The observation is reported that in low-passage human keratinocyte colonies cultured under conditions that allow full epidermal differentiation (i) the basement membrane protein BM-600/nicein, identified by the mAb GB3, is codistributed with laminin and collagen type IV as well as with the bullous pemphigoid antigen in footprints deposited by growing and migrating colonies; (ii) the integrin heterodimer alpha 6 beta 4 is codistributed with the same molecules suggesting its spatial association with basement membrane components; (iii) the distribution pattern of alpha 6 beta 4 and BM-600/nicein
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 4-y-old female with severe combined immunodeficiency disease had normal numbers of T cells in her circulation and normal T-cell subsets. However, her T cells proliferated poorly to mitogens and did not proliferate to antigens or to anti-CD3 MAb. IL-2 receptor expression was normal, but IL-2 synthesis was undetectable. The addition of recombinant IL-2 to a mitogen-stimulated culture resulted in normalization of the proliferative response. Northern blot analysis of total RNA derived from the patient's T cells revealed a weak or absent expression of mRNA coding for IL-2, IL-3, IL-4, and IL-5. I
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Mycobacterium bovis bacillus Calmette-Guérin (BCG) vaccine, developed in the 1920s as a treatment and prophylactic for tuberculosis, has proved to be a nonspecific stimulant of the immune system and is now the major form of clinical immunotherapy approved for the treatment of superficial bladder cancer in the United States. However, methods for the production and physical characterization of the vaccine have not been significantly developed since Calmette and Guérin first devised their process for attenuating the organism in 1908. When reconstituted with sterile water immediately before use, t
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were diff
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Three families with polycythemia inherited through apparently different modes are described. Secondary causes of polycythemia were ruled out. Erythropoietin (EPO) levels were normal or low, even after phlebotomy. In vitro erythroid colony growth in standard assay cultures containing EPO was normal; however, in the absence of added EPO, a few progenitors from most of the affected individuals were able to generate recognizable colonies of mature erythroblasts, although these were smaller and proportionately less numerous than seen in polycythemia vera (PV). To search for EPO-receptor changes as
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We studied cultured canine keratinocytes to determine whether they could serve as targets for retrovirus-mediated gene transfer and whether infected cells could persist after transplantation into dogs, a large random-bred model for gene transfer studies. Canine keratinocytes obtained from skin biopsy samples were cultured in vitro with lethally irradiated NIH 3T3 cells used as a feeder layer. The keratinocyte colonies consisted of squamous epithelium with numerous desmosomes, tonofilaments, and keratohyalin granules. In addition, the cells were strongly reactive with monoclonal antibodies to c
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During the past 12 years we studied children with unexplained chronic leukocytosis and other findings suggestive of acute or chronic myeloid leukemia (AML; CML). We used cultures in soft agar of peripheral blood for granulocyte-macrophage colony-forming cell (GM-CFC) analysis. Colonies were counted, examined morphologically and cytochemically and the findings in patients were compared with those in normal children and patients with leukemoid reactions. 2 children with confirmed CML and neurofibromatosis (NF) were similarly evaluated. Additional studies in 1 of them and in his mother who had NF
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
On cytological bone marrow examination we distinguished between pure sideroblastic anaemia (PSA), which is confined to dyserythropoiesis, and refractory anaemia with ring sideroblasts (RARS), which is characterized by additional dysplastic features of granulopoiesis and/or megakaryopoiesis. In a follow-up study of 94 patients with AISA diagnosed according to FAB criteria for myelodysplastic syndromes we found a striking difference in the risk of leukaemic transformation between PSA and RARS (5 year cumulative rate 1.9% v. 48%). Overall survival was much better in PSA than in RARS (5 year cumul
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
An acid/ethanol extract of normal rat liver, both in vitro and in vivo, inhibited the invasion by a highly invasive subpopulation of rat ascites hepatoma cells, AH 130 (LC-AH cells). The addition of 10-80 micrograms/ml extract inhibited the formation of penetrated colonies of LC-AH cells underneath the cultured mesothelial cell (M-cell) monolayer. The tumor cells pretreated with the extract showed the diminished colony formation. Preincubation of the extract with plasma membranes prepared from LC-AH cells abolished the effect of the extract, suggesting a binding of the inhibitory entity [tenta
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Urinary extracts from idiopathic thrombocytopenic purpura (ITP) patients, aplastic anemia (AA) patients and normal subjects were investigated for their effects on in vivo platelet production, and both in vitro and in vivo megakaryocytopoiesis in rodents. Daily intraperitoneal injection of 1.2 absorbance units (AU, A278) of urinary protein for three consecutive days induced statistically significant increases in rat blood platelet numbers. This increase was observed for 1 of 4 ITP urinary extracts and for all 3 AA urinary extracts, and occurred 24 h after the final injection. In vitro levels of
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Adenosine deaminase (ADA) deficiency, an autosomal recessive inborn error of metabolism, leads to severe combined immune deficiency in man. This enzyme, although constitutively expressed in most tissues, is expressed at high level in immature T cells, and study of the pathophysiology of the disorder indicates that increased deoxyadenosine or altered methylation capacity have toxic effects on T-cell maturation. Although bone marrow transplantation can correct the immune deficiency, this therapy is associated with graft-versus-host disease and incomplete immune restoration, and so our laboratory
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
An albumin polysorbate semisolid medium (Ellinghausen McCullough Johnson Harris medium) gelled with gellan gum (Gelrite; Kelco Div., Merck & Co., Inc.) compared favorably with conventional agar media for the cultivation of both pathogenic and saprophytic leptospires. The gellan gum medium supported the growth of all 18 leptospiral strains studied which included an array of serovars with various fastidious growth characteristics. Gellan gum medium was also used advantageously as a long-term maintenance medium; 9- to 12-month-old cultures still contained viable organisms. The colonial growth in
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Epstein Barr virus (EBV) immortalizes human B lymphocytes, resulting in long-term lymphoblastoid cell lines. To date, such cell lines have typically been derived by suspension culture of mixed mononuclear cells, infected in vivo or in vitro with EBV. We have derived 208 lymphoblastoid lines by clonal transformation of peripheral blood lymphocytes from 3 neonates, 3 normal adults, and 1 patient with systemic lupus erythematosus (SLE), utilizing colony formation in agarose and then separate propagation of the colonies in liquid medium. A total of 180 lines have been analyzed for expression of cy
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 32P-labeled fragment of DNA, encoding the major part of the chromosomal ampC beta-lactamase gene of Escherichia coli K-12, was used as a hybridization probe for homologous DNA sequences in colonies of Neisseria gonorrhoeae, Pseudomonas aeruginosa, and different enterobacterial species. The ampC probe detected the presence of homologous DNA sequences in clinical isolates of E. coli, Shigella flexneri, Shigella sonnei, Klebsiella pneumoniae, Salmonella typhimurium, Serratia marcescens, and P. aeruginosa. No hybridization was found with N. gonorrhoeae colonies. In Southern blotting experiments
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Poly(A)-containing RNA was isolated from total RNA of swine gastric mucosa by oligo(dT)-cellulose chromatography, and was translated in a wheat germ cell-free system. Analysis of the translation products by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed that pepsinogen was a major translation product and was synthesized as two different molecular forms with apparent molecular weights of 45,000 and 43,000. The pepsinogen translated in the in vitro translation system had no autocatalytic activity. The pepsinogen mRNA was further purified by sucrose density gradient centrifuga
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Golden Lion Tamarin (Leontopithecus rosalia) is an endangered species of primate indigenous to the coastal rain forest of Brazil. Since 1971 a propagation and behavioral research program has been carried out on a colony of these monkeys at the Zoological Park. Several related animals have died and at necropsy have shown absence of the anterior portion of the diaphragm with a variety of abdominal viscera in the thorax. Diagnostic studies undertaken on the living members of the colony include plain chest radiographs and gastrointestinal series. Four of the animals have been found to have maj
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Urinary proteins from patients with iron deficiency anemia and acquired aplastic anemia were fractionated by chromatography on QAE-Sephadex A-50 and Sephadex G-25. Fractions containing erythroid burst promoting activity (code named regulatory protein RP) were separated from erythropoietin. Mouse bone marrow cells were preincubated for one day in suspension culture, in the presence or absence of RP, transferred to a methylcellulose based system and incubated for six more days with erythropoietin (EPO). It was found that the presence of RP in the preincubation medium had a 2 to 4 fold enhancing
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chronic actinomycetoma associated with grain production was induced in BALB/c mice by subcutaneous inoculation of live Nocardia brasiliensis in Freund incomplete adjuvant into the hind footpads. Similar inoculation of N. asteroides and N. caviae resulted in local tumor formation which healed spontaneously after 5 months, the disease disseminating into the peritoneum, where masses or organisms could be detected. Grains were recovered from superficial skin lesions of N. caviae, but not from the N. asteroides-infected mice. Mycetoma lesions, appearing as early as 1 month after inoculation of 1.2
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The mutabilities of normal and xeroderma pigmentosum variant (XP4BE) human fibroblasts by ultraviolet light (UV) were compared under conditions of maximum expression of the 6-thioguanine resistance (TGr) phenotype. Selection was with 20 micrograms TG/ml on populations reseeded at various times after irradiation. Approx. 6--12 days (4--8 population doublings), depending on the UV dose, were necessary for complete expression. The induced mutation frequencies were linear functions of the UV dose but the slope of the line for normal cells extrapolated to zero induced mutants at 3 J/m2. The postrep
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cultured chinese hamster ovary (CHO) cells were exposed to different concentrations of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) for either 24 hr or 6 days. For cytological consequences of MNNG exposure, CHO cells were treated for 24 hr and allowed a 24 hr recovery period prior to analysis; for the estimation of cytotoxicity of MNNG, cells were treated for 6 days followed by a 6 day recovery period. The cytotoxic effect of MNNG based on the colony-forming ability of treated cells showed a semi-logarithmic decrease in the number of colonies formed with an increase in MNNG concentration. The d
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования