The lytic activity of plague phage II, serovar 3, with respect to 1,800 bacterial strains has been studied: 760 Yersinia pestis strains, 262 Y. pseudotuberculosis strains, 252 Y. enterocolitica strains, 166 Escherichia coli strains, 90 Shigella strains and 270 strains of other species. The phage has been found to lyse 81.8% of Y. pestis strains, 1 Y. pseudotuberculosis strain and 1 Y. enterocolitica strain. The representatives of other 19 bacterial species have proved to be resistant to the phage. Though having a wide range of action within Y. pestis, the phage does not lyse most of the strain
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Phage QuinnAvery produces turbid plaques in Arthrobacter globiformis B-2979 lawns, displays a siphovirus morphology, and is clustered with FF actinobacteriophages. The 43,177 bp genome of QuinnAvery is predicted to contain a tRNA-Arg(TCT) gene and 69 protein-coding genes. Homologs of a subset of QuinnAvery's predicted genes have putative roles in viral structure, particle assembly, host cell lysis, and lysogeny. QuinnAvery's genome is predicted to contain two tyrosine integrases, similar to many other cluster FF phages. However, the area immediately surrounding the integration cassette in Quin…
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this study, a new Salmonella phage, NX263, was isolated from sewage. This phage could lyse 90.57% (48/53) of the bacterial strains tested and showed good activity over a wide range of temperature (up to 60°C) and pH (5-10). Phylogenetic analysis showed that it should be classified as a member of the genus Skatevirus. The genome of phage NX263 is 46,574 bp in length with a GC content of 45.52%. It contains 89 open reading frames and two tRNA genes. No lysogeny, drug resistance, or virulence-associated genes were identified in the genome sequence, suggesting that this phage could potentially …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: Fusobacterium necrophorum, a human and animal pathogen, is the primary etiologic agent of bovine liver abscesses and a driving … med.s.
RESULTS: Four of six isolated phages were able to form lysogens, although all six contained lysogeny-related genes. φKSUM and φBB, did not form lysogens and were able to infect both subspecies. Four phages could infect F. necrophorum 8L1 (a liver abscess model challenge strain) in vitro. Genomic analysis showed that these phages belong to class Cau …
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cyanobacterial blooms dominated by Microcystis spp. pose significant ecological challenges, including the release of toxins and disruption o … nfection strategies diverged by Microcystis community morphology: colony-associated cells expressed lysogeny-associated genes, whereas single cells exhibited increased signatures of lytic infection. These data are consistent with the hypothesis that Microcystis colonies foster conditions favorable to lysogen formation-likely due to local high cell densitie …
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Burkholderia phage AP3 (vB_BceM_AP3) is a temperate virus of the Myoviridae and the Peduovirinae subfamily (P2likevirus genus). This phage s … but are sensitive to chloroform, with no remaining infective particles after 24 h of treatment. AP3 lysogeny can occur by stable genomic integration and by pseudo-lysogeny. The lysogenic bacterial mutants did not exhibit any significant changes in virulence compared to wild-type host strain when tested in the Galleria mellonella moth wax model. Moreover, A …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Shiga toxin-producing Escherichia coli (STEC) are major foodborne pathogens. In response to the need for safe biocontrol strategies, lytic phages have emerged as promising tools for STEC control. This study analyses genomic features of three novel phages, L73, PG3 and A4.3, isolated from cattle farms using STEC strains as hosts. L73 and PG3 were classified as Tequatrovirus, while A4.3 as Vequintavirus. Genomic analyses revealed no markers of lysogeny, antimicrobial resistance, or virulence. Phylogenetic and comparative analyses confirmed close relationships to reference phages of each genus, w…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Viral entry is a critical step in the infection process. Klebsiella spp. and other clinically relevant bacteria often express complex polysaccharide capsules that act as a barrier to phage entry. In turn, most lytic phages targeting Klebsiella encode depolymerases for capsule removal. This virus-host arms race leads to extensive genetic diversity in both capsules and depolymerases, complicating our ability to understand their interaction. This study exploits the genetic information encoded in Klebsiella prophages to model the interplay between the bacteria, the prophages, and their depolymeras
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Bacteriophages (phages) are one of the most promising alternatives to traditional antibiotic therapies, especially against multi … esis and the phage sequencing estimated the phage genome size of 48.2 kbp. Moreover, the absence of lysogeny-related genes, antibiotic resistance genes, and virulence genes in the annotated genome suggests that phage ZCKP2 is safe for therapeutic use. Genome-based taxonomic analysis indicates that phage ZCKP2 represents a new family that has not been forma …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
On the basis of museum strains of the melioidosis agent Pseudomonas pseudomallei, 14 pure lines of bacteriophages were isolated belonging to morphological groups IV and V according to the classification by A. S. Tikhonenko. These phages show a broad bacteriolytic range as far as museum P. pseudomallei cultures are concerned. It was determined that some phages isolated from the same melioidosis culture and belonging to the same morphological type display different bacteriolytic activity. It is demonstrated that some strains of melioidosis agent are characterized by polylysogeny.
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Because of the importance of stannous chloride in various fields of human endeavour, the potential genotoxicity of this reducing agent was evaluated by measurement of either the inactivation or the induction of SOS responses in bacteria. Escherichia coli strains used in this work (wild type, uvrA, recA, lexA and uvrA recA) were treated with stannous chloride; the wild type was found to be the most resistant and the double mutant, the most sensitive strain. As these strains present mutations on specific genes for the repair of DNA, stannous chloride would appear to be capable of inducing and/or
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Results of study of the negative colonies morphology, the structure of corpuscles, antigenic properties, specificity, and the action range permitted to refer the phages obtained from 18 E. coli strain, 1 plaque strain, and 1 pseudotoberculosis bacillus strain to the same group and to identify them with plague phages of serological type 2. Isolation of the same phage type from different bacterial species permits to regard them as "polyhostal" ones. E. coli should be considered as the main carrier of phages belonging to serological type 2. It is suggested that phages existing on microbes belongi
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
There was rapid efflux of L-leucine, L-phenylalanine, and alpha-methyl-D-glucoside after infection of Salmonella typhimurium with the clear plaque mutant C1 of phage P22. The efflux was similar to that observed with cyanide or arsenate treatment except that there was partial recovery in the case of phage infection and almost complete recovery under the condition of lysogeny. There was no efflux after infection with the temperature-sensitive mutant ts16C1 at nonpermissive temperature. Superinfection of superinfection exclusion negative lysogen (sie A minus sie B minus) with C1 led to efflux, wh…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Non-typhoidal Salmonella (NTS) typically cause self-limiting enterocolitis, but can lead to life-threatening invasive diseases, … cing platform, and analyzed with bioinformatics tools to screen for antimicrobial resistance (AMR), lysogeny, virulence, and allergenic genes. The morphological characteristics of four representative phages were examined using Transmission Electron Microscopy.
RESULTS: Thirty-one phages were isolated, with host ranges varying from lysing one strains to al …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Percutaneous cable infection of left ventricular assist device (LVAD) patients is a significant source of morbidity, often caused by biofilm … ed lysogenic lifestyle of the phages. However, none of them have shown any microbiological signs of lysogeny. In conclusion, we have been able to prove in vitro lytic activity of bacteriophages originating from the same LVAD patient. We also found effective phages in biological samples of other patients and wastewater samples, suggesting that patients impl …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Shiga toxin (Stx)-producing Escherichia coli (STEC) are pathogenic E. coli causing diarrhea, hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS). STEC are characterized by a constellation of virulence factors additional to Stx and have long been regarded as capable to cause HC and HUS when possessing the ability of inducing the attaching and effacing (A/E) lesion to the enterocyte, although strains isolated from such severe infections sometimes lack this virulence feature. Interestingly, the capability to cause the A/E lesion is shared with another E. coli pathogroup, the Enteropathog
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования