INTRODUCTION: Neutrophil extracellular traps (NETs) play a critical role in inflammation and coagulation imbalance. Recent studies have demonstrated that activation of gasdermin D (GSDMD) protein and its pore-forming activity are essential drivers of NET generation. This study investigated the association between GSDMD-NETs axis activation and sepsis-induced coagulopathy (SIC), as well as the potential association with glycocalyx damage.
MATERIALS AND METHODS: A prospective cohort of 70 sepsis patients (35 with SIC, 35 non-SIC) admitted to a respiratory intensive care unit was analyzed. This
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The evidence of an infectious agent other than human immunodeficiency virus (HIV) acting as a possible etiologic cause of Kaposi's sarcoma (KS) has received considerable attention in the last years. Recently, DNA sequences from a new herpesvirus (HHV-8) have been observed in several cases of KS. The discovery suggests that this virus may play a role in the pathogenesis of KS. To evaluate these results, we determined the frequency of HHV-8 DNA sequences in 78 specimens of KS according to different epidemiologic origins (sporadic KS: 6, immunosuppressive drug-associated: 11, and AIDS
Сравнительное исследованиеСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A Cambodian family presenting several haemoglobinopathies, Hb E, Hb Q and alpha + thalassaemia, has been investigated. DNA analysis showed that the thalassaemia syndrome corresponds to a leftward type (4.2 kb) deletional form of alpha + thalassaemia. Genotypes found in the family are: propositus -alpha A/-alpha Q, beta A/beta E., mother and older sister alpha A alpha A/-alpha Q, beta A/beta E., father alpha A alpha A/-alpha A, beta A/beta A. The propositus consistently presents an alpha Q/alpha A chain ratio of 60/40 although both chains are products of alpha 1 loci. The relatively higher expr
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Primary ovarian insufficiency (POI) is a critical fertility defect characterized by an anticipated and silent impairment of the follicular reserve, but its pathogenesis is largely unexplained. The frequent maternal inheritance of POI together with a remarkable dependence of ovarian folliculogenesis upon mitochondrial biogenesis and bioenergetics suggested the possible involvement of a generalized mitochondrial defect. Here, we verified the existence of a significant correlation between blood and ovarian mitochondrial DNA (mtDNA) content in a group of women undergoing ovarian hyperstimulation (
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The venom of Lycosoidea spiders is a complex multicomponent mixture of neurotoxic peptides (main components) and antimicrobial peptides (AMPs) as minor components. In this study, we described the high-throughput identification and analysis of AMPs from Lycosa sinensis venom (named LS-AMPs) using a combination strategy that includes the following three different analysis approaches: (i) peptidomic analysis, namely reversed-phase high-performance liquid chromatography (RP-HPLC) separation plus top-down sequencing by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MS
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
CONTEXT: A novel human DNA virus was isolated from the serum of a patient with posttransfusion hepatitis; it was named transfusion transmitted virus (TTV).
OBJECTIVE: To ascertain the influence of TTV (detected by polymerase chain reaction amplification of a conserved region of the viral genome) coinfection in individuals infected with hepatitis viruses (A, B, and C) and to investigate the putative role played by TTV in hepatic dysfunction in individuals with acute non-A-E hepatitis.
DESIGN: Sixty-two patients with viral hepatitis were included in the study in addition to 18 blood donors. Vi
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Transcriptional regulation of azole resistance in the filamentous fungus Aspergillus fumigatus is a key step in development of this problematic clinical phenotype. We and others have previously described a C2H2-containing transcription factor called FfmA that is required for normal levels of voriconazole susceptibility. Null alleles of ffmA exhibit a strongly compromised growth rate even in the absence of any external stress. Here, we employ an acutely repressible doxycycline-off form of ffmA to rapidly deplete FfmA protein from the cell. Using this approach, we carried out RNA-seq analyses to
СтатьяПоддержка NIH: внешняя программаПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A photoelectrochemical (PEC) aptasensing platform is devised for sensitive detection of an organophosphorus pesticide based on dissolution of core-shell MnO2 nanoflower@CdS (MnO2 NF@CdS) by thiocholine (TCh). TCH is produced from the butyrylcholinesterase-acetylthiocholine system, accompanied by target-triggered rolling circle amplification (RCA). The core-shell MnO2 NF@CdS with excellent PEC performance was synthesized and employed as a photo-sensing platform. The target was detected on a functionalized magnetic probe with the corresponding aptamer. Upon malathion introduction, the aptamer wa
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Retinitis pigmentosa (RP) is the most frequent inherited retinal disease, which shows a relatively high incidence of the autosomal-recessive form in Pakistan.
METHODS: Genome-wide high-density single-nucleotide polymorphism (SNP) microarrays were used to identify homozygous regions shared by affected individuals of one consanguineous family. DNA of three affected and two healthy siblings was used for SNP genotyping. Genotyping data were then analysed by Homozygosity Mapper. DNA of the proband was further analysed employing exome sequencing.
RESULTS: Homozygosity mapping revealed
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genetic instability plays a key role in the formation of naturally occurring cancer. The formation of long DNA palindromes is a rate-limiting step in gene amplification, a common form of tumor-associated genetic instability. Genome-wide analysis of palindrome formation (GAPF) has detected both extensive palindrome formation and gene amplification, beginning early in tumorigenesis, in an experimental Myc-induced model tumor system in the chicken bursa of Fabricius. We determined that GAPF-detected palindromes are abundant and distributed nonrandomly throughout the genome of bursal lymphoma cell
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Recombinant vaccinia viruses have shown promise as vaccine vectors. However, their effectiveness is markedly reduced by pre-existing anti-vaccinia immunity. The possibility of new vaccinia immunizations in the event of a bioterror-related smallpox release poses an additional negative impact on the utility of vaccinia-based vectors. Thus, we aimed to design a vaccinia vector that would enhance the immune response to an expressed foreign protein in a pre-immune animal model. To do this, we made use of the finding that most neutralizing antibodies against the extracellular form of vaccinia virus
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have identified and characterized a new member of the leucine zipper (bZIP) gene family of transcription factors, thyrotroph embryonic factor (TEF). Analysis of the ontogeny of TEF gene expression reveals the presence of TEF transcripts, beginning on embryonic day 14, only in the region of the rat anterior pituitary gland in which thyrotrophs arise. This pattern of gene expression corresponds temporally and spatially to the onset of thyroid-stimulating hormone (TSH beta) gene expression, which defines the thyrotroph phenotype. Coupled with this observation, we find that TEF can bind to and
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Trypanosomes are protozoan parasites of vertebrates transmitted by blood-sucking tsetse fly. Trypanosomes remain a constant threat to the lives of humans and animals throughout large regions of Africa.
AIMS AND OBJECTIVES: This study investigated the presence, prevalence, and species of trypanosome parasite in tsetse flies caught in two areas of no previous documented history of trypanosome infection.
MATERIALS AND METHODS: For this purpose, 63 and 77 nonterenal tsetse flies were collected from Oji River and Emene areas of Enugu State Nigeria, respectively. Genomic DNA was isol
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The COVID-19 pandemic increased demands for respiratory disease testing to facilitate treatment and limit transmission, demonstrating in the process that most existing test options were too complex and expensive to perform in point-of-care or home scenarios. Lab-based molecular techniques can detect viral RNA in respiratory illnesses but are expensive and require trained personnel, while affordable antigen-based home tests lack sensitivity for early detection in newly infected or asymptomatic individuals. The few home RNA detection tests deployed were prohibitively expensive. Here, we demonstr
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A DNA binding protein was identified which binds to two novel target-like sequences: (i) at the 5' flanking site of the breakpoint junction of chromosome 8 in a patient with T-acute lymphoblastic leukemia (ALL) carrying the t(8;14)(q24;q11) rearrangement and (ii) on chromosome 1 in three of five T-ALL patients with the t(1;14)(p32;q11) rearrangement. This protein [provisionally called recombination hotspot associated factor (ReHF-1)] was also found to bind to a similar target sequence that is present immediately at the 3' end of the human V delta 3 gene segment. In a small number of lines test
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hereditary 1,25-dihydroxyvitamin D3-resistant rickets is a rare autosomal-recessive disease resulting from target-organ resistance to the action of the active hormonal form of vitamin D. Four affected children from three related families with the classical syndrome of hereditary 1,25-dihydroxyvitamin D3-resistant rickets and the absence of detectable binding to the vitamin D receptor (VDR) in cultured fibroblasts or lymphoblasts were examined for genetic abnormalities in the VDR gene. Genomic DNA from Epstein-Barr virus-transformed lymphoblasts of eight family members was isolated and amplifie
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Esophageal cancer (EC) remains highly lethal partly because many patients are diagnosed at advanced stages, and current diagnostic pathways rely on invasive endoscopy and centralized molecular testing. Circulating microRNAs (miRNAs) are promising minimally invasive biomarkers, yet amplification-based assays can be workflow-intensive and introduce protocol-dependent bias. Here we report an amplification-free, dual-readout gold nanoparticle (AuNP) biosensor for hsa-miR-320b analysis in plasma RNA extracts. Target miR-320b bridges a biotinylated capture probe on streptavidin magnetic beads and a
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Infertility is a pressing global health concern, affecting one in six couples worldwide. The failure rate for assisted reproductive technologies (ART) cycles remains at approximately 78%, with limited improvements often attributed to a lack of technological innovation. Sperm processing, a crucial component of ART success and offspring health, has seen minimal technical advancement, and current "gold-standard" methods such as density gradient centrifugation (DGC) carry risks of iatrogenic injury and DNA damage.
OBJECTIVES: Microfluidic sperm selection technologies have shown promis
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ferritin is a shell-like carrier protein with an 8 nm diameter cavity that naturally provides a space for encapsulating food and drug components. In the absence of iron atoms bound to this protein, it is called apoferritin, the form used in this study. However, its vulnerability to environmental conditions when used alone warrants further investigation. A promising approach involves glycation reactions, which integrate the beneficial properties of proteins and polysaccharides to fine-tune the physicochemical traits of proteins and enhance their functionality. In this context, the binding of ap
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования