We investigated the ultrastructure of myeloma cells obtained from four cases of common acute lymphoblastic leukemia antigen (CALLA)-positive myeloma. Clinically, the disease was aggressive and our patients died with a median survival after diagnosis of only 62 days. By light microscopic criteria of Greipp et al., their disease was classified as plasmablastic, immature (two cases), and intermediate. In contrast, the myeloma cells of all four cases were judged to be immature and abnormal on the basis of the electron microscopic observation. Characteristic features were sparse heterochromatin, hi…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Banding studies in 25 Robertsonian translocations showed that all could be interpreted as stable dicentrics. The mechanism for their stability is likely to be the proximity of their centromeres but centromeric suppression could also have a role. In many of these dicentric translocations, discontinuous centromeric suppression, as indicated by chromatid separation at one of the centromeric regions, was observed in C-banded preparations. A further observation of undefined relation to the first was that the ratio of the two constitutive centromeric heterochromatin (CCH) regions from the component …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human tissues require a mechanism to generate durable, yet modifiable, transcriptional memories to sustain cell function across a lifetime. Previously, we demonstrated that nanoscale packing domains couple heterochromatin (cores) and euchromatin (outer zone) into unified reaction volumes that can generate transcriptional memory. In prior work, this framework demonstrated that RNA synthesis occurred within the ideal zone (intermediate density) portions of the domain. Naturally, this creates a question of where genes are positioned in relation to the packing domain architecture and which genetic…
СтатьяПрепринтПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Lamins form a proteinaceous meshwork as a major structural component of the nucleus. Lamins, along with their interactors, act as determinants for chromatin organization throughout the nucleus. The major dominant missense mutations responsible for autosomal dominant forms of muscular dystrophies reside in the Ig fold domain of lamin A. However, how lamin A contributes to the distribution of heterochromatin and balances euchromatin, and how it relocates epigenetic marks to shape chromatin states, remains poorly defined, making it difficult to draw conclusions about the prognosis of lamin A-medi…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Germline mutations in SMCHD1, DNMT3B and LRIF1 can cause facioscapulohumeral muscular dystrophy type 2 (FSHD2). FSHD is an epigenetic skeletal muscle disorder in which partial failure in heterochromatinization of the D4Z4 macrosatellite repeat causes spurious expression of the repeat-embedded DUX4 gene in skeletal muscle, ultimately leading to muscle weakness and wasting. All three proteins play a role in chromatin organization and gene silencing; however, their functional relationship has not been fully elucidated. Here, we show that knockdown of Lrif1 , but not of the other two FSHD2 genes, …
СтатьяПрепринтПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have studied the three-dimensional (3D) cytoarchitecture of the human hippocampus in neuropathologically healthy and Alzheimer's disease … he electron density and its spatial heterogeneity. The latter can be explained by a higher ratio of heterochromatin to euchromatin. Similarly, many other structural properties can be derived from the data, reflecting both the natural polydispersity of the hippocampal cytoarchitecture between different individuals in the physiological context and the structural ef …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Japanese wrinkled frog (Glandirana rugosa) is unique in having both XX-XY and ZZ-ZW types of sex chromosomes within the species. The gen … G. rugosa has unique genome characteristics with a high CG frequency, and its genome is assumed to heterochromatinize a large size of genome via methylataion of CG.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chromobox protein homolog 3 (CBX3), a core component of the heterochromatin proteins 1, is recently proved to be involved in human cancerogenesis and associated with the prognosis of patient. However, the role of CBX3 in Tongue squamous cell carcinoma (TSCC) remains unclear. In the present study we found that CBX3 was upregulated in TSCC tissues when compared to adjacent non-tumor tissues, and multivariable analysis showed that high CBX3 expression was associated with clinical stage and cervical node metastasis, which was an independent prognostic indicator of TSCC. Furthermore, Kaplan-Meier s…
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Ulcerative colitis (UC) is a common inflammatory bowel disease (IBD) producing intestinal inflammation and tissue damage. The precise aetiol … sulphate (DSS)-induced colitic mice. We found that bromo-adjacent homology domain (BAHD1), a novel heterochromatinization factor in vertebrates, was the most downregulated gene. We further validated a potential role of BAHD1 as a regulatory factor for inflammation through the TNF signalling pathway in vitro. Our findings indicate that computational approaches le …
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Microscopically visible copy number variations within the proximal short arm heterochromatin and proximal long arm of chromosome 9 have been described as euchromatic variants (EVs) and are derived from extensive segmental duplications (SDs) that map to both the proximal short and long arms of chromosome 9. Recently, 3-4 additional copies of an SD cassette were found in 2 families with duplication EVs of 9q13-q21. Here, we report a third family with a duplication EV of 9q13-q21.1 that was ascertained at prenatal diagnosis for advanced maternal age and found in the fetus and her phenotypically n…
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chromosome pairing is involved in X chromosome inactivation, a classic instance of monoallelic gene expression. Antigen receptor genes are a … cells. RAG-mediated cleavage on one allele induces the other allele to relocate to pericentromeric heterochromatin (PCH), likely to ensure that only one allele is cut at a time. This relocation to PCH requires the DNA damage sensor ATM (ataxia telengiectasia mutated). In the absence of ATM, repositioning at PCH is diminished and the incidence of cleavage on both …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
(Y;autosome) translocations have been reported in association with male infertility. Different mechanisms have been suggested to explain the … generated the loss of the long arm of the Y chromosome involving a large part of AZFb, AZFc and Yq heterochromatin regions. Testicular tissue analyses showed sperm in the wet preparation. Our case shows the importance of documenting (Y;autosome) translocations with molecular and testicular tissue analyses.
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cytogenetic abnormalities with schizophrenia may provide a valuable clue to the identification of target loci and successful search for majo … acentric chromosomes, and 47,XXY. The seven cases with pericentric inversion and enlargement of the heterochromatin region of chromosome 9 (inv(9); 9qh+) were observed in the study. The incidence (5.2%) of inv(9) and 9qh+ in our schizophrenic patients were found higher than the general population, suggesting that a susceptibility locus for schizophrenia may be lo …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Chimerism quantification (CQ) after sex-matched bone marrow transplantation (BMT) is based on the identification of autosomal differences distinguishable at the chromosomal level, such as variations within constitutive heterochromatin between the recipient and the donor. The probability of finding distinguishable recipient/donor pairs at the karyotypic level depends on the frequency of the chromosome variants or morphs in the population, on whether recipient and donor are related, and if so, their kinship relation. We have developed a population genetics-based method that allows the estimation…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Abnormal chromatin clumping syndrome (ACCS) is a rare granulocyte disease halfway between Ph'-negative chronic myelogenous leukaemia (CML) and the myelodysplastic syndromes. A new case of such syndrome is presented, the patient being a 65 year-old man with anaemia, thrombocytopenia and myelaemic leucocytosis with abnormal condensation of the neutrophils' chromatin. Marked granulocytic hyperplasia was present in the bone marrow with strikingly dysplastic features, along with a decrease of the remaining blood cell lines. Irregular nuclear outlines and heterochromatin clumps separated by euchroma…
Клинический случайАннотация на английскомСтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Intaductal papillomas, papillary carcinomas, and normal mammary large ducts were studied by electron microscopy. The intraductal papillomas were divided into two subtypes: fibrous and glandular. Comparative ultrastructural analysis of these two subtypes revealed definitive differences in the nucleus, chromatin, and presence of myoepithelial cells. An irregularly shaped nucleus, aggregated heterochromatin, and prominent myoepithelial cells were the conspicuous features of the fibrous type which appeared to be almost absent in the glandular type. Moreover, the fibrous type possessed intact basal…
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT t … ellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and tha …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Investigating the physiological regulation of the epigenome using genetically engineered mouse models, with a focus on heterochromatic regions of DNA, presents two major challenges: (i) the isolation and preparation of high-quality nuclei from tissue for analysis, (ii) the computational considerations for repetitive regions of the genome. Here we outline the experimental methods for tissue procurement and cryopreservation used in our laboratory, and the steps for nuclei isolation, which can be used for several downstream epigenomic and transcriptomic applications, including ATAC-seq, CUT&RUN,
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Structural variants (SVs) constitute a large proportion of the genomic variation that results in phenotypic variation in plants. However, they are still a largely unexplored feature in most plant genomes. Here, we present the whole-genome landscape of SVs between two model legume Medicago truncatula ecotypes-Jemalong A17 and R108- that have been extensively used in various legume biology studies.
RESULTS: To catalogue SVs, we first resolved the previously published R108 genome assembly (R108 v1.0) to chromosome-scale using 124 × Hi-C data, resulting in a high-quality genome assemb
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
B chromosomes are small, heterochromatic chromosomes that are transmitted in a non-Mendelian manner. We have identified a stock of Drosophil … ATAT satellite sequence. Although the AATAT sequence comprises the majority of the 4(th) chromosome heterochromatin, the B chromosomes lack most, if not all, 4(th) chromosome euchromatin. Presumably as a consequence of their heterochromatic content, these B chromosomes significantly modify position-effect variegation in two separate reporter systems, acting as en …
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования