Protein limitation in vivo or amino acid deprivation of cells in culture causes a signal transduction cascade consisting of activation of the kinase GCN2 (general control nonderepressible 2), phosphorylation of eukaryotic initiation factor 2, and increased synthesis of activating transcription factor (ATF) 4 by a translational control mechanism. In a self-limiting transcriptional program, ATF4 transiently activates a wide range of downstream target genes involved in transport, cellular metabolism, and other cell functions. Simultaneous activation of other signal transduction pathways by amino
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The spliceosomal protein p14, a component of the SF3b complex in the U2 small nuclear ribonucleoprotein (snRNP), is essential for the U2 snRNP to recognize the branch site adenosine. The elucidation of the dynamic process of the splicing machinery rearrangement awaited the solution structural information. We identified a suitable complex of human p14 and the SF3b155 fragment for the determination of its solution structure by NMR. In addition to the overall structure of the complex, which was recently reported in a crystallographic study (typical RNA recognition motif fold beta1-alpha1-beta2-be
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Penicillin-binding protein 2 (PBP2) from N. gonorrhoeae is the major molecular target for beta-lactam antibiotics used to treat gonococcal infections. PBP2 from penicillin-resistant strains of N. gonorrhoeae harbors an aspartate insertion after position 345 (Asp-345a) and 4-8 additional mutations, but how these alter the architecture of the protein is unknown. We have determined the crystal structure of PBP2 derived from the penicillin-susceptible strain FA19, which shows that the likely effect of Asp-345a is to alter a hydrogen-bonding network involving Asp-346 and the SXN triad at the active
СтатьяПоддержка NIH: внешняя программаПоддержка правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Three NUP98 chimaeras have previously been reported in T cell acute lymphoblastic leukaemia (T-ALL): NUP98/ADD3, NUP98/CCDC28A, and NUP98/RAP1GDS1. We report a T-ALL with t(11;18)(p15;q12) resulting in a novel NUP98 fusion. Fluorescent in situ hybridisation showed NUP98 and SET binding protein 1(SETBP1) fusion signals; other analyses showed that exon 12 of NUP98 was fused in-frame with exon 5 of SETBP1. Nested polymerase chain reaction did not amplify the reciprocal SETBP1/NUP98, suggesting that NUP98/SETBP1 transcript is pathogenetically important. SETBP1 has previously not been implicated in
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PBK/TOPK is a recently identified 322 amino acid serine/threonine kinase that is phosphorylated during mitosis and may include p38 MAPK among its targets. Previous work has shown up-regulated expression of PBK/TOPK mRNA in a variety of tumor cell lines and fetal tissues, suggesting a role for this kinase in malignant cell proliferation. In this paper, PBK/TOPK protein expression was examined in a variety of primary hematologic neoplasms: PBK/TOPK was readily detected in 9 of 12 AML samples (75%), in 3 of 3 ALL samples, and in 1 sample each of a plasmacytoma and blastic type mantle cell lymphom
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Telomere maintenance is a prerequisite for immortalisation, and in most malignant cells is carried out by telomerase, an enzyme that synthesis new telomeric repeats on the chromosome ends. In normal or reactive tissues with a high regenerative capacity, telomerase is regulated according to the telomere loss that occurs during proliferation. To evaluate the interaction of proliferation and telomerase activity in malignant lymphomas, we quantified telomerase expression in different non-Hodgkin lymphomas in comparison to normal or reactive lymph nodes. Surprisingly, the activity levels were the s
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Experimental autoimmune uveitis (EAU) and pinealitis (EAP) can be induced in susceptible mice by immunization with immunologically privileged retinal antigens. In the present study, we analyzed the immunologic and immunopathologic responses of mice deficient in the retinal autoantigen interphotoreceptor retinoid-binding protein (IRBP). The consequences of IRBP deficiency on the T-cell repertoire were also investigated. IRBP+/+, IRBP+/- and IRBP-/- mice on the C57BL/6 background were immunized with IRBP or with a pathogenic epitope, IRBP(1-20) peptide in adjuvant, and were evaluated for disease
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cicatricial pemphigoid (CP) is an autoimmune mucocutaneous blistering disease associated with scarring. Heat shock protein 47 (HSP47) is thought to play an important role in fibrogenesis, but its role in skin lesions of cicatricial pemphigoid is not yet known. In the present study, we examined the role of HSP47 in dermal fibrosis in cutaneous lesions of a CP patient. Skin biopsies from a patient with CP, and from normal subjects were studied for the expression of HSP47, and interstitial collagens (type I and type III collagens) by immunohistochemistry. Dermal fibroblasts isolated from skin of
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Previous studies have shown that hypoxia results in increased phosphorylation of CREB protein that mediates gene expression including that of the pro-apoptotic gene bax. We also have shown that hypoxia-induced expression of Bax protein is prevented by blocking nitric oxide synthase (NOS). The present study tests the hypothesis that inhibition of NOS by N-nitro-L-arginine (NNLA) will prevent the hypoxia-induced increased phosphorylation of CREB protein in neuronal nuclei of newborn piglets. To test this hypothesis, phosphorylation of CREB protein was assessed by immunoblotting neuronal nuclear
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Dexras1 is a novel GTP-binding protein that shares structural similarity with the Ras family of small molecular weight GTPases and is strongly and rapidly induced during treatment with dexamethasone. The function of Dexras1 and its contribution to glucocorticoid-dependent signaling in the corticotroph cell are unknown. The present study was undertaken to examine the potential role of Dexras1 in the regulation of peptide hormone secretion in the AtT-20 corticotroph cell line. To determine the effects of Dexras1 expressed independently of glucocorticoid treatment, expression plasmids for wild-ty
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
5-HT(1A) receptors are implicated in the aetiology of schizophrenia. Herein, the influence of 15 antipsychotics on the binding of the selective 'neutral' antagonist, [3H]WAY100,635 ([3H]N-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-N-(2-pyridinyl)-cyclo-hexanecarboxamide), was examined at human 5-HT(1A) receptors expressed in Chinese Hamster Ovary cells. In competition binding experiments, 5-HT displayed biphasic isotherms which were shifted to the right in the presence of the G-protein uncoupling agent, GTPgammaS (100 microM). In analogy, the isotherms of ziprasidone, quetiapine and S16924 (
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The involvement of signaling factors, which are related to serum component, on the regucalcin mRNA expression in the cloned rat hepatoma cells (H4-II-E) was investigated. The change in regucalcin mRNA levels was analyzed by Northern blotting using rat liver regucalcin complementary DNA (0.9 kb of open reading frame). H4-II-E cells were cultured for 2 or 6 h in a medium containing various reagents in the presence of serum (10% fetal bovine serum) after the subconfluent with 3-day-culture. The regucalcin mRNA expression was significantly increased by serum addition. This increase was clearly inh
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Long-acting gonadotropin-releasing hormone (GnRH) analogs (GnRH-a) suppress gonadal steroid production and are used in precocious puberty, resulting in an arrest of pubertal development, a slower epiphyseal maturation, and a deceleration of growth, but an increased final height. However, the way that GnRH-a affect growth is not clear. GnRH-a treatment might not only affect gonadal steroid production but might also modulate the GH axis and thereby affect growth. We used a rat model to investigate the long-term effects of prepubertally started GnRH-a treatment (triptorelin) on growth, spontaneou
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have identified the first putative integral membrane pentraxin and named it neuronal pentraxin receptor (NPR). NPR is enriched by affinity chromatography on columns of a snake venom toxin, taipoxin, and columns of the taipoxin-binding proteins neuronal pentraxin 1 (NP1), neuronal pentraxin 2 (NP2), and taipoxin-associated calcium-binding protein 49 (TCBP49). The predominant form of NPR contains an putative NH2-terminal transmembrane domain and all forms of NPR are glycosylated. NPR has 49 and 48% amino acid identity to NP1 and NP2, respectively, and NPR message is expressed in neuronal regi
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Although the 56-kDa protein of Rickettsia tsutsugamushi has been presumed to play important roles in generating protective immunity against scrub typhus, studies of this protein have been impeded. We used the recombinant 56-kDa protein of R. tsutsugamushi Boryong fused with the maltose-binding protein of Escherichia coli (MBP-Bor56) to analyze its ability to induce protective immunity in a C3H/HeDub murine model. Intraperitoneal immunization of mice with MBP-Bor56 resulted in an increase in the 50% minimal lethal dose of more than 160 times compared with that for the control mice. Splenic mono
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A model in which two positively-charged titratable sites enhance the affinity for anionic substrates can explain the increase in external iodide dissociation constant (K(O)(I)) with increasing pH(O) (Liu, S. J., F.-Y. Law, and P.A. Knauf. 1996.f Gen.Physiol. 107:271-291). If sulfate binds to the same external site as I-, this model predicts that the SO(4)= dissociation constant (K(O)(S)) should also increase. The data at pH 0 8.5 to 10 fit this prediction, and the pK for the titration is not significantly different from that (pKc) for the low-pK group that affects K(O)(1). The dissociation con
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Using radioactive in situ hybridization histochemistry, we examined the topographical patterns of expression of the messenger RNA encoding a glutamate-binding protein (N-methyl-D-aspartate receptor glutamate-binding protein in rat; NMDARgbs) in the central nervous system of the rat. Expression patterns of N-methyl-D-aspartate receptor glutamate-binding protein were compared with those of N-methyl-D-aspartate receptor subunit 1 (NMDAR1) of the N-methyl-D-aspartate receptor on adjacent sections. N-methyl-D-aspartate receptor glutamate-binding protein is not expressed in glial cells. The expressi
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: The high-affinity growth hormone (GH)-binding protein corresponds to the extracellular domain of GH receptor. The direct role of sex steroids in pubertal bone growth may be an increased GH receptor-coupled GH action. We examine the GH-binding protein (GHBP) activity before and after the suppression of female sex steroids and the relation of GHBP to pubertal growth.
PATIENTS: We studied six girls with central idiopathic sexual precocity without any prior gonadal suppression therapy.
DESIGN: We measured GHBP activity before and 12, 24 and 48 weeks after the treatment with s.c. injec
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Intrinsic resistance toward beta-lactams in methicillin-resistant Staphylococcus aureus strains, a major source of nosocomial infections, is believed to be caused mainly by penicillin-binding protein 2a (PBP2a). This protein resembles other penicillin-binding proteins that are involved in bacterial cell wall biosynthesis and are the targets of active site acylation by beta-lactam antibiotics. PBP2a, however, presumably remains active at therapeutic concentrations of beta-lactams. In this paper, we describe a three-step purification of a soluble form of PBP2a (PBP2a') to apparent homogeneity us
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования