Forkhead box N1 (FOXN1) is a member of the forkhead box family of transcription factors and plays an important role in thymic epithelial cell differentiation and development. FOXN1 mutations in humans and mice give rise to the "nude" phenotype, which is marked by athymia. FOXN1 belongs to a subset of the FOX family that recognizes an alternative forkhead-like (FHL) consensus sequence (GACGC) that is different from the more widely recognized forkhead (FKH) sequence RYAAAYA (where R is purine, and Y is pyrimidine). Here, we present the FOXN1 structure in complex with DNA containing an FHL motif
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIM: DNA methyltransferases (DNMTs) are important drug targets for epigenetic therapy of cancer. Nowadays, non-nucleoside DNMT inhibitors are in development to address high toxicity of nucleoside analogs. However, these compounds still have low activity in cancer cells and mode of action of these compounds remains unclear.
MATERIALS & METHODS: In this work, we studied maleimide derivatives of RG108 by biochemical, structural and computational approaches to highlight their inhibition mechanism on DNMTs.
RESULTS: Findings demonstrated a correlation between cytotoxicity on mesothelioma cells of
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Nudix hydrolases (Nd) is a widespread superfamily, which is found in all classes of organism, hydrolyse a wide range of organic pyrophosphates and has a 'housecleaning' function. The previous study showed that Trichinella spiralis Nd (TsNd) bound to intestinal epithelial cells (IECs), and the vaccination of mice with T7 phage-displayed TsNd polypeptides produced protective immunity. The aim of this study was to clone, express and identify the full-length TsNd and to investigate its immune protection against T. spiralis infection.
METHODS: The full-length cDNA sequence of TsNd gene
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Upon induction of DNA damage by ionizing radiation (IR), members of the phosphatidylinositol 3-kinase-like kinase family of proteins namely ataxia-telangiectasia mutated (ATM), DNA-PKcs, and ATM- and Rad3-related (ATR) maintain genomic integrity by mounting DNA damage response (DDR). Recent reports suggest that activation of ATM and ATR are oppositely regulated by the length of single stranded overhangs generated during end processing by nucleases at the break sites. These stretches of single stranded overhangs hold the clue for the transition from ATM to ATR signaling at broken DNA ends. We i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Antibiotic resistance poses a significant challenge to human health and its rate continues to rise globally. While antibiotic-selectable synthetic plasmid vectors have proved invaluable tools of genetic engineering, this class of artificial recombinant DNA sequences with high expression of antibiotic resistance genes presents an unknown risk beyond the laboratory setting. Contamination of environmental microbes with synthetic plasmid vector-sourced antibiotic resistance genes may represent a yet unrecognized source of antibiotic resistance. In this study, PCR and real-time quantitative PCR wer
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In the filamentous fungus Penicillium chrysogenum, microbodies are essential for penicillin biosynthesis. To better understand the role of these organelles in antibiotics production, we determined the matrix enzyme contents of P. chrysogenum microbodies. Using a novel in silico approach, we first obtained a catalogue of 200 P. chrysogenum proteins with putative microbody targeting signals (PTSs). This included two orthologs of proteins involved in cephalosporin biosynthesis, which we demonstrate to be bona fide microbody matrix constituents. Subsequently, we performed a proteomics based invent
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A cDNA library was constructed from muscle larvae of Trichinella pseudospiralis. A cDNA clone, designated as Tp8 contained a cDNA transcript of 1326 bp length with a single open reading frame, which encoded 303 amino acid residues (34,187 Da, estimated molecular mass). The predicted amino acid sequence of the clone had an identity of approximately 60% to the Rcd1 (Required cell differentiation 1) -like proteins among a wide range of organisms. Real-time quantitative polymerase chain reaction results showed that the transcription level of Tp8 gene reached the highest value in adult worms, and t
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the ve
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Type 2A von Willebrand disease (VWD) is mostly an autosomal dominantly inherited bleeding disorder characterised by a qualitative defect of von Willebrand factor (VWF). Mutation screening was used to screen the whole of VWF gene followed by direct sequencing to detect the mutation in a father and son diagnosed with type 2A (phenotype IIA) von Willebrand disease. A C5219 to A transversion was detected predicting Leucine to Isoleucine substitution in codon 1657. This novel missense mutation which was also identified by MboI restriction enzyme analysis, was found in both patient and his father bu
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The damaged DNA-binding protein (DDB) is believed to be involved in DNA repair, and it has been linked to the repair deficiency disease xeroderma pigmentosum. DDB also exhibits transcriptional activities. DDB binds to the activation domain of E2F1 and stimulates E2F1-activated transcription. Here we provide evidence that DDB or DDB-associated proteins are targets of cullin 4A (CUL-4A). CUL-4A is a member of the cullin family of proteins, which are believed to be ubiquitin-protein isopeptide ligases (type E3). The CUL-4A gene has been shown to be amplified and up-regulated in breast carcinomas.
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Novel mRNA isoforms encoding the enamel matrix proteins amelin-1, amelin-2 and ameloblastin have been recently described. We have applied detailed immunohistochemical as well as non-radioactive in situ hybridization analyses to follow amelin-1 expression in developing rat incisors and molars. We constructed an expression vector, overproduced recombinant amelin in Escherichia coli and prepared an antibody. In addition to the previously reported amelin mRNA expression patterns in ameloblasts, the amelin message was also detected in pulpal mesenchymal cells including preodontoblasts and young odo
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Classical phenylketonuria (PKU), which predisposes affected individuals to severe mental retardation, is caused by a deficiency of hepatic phenylalanine hydroxylase (PAH). A recombinant adenoviral vector containing the human PAH cDNA was constructed and administered to PAH-deficient mice (strain PAHenu2). The hyperphenylalaninemic phenotype of these animals was completely normalized within 1 week of treatment. Although this therapeutic effect did not persist, analysis of the relationship between hepatic PAH activity and serum phenylalanine levels indicated that only 10-20% of normal enzymatic
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Disease activity in systemic lupus erythematosus is closely associated with the appearance of immunoglobulin (Ig)G antibody to native DNA in both humans and mice. Like normal antibody responses, the anti-DNA autoantibody first appears as IgM and then switches to IgG. Structural studies of IgG anti-DNA suggest that these antibodies are the products of clonally selected, specifically stimulated B cells. The origins of the IgM anti-DNA have been less clear. To determine whether the earlier appearing IgM anti-DNA antibody in autoimmune mice also derives from clonally selected, specifically stimula
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: In this paper, we report two new original deletions and present an extended review of the previously characterized AVPR2 gene deletions to better understand the underlying deletion mechanisms.
METHODS: The two novel deletions were defined using polymerase chain reaction mapping and junction fragment sequencing. Bioinformatic analysis was performed on both the previously mapped deletions and the novel ones through several web tools.
RESULTS: In our two patients with nephrogenic diabetes insipidus, we found a 23 755 bp deletion and a 9264 bp deletion both comprising the entire AVPR
Клинический случайРедакционная статьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In Gram-negative bacteria, autotransporters are secreted proteins able to translocate themselves through the inner- and outer-membranes to the cell surface or to the extracellular environment. The influence of the putative outer membrane autotransporter (OmaA) protein to the persistence of Brucella suis was investigated. Sequence analyses revealed that the OmaA protein of B. suis strain 1330 consists of a signal peptide, a passenger alpha-domain, and a transporter beta-domain, which are the characteristic components of an autotransporter protein. The transporter beta-domain consists of 14 indi
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prokaryotic insertion sequence (IS) elements behave like parasites in terms of their ability to invade and proliferate in microbial gene pools and like symbionts when they coevolve with their bacterial hosts. Here we investigated the evolutionary history of IS605 and IS607 of Helicobacter pylori, a genetically diverse gastric pathogen. These elements contain unrelated transposase genes (orfA) and also a homolog of the Salmonella virulence gene gipA (orfB). A total of 488 East Asian, Indian, Peruvian, and Spanish isolates were screened, and 18 and 14% of them harbored IS605 and IS607, respectiv
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A Taenia solium larval glutathione S-transferase fraction (SGSTF), composed of two proteins with Mr 25,500 (SGSTM1) and 26,500 (SGSTM2), was purified by GSH-sepharose. Its N-terminal sequence analysis revealed that both proteins are related to mammalian mu-class GST enzymes. A cDNA clone coding for SGSTM1 was isolated and the amino acid sequence analysis showed close identity with two Echinococcus GSTs and also high identity with several mu-class GSTs that have been reported. In addition, SGSTM1 presents a similar structure to mu-class GSTs, including the mu loop. The recombinant SGSTM1 is a d
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We recently described the phase-variable expression of a virulence-associated lipopolysaccharide (LPS) epitope in Legionella pneumophila. In this study, the molecular mechanism for phase variation was investigated. We identified a 30 kb unstable genetic element as the molecular origin for LPS phase variation. Thirty putative genes were encoded on the 30 kb sequence, organized in two putative opposite transcription units. Some of the open reading frames (ORFs) shared homologies with bacteriophage genes, suggesting that the 30 kb element was of phage origin. In the virulent wild-type strain, the
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To study the alternative splicing of fibronectin during embryogenesis and oncogenic transformation, we isolated cDNA clones of chicken fibronectin. The partial amino acid sequence deduced from sequencing of these clones showed that, overall, chicken fibronectin is approximately 80% identical with mammalian fibronectins. However, two of the three known regions of alternative splicing differed from this average. The V region was significantly more divergent, and RNA from embryonic chicken liver showed a pattern of V exon splicing which was distinct from that seen in human or rat fibronectins. In
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Escherichia coli mutant hfl-1 is lysogenized at very high frequency by bacteriophage lambda. The normal requirement for the lambdacIII gene product in the establishment of repression is not observed in hfl-1 strains. These phenotypic characteristics are specified by a single locus at 82.5 min on the E. coli map in extremely close proximity to the purA gene, cotransduction frequencies ranging from 97 to 100% depending on the particular purA marker used. The lactose operon is shown to function normally in this strain, and there are also no demonstrable differences in ribonucleic acid polymer
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования