syndrome (IBS). METHODS: Seventy-si … were taken from the corpus. Sections from these biopsy samples were immunostained using the avidin-biotin complex (ABC) method, for ghrelin, serotonin, somatostatin and histamine. The densities of these cell types and immunoreactivity intensities were quantified using computerized image analysis with Olympus cellSens imaging software (version 1.7). RES …

"Smart" drug delivery: A window to future of translational medicine.

Chemotherapy is the mainstay of cancer treatment today. Chemotherapeutic drugs are non-selective and can harm both cancer and healthy cells, causing a variety of adverse effects such as lack of specificity, cytotoxicity, short half-life, poor solubility, multidrug resistance, and acquiring cancer stem-like characteristics. There is a paradigm shift in drug delivery systems (DDS) with the advent of smarter ways of targeted cancer treatment. Smart Drug Delivery Systems (SDDSs) are stimuli responsive and can be modified in chemical structure in response to light, pH, redox, magnetic fields, and e

Совпадение в полном тексте источника
… In another study, Chen et al. manufactured multifunctional poly (ethylene glycol)- blocked-poly ( l -lysine) Biotin 6-maleimido-caproic acid (Biotin-PEG-b-PLL (Mal)-peptide) polymeric micelles enclosing doxorubicin to improve cancer cell uptake by endocytosis ( Chen WH. et al., 2015 ). … To exploit the biotin receptor overexpressed on tumour cells, they covalently conjugated QDs to the tumour targeting ligand biotin. This system utilizes the pH stimuli to release the drug payload at desired targeted site ( Iannazzo et al., 2017 ). …

A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation.

Interleukin IL-17 is a proinflammatory cytokine that has been implicated in the pathogenesis of various autoimmune diseases. The single nucleotide polymorphism (SNP), rs2275913, in the promoter region of the IL-17 gene is associated with susceptibility to ulcerative colitis. When we examined the impact of rs2275913 in a cohort consisting of 438 pairs of patients and their unrelated donors transplanted through the Japan Marrow Donor Program, the donor IL-17 197A allele was found to be associated with a higher risk of acute graft-versus-host disease (GVHD; hazard ratio [HR], 1.46; 95% confidence

Совпадение в полном тексте источника
… Lane 1, free probes; lane 2, biotin-labeled probes plus nuclear extracts; lane 3, biotin-labeled probes plus nuclear extracts plus a 50-fold molar excess of unlabeled probes. The figure shown is representative of five independent experiments. … Lane 1, free probes; lane 2, biotin-labeled probes plus GST-NFAT; lane 3, biotin-labeled probes plus GST-NFAT plus a 50-fold molar excess of unlabeled probes; lane 4, biotin-labeled probes plus GST-NFAT plus a 50-fold molar excess of unlabeled oligomers containing a NFAT consensus site. …

Структурное и механистическое профилирование модулятуры Hurr1 vidofludimus позволяет проектировать лиганд на основе структуры.

В центре биомедицинских исследований находится фактор нейрозащиты, связанный с ядерным рецептором 1 (Nurr1, NR4A2) для его многообещающей нейрозащитной роли в болезни Паркинсона, болезни Альцгеймера и множественном склерозе. Его деятельность может контролироваться лигандами, предлагающими доступ к фармакологической модуляции Hurr1. Вместе с тем связующие эпитопы и механизмы молекулярной активации синтетических активаторов Hurr1 по-прежнему остаются труднодостижимыми, но имеют важное значение для продвижения к новым лекарствам лигандов Hurr1. Здесь мы охарактеризовали диссоциацию Hurr1 димера и

Совпадение в полном тексте источника
… The flow-through from reverse IMAC containing Nurr1 LBD was collected and supplemented with 0.5 mM biotin, 0.5 mM ATP, 5 mM MgCl 2 , and E.coli biotin ligase BirA at a molar ratio of ~1:10 for enzymatic conjugation of biotin to the lysine residue in the avitag. … After overnight incubation at 4°C, the solution was subjected to reverse IMAC to remove biotin ligase birA. …

Шаги в направлении внедрения нейрофильтров в множестве склерозов: характеристики пациентов, которым необходимо уделять приоритетное внимание в клинической практике.

Множественный склероз (MS) — хроническое заболевание центральной нервной системы, характеризующееся нейродегенерацией и воспалением. Нейрофильтральная световая цепочка (NfL), являющаяся белком, высвобождающимся во время аксоновых травм, получила признание в качестве потенциального биомаркера для мониторинга прогресса и реакции MS. Имеющиеся данные свидетельствуют о том, что NfL (bNfL) представляет собой минимально инвазивный, экономичный инструмент для отслеживания нейроаксональных повреждений. Регулярная оценка БНФЛ позволяет выявлять субклинические заболевания, направлять интенсификацию лече

Совпадение в полном тексте источника
… Biotin supplements, commonly used by MS patients, were previously considered a potential interference risk for bNfL measurement using SiMoA technology. … A manufacturer’s application note states that biotin concentrations up to 80 μM in serum, plasma, or sample diluent do not impact the performance of SiMoA bead-based assay. …

Иммунотерапия при помощи модуляции кишечного микробиота в множестве склерозов и ассоциации с диетологической и клинической реакцией - эффект диметилфуматовой терапии.

СПРАВОЧНАЯ ИНФОРМАЦИЯ: Накопление данных подтверждает ту роль, которую микробиота играет в здравоохранении и болезнях, в том числе в многократном склерозе (МС). Как наркотики MS влияют на микробиоту и является ли это частью их способа действия, пока неизвестно. ЦЕЛИ: Оценка воздействия диметилфумарата (ДМП) на кишечник микробиота и того, связана ли микробиота с клинической реакцией или неблагоприятными явлениями (АЭ) с ДМФ или с диетой. DESIGN: когортное исследование наблюдений, в котором микробиота 45 больные с повторной эмиссией MS до начала работы DMF и после этого 6 месяцев психотерапии ДМ

Совпадение в полном тексте источника
… Top enrichment was found in pathways such as Citrate cycle (tricarboxylic acid (TCA) cycle), Lipopolysaccharide biosynthesis, Oxidative phosphorylation, and Biotin metabolism. … Biotin is a co-factor for four essential carboxylases expressed in oligodendrocytes and neurons, and supplement has therefore been suggested as a therapeutic strategy, although high-dose Biotin supplement in progressive PwMS was unsuccessful. 80 Additional longitudinal replication followed by experimental …

Covalent targeting of PSMD14 by Eupalinolide B induces oncoprotein degradation and apoptosis in acute promyelocytic leukemia cells.

Treatment of acute promyelocytic leukemia (APL) remains challenged by toxicities associated with current regimens, highlighting the need for novel and safer therapeutic agents. Here, we identify Eupalinolide B (EB), a natural sesquiterpene lactone isolated from Eupatorium lindleyanum DC., as a potent anti-leukemic compound targeting the human APL-derived HL-60 cell line. Through integrated chemoproteomic profiling and functional validation, we demonstrate that EB covalently binds and inhibits 26S proteasome non-ATPase regulatory subunit 14 (PSMD14), a deubiquitinase enzyme (DUB) within the 19S

Совпадение в полном тексте источника
… EB-P-bound proteins were conjugated to biotin-azide via copper-catalyzed azide–alkyne cycloaddition (CuAAC), enriched using NeutrAvidin agarose, and analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). … Subsequently, proteins were conjugated to biotin tag through click chemistry reaction. For each sample, TCEP (1 mM), CuSO 4 (1 mM), biotin–azide (50 μM) and TBTA ligand (100 μM) were sequentially added, and the reaction mixtures were incubated at 37 °C with shaking for 2 h. …

Иммунорегулирующий амфипатический песптид, полученный из молекулы защиты фасиолы гепатики (FhHDM-1.C2), демонстрирует мощную биотерапевтическую активность в мусриновой модели множественного склероза.

Молекулярные защитные молекулы (HDM) — семейство иммунных регуляционных пептидов, которые выражаются исключительно триматодными червями. Ранее мы продемонстрировали, что в vivo FhHDM-1, архетипный член HDM, регулировала макрофагическую реакцию на подстрекательские лиганды, тем самым облегчая процесс повреждения иммунной ткани в нескольких мусриновых моделях воспалительных заболеваний. Соответственно, мы исходили из того, что понимание взаимосвязи между структурой и функцией НДМ облегчило бы идентификацию минимального биоактивного пептида, который представлял бы собой более синтезируемый, эконо

Совпадение в полном тексте источника
… C2 peptides with macrophages RAW 264.7 macrophages (1 × 10 6 cells/mL) were incubated with 1 mL of biotin‐labeled peptides in PBS at 4°C for 30 min, protected from light. … (A) RAW 264.7 macrophages were either unstained (gray filled) or incubated with biotin‐labeled FhHDM‐1.C1 (dotted line) or FhHDM‐1.C2 (Black line) peptides at 4°C for 30 min. …

Биоразлагаемый электроспун PLGA Nanofibers-Encapsolated Trichinella Sphiralis Antigens защищает от повторного использования экспериментального аутоиммунного энцефаломилита и связанного с ним микробиота дисбиоз.

ЦЕЛЬ: " Тричинелла спиралис " создала сложные механизмы иммуномодуляции при посредничестве экскременто-секретарских продуктов (ESL1), которые позволяют ей выжить в принимающей стране. Следовательно, антигены ESL1 обладают прекрасным потенциалом для лечения аутоиммунных заболеваний, таких, как множественный склероз (MS). Однако вопрос о том, могут ли своевременные контролируемые поставки антигенов ESL1 в vivo, как и в случае естественных инфекций, повысить его терапевтический потенциал в отношении MS, до сих пор неизвестен.Для этого мы ввели антигены ESL1 в полихлорированные (лактидно

Совпадение в полном тексте источника
… II-PE (OX-6), (all from Bio-Rad, Hercules, California, USA); mouse IgG1 negative control-biotin (AB_2550616), anti-IL-17A-FITC (eBio17B7), anti-CD45R antibody-FITC (HIS24), anti-CD161-Biotin (10/78), CD86-Pe/Cyanin 5 (GL1), mouse IgG1 negative control (MOPC-21)-Alexa Fluor 647 (all form Thermo Fisher … Alternatively, peri-implant tissues from PLGA/ESL1- and PLGA/ESL1-FITC-treated animals were either H&E stained or incubated with anti-FITC antibody-biotin (BioLegend) (1:200) overnight and after washing in PBS, with streptavidin-Alexa 546. …

Developing Actively Targeted Nanoparticles to Fight Cancer: Focus on Italian Research.

Active targeting is a valuable and promising approach with which to enhance the therapeutic efficacy of nanodelivery systems, and the development of tumor-targeted nanoparticles has therefore attracted much research attention. In this field, the research carried out in Italian Pharmaceutical Technology academic groups has been focused on the development of actively targeted nanosystems using a multidisciplinary approach. To highlight these efforts, this review reports a thorough description of the last 10 years of Italian research results on the development of actively targeted nanoparticles t

Совпадение в полном тексте источника
… Biotin-Specific Receptors Biotin is an essential micronutrient that can be exploited to provide tumor-targeting properties to nanocarriers, thanks to the overexpression of biotin-specific uptake systems [ 46 ], which have recently been found to be enhanced in many cancer cells lines, including ovarian … For these reasons, many examples of biotin being used as a targeting moiety in tumor therapy, both for therapeutic and diagnostic/theranostic purposes, have been reported in the literature [ 47 ]. 2.9. …

Бетен смягчает недостатки в моторном поведении, нейротоксическом воздействии и нейро-воспалительной реакции в крысиной модели обезвоживания.

Множественный склероз (MS) характеризуется как хроническое воспалительное нейродегенеративное расстройство, ведущее к порче милиновой оболочки и потере аксонов. Бетане, триметилглициновое соединение, признается за его способность проникать через барьер мозга крови (ББД) и демонстрирует свойства, которые являются антиоксидантами, антивоспалительными и нейрозащитными. Модель " чапризона " (КПЗ) служит эффективным инструментом для изучения процессов обезвоживания и воспоминания, связанных с НР. В наших исследованиях мы изучили защитные и терапевтические последствия бетаина в крысиной мо

Совпадение в полном тексте источника
… Rinses with TBS-tween were always performed after 15 minutes of 0.3 % hydrogen peroxide (H 2 O 2 ) treatment to block nonspecific background staining (Background Sniper; Biocare Medical) and endogenous biotin and biotin-binding proteins (avidin/biotin blocking kit; Vector Laboratories Inc., Burlingame … Endogenous biotin blocking was carried out online for four minutes, and then the anti-MBP primary antibody (Abcam. Ab40390 (1ug/ml) LotGR3264120–1) at a 1:1000 dilution was incubated for thirty-two minutes. …

Множественный вариант жесткости склероза в DYSF-ZNF638 связует с нейронной потерей и воспалением.

Был выявлен генетический вариант rs10191329AA, связанный с более быстрым накоплением инвалидности при множественном склерозе (MS). Мы изучили воздействие переносчика Rs10191329AA на MS патологию и флангающие гены дисферлин (DYSF) и белкового цинка 638 (ZNF638) в голландском банке мозга (n = 290) путем сопоставления rs10191329AA (n = 6) с совпадающими rs10191329CC носителями (n = 12). rs10191329A носителями, связанными с более острым аксоном стрессом, снижением нейронной плотности слоя 2 и более высокой долей повреждений пенистыми микроглией. В rs10191329AA спонсоры, обычно выделявшиеся белое в

Совпадение в полном тексте источника
… Vector Laboratories Cat# BA-9500 RRID: AB_2336123 Horse-anti-mouse-IgG – biotin Vector Laboratories Cat# BA-2000 RRID: AB_2313581 Horse-anti-rabbit-IgG – biotin Vector Laboratories Cat# BA-1100 RRID: AB_2336201 Mouse-anti-human APP A4 Sigma-Aldrich Cat# MAB348 RRID: AB_94882 Mouse-anti-human CD79A … Sections were incubated with appropriate biotinylated secondary antibody, followed by avidin-biotin-horseradish peroxidase (HRP) complex (Vector Elite ABC kit; Vector Laboratories), before visualization with 3,3′-diaminobenzidine (DAB) and hematoxylin counterstaining. …

Advanced Diagnostic Techniques

Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.

Совпадение в полном тексте источника
… Numerous tissues have endogenous avidin-biotin activity that must be blocked before adding biotinylated reagents in avidin-biotin detection systems. … Current IHC methods can be divided into avidin-biotin or non–avidin-biotin systems. After incubation with the primary antibody, a secondary antibody specific for the primary antibody (secondary reagent) is added. For avidin-biotin systems the secondary reagent is biotinylated. …

LAP2α drives breast tumorigenesis by mitigating replication stress.

Replication protein A (RPA) plays a vital role in replication stress response, with RPA-coated single-stranded DNA (ssDNA) acting as a critical platform for the coordination of the genome surveillance machinery. In previous studies, we reported that the lamin-associated protein LAP2α interacts physically with RPA, aiding its localization to damaged chromatin for genome protection. However, the significance of the LAP2α-mediated RPA deposition in tumor progression remains unclear. Here, we reveal that LAP2α promotes breast tumorigenesis by counteracting replication stress-induced DNA damage. Fu

Совпадение в полном тексте источника
… Additionally, gel shift assays utilizing 5’ biotin-labeled ssDNA (GCTTGCATGCCTGCAGGCCAGCCTCAATCTCATC, at 10 nM) were conducted under the same conditions. … First, increasing amounts of RPA were incubated with a fixed amount of biotin-labeled 34-nucleotide (nt) ssDNA, and the resulting DNA-protein complexes were separated from unbound DNA using non-denaturing gel electrophoresis. …

Mapping oncogenic protein interactions for precision medicine.

Normal protein-protein interactions (normPPIs) occur with high fidelity to regulate almost every physiological process. In cancer, this highly organised and precisely regulated network is disrupted, hijacked or reprogrammed resulting in oncogenic protein-protein interactions (oncoPPIs). OncoPPIs, which can result from genomic alterations, are a hallmark of many types of cancers. Recent technological advances in the field of mass spectrometry (MS)-based interactomics, structural biology and drug discovery have prompted scientists to identify and characterise oncoPPIs. Disruption of oncoPPI inte

Совпадение в полном тексте источника
… Abbreviations affinity purification mass spectrometry ascorbate peroxidase proximity‐dependent biotin identification cryogenic electron microscopy dynamic light scattering fragment‐based drug discovery Förster resonance energy transfer high‐throughput screening nuclear magnetic resonance normal … of protein interactions. 122 , 123 These include proximity‐dependent biotin‐identification (BioID) 124 and ascorbate peroxidase (APEX)‐based methods 125 or derivatives of these. …