Methotrexate, a structural analogue of folic acid, is one of the most frequently used chemotherapeutics, especially in haematological malignancies, various solid tumours and also inflammatory disorders. Methotrexate interferes with folate metabolism, mainly by inhibition of dihydrofolate reductase, resulting in the suppression of purine and pyrimidine precursor synthesis. The depletion of nucleic acid precursors seems to be responsible for the cytostatic, cytotoxic and differentiation effects of methotrexate. Methylation of biomolecules represents another folate-dependent pathway that is also
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
One of the best-known disorders in purine metabolism is accumulation of uric acid leading to gout. Gout is a lifestyle disease, which was nicely illustrated in the joint symposium of the Japanese Society of Gout and Nucleic Acid Metabolism and of the Purine and Pyrimidine Society held in February 2011 in Tokyo, Japan. The westernization of the Japanese diet led to an increase in hyperuricemia in Japanese, which subsequently boosted research in this field, as illustrated in this symposium. As a consequence, Japanese nucleotide research also expanded, leading to the development of not only new d
Conference ProceedingsИсторическая статьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A Dirofilaria immitis cDNA clone encoding a nucleic acid homolog of thioredoxin peroxidase (nDiTPx) was isolated from a fourth-stage larval cDNA library, using serum from dogs vaccinated by chemotherapeutically-abbreviated D. immitis larval infections. The protein encoded by nDiTPx had a predicted molecular mass of 22.1 kDa and the deduced amino acid sequence was homologous to thioredoxin peroxidase-like sequences described in other filarial nematodes, yeast, bacteria and mammals. As is true for other members of this peroxiredoxin family, the nDiTPx-encoded protein had the conserved cysteine n
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Proteins make complex life possible, yet our understanding of their emergence remains limited. What are the information limits of protein folding, and how did the first proteins emerge? Protein simplification studies - in which contemporary folds are built from limited alphabets, symmetrized, fragmented, or shortened - have provided key insights into these questions. These studies use design constraints to address the discoverability of, and connectedness between, protein folds. By considering various environments, such as high salt concentrations or peptide-nucleic acid coacervates, the role
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AbstractAs part of a multi-year surveillance program of tick-borne diseases, we describe babesia surveillance of blood donors using nucleic acid tests conducted in 2025 and summarize cases of babesiosis reported by public health officials in Nova Scotia, Canada, from 2023 through 2025. Among 10,976 blood donor specimens, one specimen, collected from a blood donor in Nova Scotia Health's Western Zone, was positive, although this result was unable to be confirmed. Since babesiosis became reportable in Nova Scotia on May 23, 2023, eleven clinical cases have been documented, including eight in ind
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prostatic abscess as an isolated entity is an infrequent and extremely rare manifestation of genitourinary tuberculosis. We report a case of a middle-aged male with type 2 diabetes mellitus and hypertension who presented with persistent lower urinary tract symptoms and fever. Imaging revealed a multiloculated prostatic abscess. Pus culture grew Stenotrophomonas maltophilia, while a cartridge-based nucleic acid amplification test confirmed Mycobacterium tuberculosis. The patient was managed with appropriate antimicrobial therapy, antitubercular treatment, and supportive care, leading to complet
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Women of childbearing age can develop autoimmune or hereditary neuromuscular disorders, which can exacerbate during pregnancy. Stabilizing disease activity during pregnancy has a positive impact on pregnancy and delivery outcomes. Selection of therapeutic agents during pregnancy should be based on the evaluation of the risks and benefits involved. Generally, spontaneous vaginal delivery is recommended; however, preterm and emergency cesarean deliveries may become necessary. Novel agents such as biologics and nucleic acid drugs have been introduced in clinical practice in recent years. These no
Аннотация на английскомСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Osteomyelitis caused by Mycobacterium tuberculosis is a rare entity. This clinical condition is even rarer when the bones of extremities like the foot are involved. There is a paucity of literature on the isolated tubercular involvement of the bones of the foot. Further, congenital hallux valgus is an infrequently reported condition. A case of tuberculosis of the first metatarsal of the left foot with congenital hallux valgus without pulmonary involvement is never reported in the literature. We herein present a first of its type case where tuberculous osteomyelitis of the first metatarsal of t
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human cytomegalovirus (HCMV) remains an essential global concern due to its distinct life cycle, mutations and latency. As HCMV is a herpesvirus, it establishes a lifelong persistence in the host through a chronic state of infection. Immunocompromised individuals are at risk of significant morbidity and mortality from the virus. Until now, no effective vaccine has been developed to combat HCMV infection. Only a few antivirals targeting the different stages of the virus lifecycle and viral enzymes are licensed to manage the infection. Therefore, there is an urgent need to find alternate strateg
СтатьяОбзорПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pneumocystis jirovecii, Cytomegalovirus and varicella-zoster virus are all opportunistically infective pathogens, but pulmonary co-infection with these pathogens is rare. Herein, this case report describes a patient with autoimmune haemolytic anaemia treated with methylprednisolone and cyclosporine that presented with rapidly progressive severe respiratory failure. Analysis of microbial nucleic acid sequences in both blood and sputum using next-generation sequencing revealed pulmonary co-infection with Pneumocystis jirovecii, varicella-zoster virus, and possibly Cytomegalovirus. After timely t
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The coronavirus disease 2019 (COVID-19) has been a worldwide pandemic diseases, nearly 400,000 people died at now. The data of status of pregnant women and neonates after infection of severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) is limited. We report a case of pregnant woman in her third trimester with critical COVID-19, and amniotic fluid, umbilical cord blood, placenta, and neonatal gastric fluid were retained during cesarean section. The SARS-COV-2 nucleic acid test results of these specimens were negative. There is no evidence of intrauterine vertical transmission during de
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hospitalized infants have the highest rates of invasive Staphylococcus aureus disease of any population and infection control strategies such as decolonization have been insufficient. For decades, researchers began studying the microbiome in search of new prevention strategies. The resident microbiota was found to be closely associated with susceptibility and at times, resistance to S. aureus colonization. The evolution of nucleic acid based techniques has enhanced our understanding of the complex relationship between the nasal microbiota and S. aureus colonization. We review what is known abo
СтатьяПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Selective gene silencing technologies such as RNA interference (RNAi) and nucleic acid enzymes have shown therapeutic potential for treating viral infections. Influenza virus is one of the major public health concerns around the world and its management is challenging due to a rapid increase in antiviral resistance. Influenza vaccine also has its limitations due to the emergence of new strains that may escape the immunity developed by the previous year's vaccine. Antiviral drugs are the primary mode of prevention and control against a pandemic and there is an urgency to develop novel antiviral
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abstract Tick-borne encephalitis virus (TBEV) infection is a common zoonotic disease affecting humans in Europe and Asia. To determine whether TBEV is present in small mammalian hosts in Hungary, liver samples of wild rodents were tested for TBEV RNA. Over a period of 7 years, a total of 405 rodents were collected at five different geographic locations of the Transdanubian region. TBEV nucleic acid was identified in four rodent species: Apodemus agrarius, A. flavicollis, Microtus arvalis, and Myodes glareolus. Out of the 405 collected rodents, 17 small mammals (4.2%) were positive for TBEV. Th
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Oxidative DNA damage can be the consequence of endogenous metabolic processes and exogenous insults and several DNA repair enzymes provide protection against the toxic effects of oxidized DNA bases. Here we review the increasing knowledge on the relationship between an oxidized dNTPs pool and genome instability. The review also describes some important progress toward understanding the role of oxidative DNA damage and its repair in neurodegenerative diseases. In particular the hMTH1 hydrolase destroys oxidized nucleic acid precursors to prevent their harmful incorporation into DNA and RNA. Bas
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A DNA vaccine against contagious agalactia was developed for the first time, encoding the P48 of Mycoplasma agalactiae. Specific immune responses elicited in BALB/c mice were evaluated. Both total IgG and IgG1 were detected in mice vaccinated with pVAX1/P48. Proliferation of mononuclear cells of the spleen, levels of gamma interferon, interleukin-12, and interleukin-2 mRNAs were enhanced in immunized animals. Results indicate that pVAX1/P48 vaccination induced both T(h)1 and T(h)2 immune responses. Nucleic acid immunization could be a new strategy against M. agalactiae infections and may be po
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The history of prion diseases is derived from descriptions of scrapie of sheep and goats in the eighteenth century. In 1920, Creutzfeldt-Jakob disease was reported as the first case of human prion diseases, which was recognized as subacute spongiform encephalopathy, one of neurodegenerative diseases. Afterwards, many transmission experiments were performed, which lead to the establishment of the fundamental concept, transmissible spongiform encephalopathy(TSE). The infectious agent was supposed to be a novel virus, so TSE was classified into slow virus infection. In 1982, Prusiner investigated
Аннотация на английскомИсторическая статьяСтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
There is an urgent need for a small, inexpensive sensor that can rapidly detect bio-warfare agents with high specificity. Bacillus anthracis, the causative agent of anthrax, would be a perilous disease-causing organism in the event of a release. Currently, most anthrax detection research is based on nucleic acid detection, immunoassays and mass spectrometry, with few detection levels reported below 10(5) spores. Here, we show the ability to distinguish Bacillus spores to a level approaching 10(3) spores, below the reported median infectious dose of B. anthracis, using pyrolysis--micromachined
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The first part of this series provided a brief overview of how antimicrobials, the "silver bullets" of modern medicine, are designed to target specific agents of infection. The second part addressed several classes of antibacterials: bacterial cell wall inhibitors (penicillins, cephalosporins), protein synthesis inhibitors (macrolides, tetracyclines, aminoglycosides), and nucleic acid inhibitors (sulfonamides and quinolones). This third section focus on those drugs used to treat mycobacterial infections (Mycobacterium tuberculosis), fungal infections (Candida species, Aspergillus species), and
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования