Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
T-cell lymphomas are a biologically heterogeneous group of diseases with varying clinical presentations and outcomes. We tried to understand the effect of Epstein-Barr virus (EBV) on lymphogenesis, prognostic factors and drug resistance of T-cell lymphomas, and to establish their relationship with international prognostic factors. Formalin-fixed paraffin-embedded tissue sections from 35 patients (12 women and 23 men) with T-cell lymphomas were examined to detect the presence of EBV using RNA in situ hybridization for EBV-encoded small nuclear RNA (EBER) 1/2 and immunohistochemical stain for la
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Primary cultures of prepubertal rat Sertoli cells secrete two major tissue inhibitors of metalloproteinases: TIMP-1 (M(r) 28K) and TIMP-2 (M(r) 21 K). FSH stimulated Sertoli cell TIMP-1 and TIMP-2 activity in a time- and dose-dependent manner and also stimulated TIMP-1 and TIMP-2 protein and messenger RNA levels. These effects were mimicked by the cAMP analog, 8-bromo-cAMP, and the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine. The protein kinase C activating phorbol ester phorbol myristate acetate (TPA) stimulated TIMP-1 but not TIMP-2 activity and messenger RNA levels. Cycloheximid
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
KEY POINTS: Experimental autosomal dominant polycystic kidney disease is associated with longitudinal changes in the kidney micro-RNA and mRNA profiles. Alterations in cellular transport, a feature of CKD, and a common biological process within polycystic kidney disease models and human autosomal dominant polycystic kidney disease, is present from early stages. Early versus late micro-RNA expression changes in autosomal dominant polycystic kidney disease could be targeted for a more tailored therapeutic intervention in the disease.
BACKGROUND: Autosomal dominant polycystic kidney disease (ADP
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Acute kidney injury (AKI) is the main life-threatening complication of crush syndrome (CS), and myoglobin is accepted as the main pathogenic factor. The pattern recognition receptor retinoicacid-inducible gene I (RIG-I) has been reported to exert anti-viral effects function in the innate immune response. However, it is not clear whether RIG-I plays a role in CS-AKI. The present research was carried out to explore the role of RIG-I in CS-AKI.
METHODS: Sprague-Dawley rats were randomly divided into two groups: the sham and CS groups (n = 12). After administration of anesthesia, the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Metabolic dysfunction-associated steatohepatitis (MASH) is increasingly prevalent and lacks effective therapies. Hydroxysteroid 17-beta dehydrogenase 6 (HSD17B6), a liver-enriched enzyme involved in retinoid and steroid metabolism, has not been functionally characterized in MASH pathogenesis.
METHODS: Transcriptomic analysis of PDCD4-deficient livers identified HSD17B6 as a key upregulated gene. Its expression was validated in human MASH liver samples and murine MASH models and localized primarily to hepatocytes via single-cell RNA sequencing. Hepatic 9-cis-retinoic acid (9cRA) wa
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Oculopharyngeal muscular dystrophy (OPMD) is a rare, late-onset, autosomal dominant muscular dystrophy caused by a trinucleotide GCN repeat expansion in the PABPN1 gene on chromosome 14q11.2. The disease is clinically characterised by progressive ptosis, dysphagia, and proximal limb weakness, with onset typically between the fifth and sixth decades. OPMD affects approximately 1:100,000 individuals in Europe, with substantially higher prevalence in specific founder populations, reaching 1:600 among Bukharan Jews and 1:1,000 in French Canadians. The expanded polyalanine tract in PABPN1 promotes
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Pleuroparenchymal fibroelastosis (PPFE) is a rare, most often idiopathic fibrotic lung disease with poor prognosis, mainly affecting adults. Biallelic pathogenic variants in the deoxyguanosine kinase gene (DGUOK) cause a mitochondrial DNA (mtDNA) depletion syndrome, predominantly affecting infants with severe hepatic and neurological disease. Neither detailed pulmonary manifestations nor a pulmonary-dominant phenotype has been reported.
METHODS: We describe nine patients with PPFE and DGUOK-associated mitochondriopathy. Clinical, radiological, histopathological, and genetic data w
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Iron deficiency frequently accompanies chronic heart failure (CHF) and is linked to adverse clinical outcomes. Although intravenous iron replacement has shown clinical benefit in heart failure, whether increasing dietary iron intake can provide cardioprotective effects remains uncertain. In this study, we examined the effects of dietary iron supplementation in a murine model of doxorubicin (Dox)-induced cardiotoxicity. Mice were treated with Dox at 2.5 mg/kg by intraperitoneal injection once weekly for 6 weeks and received either standard chow containing 45 ppm iron or ferric citrate-enriched
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tractional retinal detachment caused by fibroproliferative membrane formation is a vision-threatening complication of proliferative diabetic retinopathy (PDR). Müller cells can acquire myofibroblast-like features during retinal fibroproliferative remodeling, yet the metabolic mechanisms governing these phenotypic changes remain poorly understood. Here, we report that lactate is a metabolic regulator of myofibroblast-like remodeling in Müller cells. Metabolomic profiling revealed elevated vitreous lactate levels in patients with PDR. Consistently, lactate concentrations were increased in the vi
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Therapeutic resistance to trastuzumab remains a critical limitation in the management of HER2-positive (HER2+) breast cancer. Emerging evidence implicates epigenetic regulators, including microRNAs and histone demethylases, in modulating HER2 signaling and drug responsiveness. This study aimed to investigate the mechanistic role of miR-770-5p and its interplay with KDM5B in the context of trastuzumab resistance. An integrative approach combining in silico analyses with in vitro functional assays was employed in trastuzumab-sensitive and -resistant HER2 + breast cancer cell lines. Molecular, su
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bisphenol compounds are pervasive environmental contaminants linked to neuropsychiatric disorders, yet their molecular interactions with major depressive disorder (MDD) pathogenesis remain unclear. This study employed an integrative approach combining network toxicology, machine learning, single-cell analysis, molecular docking, molecular dynamics simulations, and animal experiments to systematically identify key targets and pathways through which bisphenols may contribute to MDD. Network analysis of 123 shared targets between bisphenols and MDD revealed enrichment in corticosteroid responses,
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
G-quadruplexes (G4s) are four-stranded nucleic acid structures that regulate virtually all nucleic acid-dependent cellular processes. At present, most functional studies involving G4s have focused on cancer cells. This study investigated how neurons respond to genotoxic stress induced by quarfloxin (CX-3543), a small molecule that stabilizes G4s. We found that quarfloxin treatment induced DNA damage in neurons, with double-strand breaks enriched in the nucleolus. Proteomic analysis revealed that quarfloxin promoted substantial protein changes, affecting networks associated with Alzheimer's, Pa
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIMS: Diabetes exacerbates periodontitis by intensifying inflammatory responses and impairing tissue regeneration. Hyperglycemia-induced dysfunction of jawbone-derived bone marrow mesenchymal stem cells (BMSCs) contributes to the imbalance of bone remodeling and periodontal homeostasis. This study aimed to reveal the role and regulatory mechanism of stem cell senescence in diabetic periodontitis.
MATERIALS AND METHODS: Diabetic periodontitis model was established in mice by high-fat diet, streptozotocin injections and ligation. Following treatment with high glucose (HG) and Porphyromonas ging
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Glioblastoma (GBM) remains a lethal brain tumor with limited therapeutic options. Metabolic reprogramming, particularly lactate metabolism, plays a critical role in tumor progression and immune evasion.
METHODS: Here, we integrated single-cell RNA sequencing (scRNA-seq), spatial transcriptomics, and machine learning to investigate the heterogeneity of lactate metabolism in GBM.
RESULTS: Using scRNA-seq data (GSE138794), we classified neoplastic cells into high- and low-lactate subgroups and identified nuclear factor of activated T-cells cytoplasmic 4 (NFATc4) as a key transcripti
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Despite advances in therapeutic strategies, acute respiratory distress syndrome (ARDS) mortality remains high. Growing evidence links respiratory microbiome composition to ARDS outcomes. This investigation sought to elucidate how colonizing bacteria and their metabolites influence ARDS pathogenesis. METHODS: Bronchoalveolar lavage fluid (BALF) from patients with pulmonary infections was analyzed by metagenomic next-generation sequencing (mNGS) to identify characteristic bacteria. Bacterial culture supernatants were analyzed by untargeted metabolomics (LC-MS) to identify metabolites
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Lung adenocarcinoma (LUAD) remains a leading cause of cancer mortality, with poor prognosis driven by metastasis and therapeutic resistance. Chromosome 1 open reading frame 112 (C1ORF112) encodes a nuclear protein involved in DNA replication and repair, but its role in LUAD is unclear. To systematically investigate the clinical relevance, functional impact, and transcriptional regulation of C1ORF112 in LUAD through integrative bioinformatic and experimental approaches.
METHODS: C1ORF112 expression and prognostic significance were analyzed using The Cancer Genome Atlas (TCGA) and G
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fourier Transform Infrared (FTIR) spectroscopy combined with nonlinear optical imaging was employed to characterize molecular and structural alterations associated with oral squamous cell carcinoma (OSCC) progression in control, margin, and tumor tissues. Spectral and imaging datasets were evaluated using multivariate statistical analysis and receiver operating characteristic (ROC) analysis to identify disease-associated features and assess their discriminatory performance. Integration of second- and third-harmonic generation (SHG/THG) imaging with histopathological staining provided complemen
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: V-domain immunoglobulin suppressor of T-cell activation (VISTA), an immune checkpoint protein, is overexpressed in multiple cancers. However, its mechanistic role in ovarian cancer (OC) remains largely undefined. METHOD: Transcriptomic analysis of OC cohorts (OCA and OCB) and single-cell RNA sequencing (GSE184880) were conducted to evaluate VISTA expression and associated pathway enrichment. Functional assays, including proliferation, migration, and epithelial-mesenchymal transition (EMT) analyses, along with in vivo models, were employed to determine the role of VISTA in OC progre
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To investigate whether epiregulin (EREG) mitigates type 2 diabetes-associated cognitive dysfunction (T2DM-ACD) by inhibiting hippocampal ferroptosis via the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway. T2DM mice received EREG or vehicle for 4 weeks. Cognitive function was assessed by Morris water maze. Hippocampal neuronal damage was evaluated by Nissl staining, and ferroptosis-related protein expression was assessed by immunofluorescence. Transcriptomic profiling was performed by RNA sequencing in HT22 cells under control, high-glucose, and EREG-treated conditions. HT22 hippoca
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования