Several pathways have been implicated in the etiology of the polycystic ovary syndrome (PCOS). The observation of familial aggregation of PCOS is consistent with a genetic component of this disorder. We report on a 21-year-old woman with menstrual irregularity, hirsutism, elevated serum androgen levels and polycystic ovarian morphology on ultrasonography, meeting the diagnostic criteria of PCOS. A cytogenetic investigation was performed because of a congenital heart defect, craniofacial anomalies in infancy (quadricephaly with protruding forehead, flat nasal bridge, low set ears with attached
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Triploidy is constituted by an extra haploid set of chromosomes for a total of 69 chromosomes in humans. A "parent-of-origin" effect has been demonstrated by analysis of cytogenetic polymorphisms of triploidy pregnancies. Two distinct phenotypes of human triploid fetuses have been recognized according to the parental origin of the extra haploid set. The first one or triploidy of diandric type occurs when the extra haploid set of chromosomes arises from the father, the second one or triploidy of digynic type occurs when the extra haploid set of chromosomes arises from the mother. Diandric fetus
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Members of the plakin family of cytolinker proteins integrate filaments into cellular networks and anchor these networks to the plasma membrane. Their importance is supported by the existence of cell and tissue fragility disorders caused by mutations in certain family members. In this study, the human gene encoding desmoplakin (DSP) was characterized and its structure compared with the related family members: plectin, bullous pemphigoid antigen 1 (BPAG1), envoplakin (EVPL) and periplakin (PPL). Sequence analysis of genomic clones was carried out in combination with a PCR-based strategy to defi
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prenatal diagnosis has been introduced in medicine in the seventies with aminocenteses and amniotic cells cultures. It was applied to the diagnosis, during the second trimester of pregnancy for chromosomal abnormalities (mainly Down syndrome in women 38 years of age) and inborn errors of metabolism with very severe handicaps). Since 1970, obstetrical techniques have improved giving access to several fetal biological samples, knowledge in genetics has identified more diseases and biological analyses have become more accurate. During the same time legislation has been instituted: in France the l
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cytogenetic investigations were performed in 781 couples prior to intracytoplasmic sperm injection (ICSI) because of severe male infertility or fertilization failures in previous in-vitro fertilization attempts. Out of these 1562 patients, 1012 had a normal karyotype without any aberrations (64.8%), 204 patients had an abnormal karyotypes (13.1%). These chromosome aberrations included constitutional aberrations (4.4%), fragile sites of autosomes (3.0%), low level mosaicism of sex chromosomes (4.0%) and secondary structural chromosome aberrations (4.2%). Combinations of different types of abnor
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects we
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Previous work from our laboratory demonstrated aneuploidy for several chromosomes by interphase fluorescence in situ hybridization (FISH) in a high proportion of breast cancer specimens. In the literature, only limited data are available concerning chromosome 8 anomalies in breast cancer. To determine chromosome 8 ploidy status in primary and metastatic specimens from 81 breast cancer patients, FISH analysis with a DNA probe recognizing chromosome 8 centromeres was performed. In all primary tumor specimens (n = 30), significant proportions of cells were aneuploid exhibiting gain of chromosome
Сравнительное исследованиеСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The clinical significance of mosaicism trisomy 20 detected prenatally following amniocentesis remains uncertain, due to the rarity of liveborn cases with inconsistent clinical findings, the short postnatal follow-up, and failure in evaluating other fetal tissues for the presence of the trisomy. We report on a 15 month-old 46,XX chromosome constitution in white blood cells, while skin fibroblasts demonstrated trisomy 20 mosaicism (54%) by fluorescence in situ hybridization (FISH) analysis. Clinical examination of the baby showed only minor phenotypic signs (bilateral epicanthal folds, delayed c
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cytogenetic and molecular studies demonstrated that pancreatic cancer frequently shows specific chromosomal abnormalities, such as losses of 9p, 17p, and 18q, and gains of 8q and 20q. We have analyzed alterations in the copy number of specific chromosomal regions in cells from the pancreatic juices of 32 patients with various pancreatic disorders by fluorescence in situ hybridization (FISH) technique to pursue the possible clinical use of early diagnosis of pancreatic cancer. None of the chromosomal abnormalities were found in 13 specimens from individuals who had no neoplastic lesions. On the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Atypical and anaplastic meningiomas tend to recur and to invade adjacent brain, bone, and skin. They also can metastasize to extracranial organs such as the lung, liver, or bone, causing death. Recent reports have indicated that allelic deletion of chromosome 1p is associated with malignant progression of meningiomas.
METHODS: Cytogenetic analysis of 37 meningiomas was performed using double-target fluorescent in situ hybridization (FISH) and focusing on chromosome arm 1p. The meningioma series included 17 benign meningiomas, 11 atypical meningiomas, and 9 anaplastic meningiomas. …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Behçet's disease has rarely been reported in association with myelodysplastic syndromes (MDS). Increased production of reactive … ses of Behçet's disease associated with MDS have been reported to date. Nine patients had undergone cytogenetic analysis of bone marrow cells, 7 of whom (78%) had trisomy 8. Neutrophils taken from the authors' patient during the active phase of Behçet's disease demonstrated an increased CL response. Moreover, serum from this patient increased the CL emission of neutro …
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Peripheral blood lymphocyte morphology and karyotype were correlated across the spectrum of cytogenetic abnormalities in 78 previously karyotyped cases of B-cell chronic lymphocytic leukemia (CLL). Cases were classified according to French-American-British morphologic criteria as typical CLL or CLL, mixed-cell type; the latter category was divided into CLL with a mixture of small and large cells and CLL with increased prolymphocytes (CLL/PL). Other leukemic lymphoproliferative disorders were excluded from this analysis. CLL cases with normal karyotypes were more likely to demonstrate typical m
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: The Smith-Magenis syndrome (SMS) is a multiple-anomaly, mental retardation syndrome associated with deletions of a contiguous region of chromosome 17p11.2. Prior reports have described ophthalmic anomalies with SMS, including telecanthus, ptosis, strabismus, myopia, iris anomalies, cataracts, optic nerve hypoplasia, and retinal detachment. This report defines the ophthalmic spectrum in 28 individuals with SMS subjected to a multidisciplinary clinical and molecular survey.
METHODS: Individuals with deletion of chromosome 17p11.2 detected by high-resolution cytogenetic analysis underwe…
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human pancreatic cancer develops in association with an acquired genomic instability, but the events that lead to instability are difficult … cling tetraploid cell population that had p53 protein overexpression in both G1- and S-phase cells. Cytogenetic analysis of pancreatic samples confirmed the development of a tetraploid cell population. Inactivation of p53 in diploid cells of the transgenic pancreas is followed by the development of a tetraploid cell population. We have shown previously that this tetra …
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We describe the first case of an Epstein-Barr virus (EBV)-associated natural killer-large granular lymphocyte (NK-LGL) leukemia in the United States to the best of our knowledge. A 29-year-old woman of Japanese descent developed EBV infection after a blood transfusion as indicated by a rise in serum antibody titers. Peripheral blood and bone marrow aspirate smears demonstrated increased LGLs. Flow cytometry showed that these cells expressed NK-associated surface antigens. Cytogenetic analysis of the bone marrow aspirate showed two distinct but related clones with multiple copies of a modified …
Клинический случайСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We investigated the hematological and clinical status of 145 patients with de novo myelodysplastic syndrome (MDS), 14 of whom (10%) had eosi … actory anemia (RA), seven had RA with excess of blasts (RAEB), and four had RAEB in transformation. Cytogenetic analysis revealed chromosomal abnormalities in 12 of 13 MDS-Eo patients (92%), in particular, there were major karyotypic abnormalities (MAKA) in eight patients (62%). Cytotoxic agents were not effective in the treatment of four patients after leukemic trans …
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Philadelphia (Ph) chromosome can be detected in the vast majority of patients with chronic myelogenous leukemia (CML). We performed a long-range analysis of chromosomal translocation junction by pulsed-field gel electrophoresis (PFGE) techniques, to examine whether molecular evidence of a reciprocal Ph translocation exists in Ph-positive CML as well as Ph-negative, M-BCR rearrangement-positive CML. The rearrangement within M-BCR and ABL was detected in all patients including nine Ph-positive CML, and three Ph-negative CML. The rearranged 3'-abl fragments showed comigration with rearranged
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A new Epstein-Barr virus nuclear antigen (EBNA)-positive B-cell line, designated BALL-2, was spontaneously established from the peripheral blood of a 14-year-old boy with an EBNA-negative B-cell acute lymphoblastic leukemia (B-ALL), L2 in the French-American-British classification. The BALL-2 cell line grew in suspension with or without forming clumps of cells. The cultured cells exhibited lymphoid morphology with indented or lobulated nuclei, prominent nucleoli, and relatively abundant cytoplasm. Immunologic and cytogenetic studies showed that the BALL-2 cell line expressed the B-cell phenoty
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Transcervical chorionic villus sampling (CVS) was performed in 174 patients between 7 & 12 menstrual weeks of pregnancy opting for prenatal diagnosis. Advanced maternal age was the most common indication for CVS (39.7%). The sampling success rate was 95.4% (166/174), representing 88.9% at 7 to 8 weeks, 98.9% at 9 to 10 weeks & 92.7% at 11 to 12 weeks gestation. In 139 of 174 patients (80%), successful sampling was accomplished in one or two catheter passages only. Four spontaneous fetal losses (2.3%) occurred. The cytogenetic analysis routinely used was the direct overnight & long-term culture…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ten of 136 consecutive adult patients with previously untreated acute leukemia had morphologically undifferentiated leukemia by light micros … ir cells. Common acute lymphoblastic leukemia (ALL) antigen was absent in the nine patients tested. Cytogenetic analysis of blast cells was abnormal in seven patients on whom adequately banded chromosomes were obtained although there were no consistent abnormalities. No patient had a Ph1 chromosome. Only two of the ten patients achieved a complete remission. Morpholog …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования