Результаты поиска

Watchful waiting in children with unifocal osseous Langerhans cell histiocytosis.

BackgroundLangerhans cell histiocytosis (LCH) is a rare inflammatory neoplasm most commonly involving bone. However, data on single-system, single-site LCH (SS-s-LCH), particularly with unifocal bone disease, remain limited. Management strategies for unifocal osseous LCH vary globally, and the safety of a watchful-waiting approach is not well-defined. This study aimed to evaluate whether patients with osseous SS-s-LCH can be managed with observation alone without compromising long-term outcomes.MethodsIn this retrospective, multicenter study, we enrolled children with biopsy-proven osseous SS-

Совпадение в полном тексте источника
… Dong Wang, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing 100045, China. Jiafeng Yao, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing 100045, China. … Zishi Fang, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing 100045, China. Wenqian Wang, Beijing Children’s Hospital, Capital Medical University, National Center for Children’s Health, Beijing 100045, China. …

Silencing of SPARC represses heterotopic ossification via inhibition of the MAPK signaling pathway.

Heterotopic ossification (HO), the pathologic formation of extraskeletal bone, can be disabling and lethal. However, the underlying molecular mechanisms were largely unknown. The present study aimed to clarify the involvement of secreted protein acidic and rich in cysteine (SPARC) and the underlying mechanism in rat model of HO. The mechanistic investigation on roles of SPARC in HO was examined through gain- and loss-of-function approaches of SPARC, with alkaline-phosphatase (ALP) activity, mineralized nodules, and osteocalcin (OCN) content measured. To further confirm the regulatory role of S

Совпадение в полном тексте источника
… Subsequently, the sections were coupled with horseradish peroxidase (HRP)-labeled streptavidin protein working solution (0343-10000U, Beijing Yimo Biotechnology Co., Ltd., Beijing, China) for additional incubation under similar parameters. … The membrane was then incubated, this time with the HRP-labeled rabbit anti-human IgG (F020218, Beijing Biolab Technology Co., Ltd., Beijing, China). The membrane was reacted with an enhanced chemiluminescence reagent (ECL808-25, Biomiga San Diego, CA, U.S.A.) for 1 min. …

Targeted drug approvals in 2023: breakthroughs by the FDA and NMPA.

Аннотация не предоставлена источником. Откройте карточку для перехода к публикации.

Совпадение в полном тексте источника
… . | Small molecule | Takeda Pharmaceutical Co., Ltd. 3 | Kispali | Ribociclib | 1/19/2023 | CDK4/6 inhibitor | For the treatment of breast cancer | Small molecule | Beijing Novartis Pharma Ltd. 4 | | Simnotrelvir/Ritonavir | 1/28/2023 | HIV-1 protease, SARS-CoV 3CLpro inhibitor | For the treatment of … Menarini China Holding Co., Ltd. 24 | | Anaprazole | 6/21/2023 | Proton pump inhibitor | For the treatment of duodenal ulcers | Small molecule | Xuanzhu (Beijing) Pharmaceutical Technology Co., Ltd. 25 | | Iruplinalkib | 6/27/2023 | ALK inhibitor | For the treatment of locally advanced or metastatic …

What Are the Long-term Outcomes of Wrist Arthrodesis Using Structural Iliac Bone Graft After Resection of the Distal Radius for Giant Cell Tumor of Bone? A Minimum 10-year Follow-up.

BACKGROUND: Most distal radial giant cell tumors are treated with curettage, whereas malignancies and very advanced giant cell tumor of bone … using our institutional database (Jishuitan Sarcoma database) undergoing prospective maintenance by Beijing Jishuitan Hospital. Between January 2005 and January 2025, we treated 231 patients for distal radius GCTB. Of those, we considered patients with Campanacci III GCTB as potentially eligible. Twenty-three percent (53 of 231) of patients underwent cure …

[Clinical value of left ventricular strain analysis by cardiovascular magnetic resonance in patients with coronary chronic total occlusion].

Objective: To explore the clinical value of quantitatively assessment of left ventricular strain in patients with coronary chronic total occlusion (CTO) by cardiac magnetic resonance imaging (CMR)-feature tracking (CMR-FT) technique. Methods: In this retrospective and observation study, patients with single CTO, who underwent CMR examination in Beijing Anzhen Hospital from November 2014 to January 2019, were selected as case group (CTO group), and those without cardiovascular diseases defined by echocardiography, electrocardiogram (ECG) and clinical history and with normal CMR results were sel…

[Exploration on clinical treatment of incisional wound infection after orthopedic internal fixation for lower extremity joint injuries].

Objective: To explore the clinical treatment of incisional wound infection after orthopedic internal fixation for lower extremity joint injuries. Methods: A retrospective cohort study was conducted. From February 2014 to December 2019, 214 patients with lower limb closed injury were treated in Beijing Jishuitan Hospital, including 143 males and 71 females, aged from 16 to 65 years. All patients underwent orthopedic internal fixation, after which incisional wound infection developed in 42 cases of postoperative wounds of patellar fracture, 30 cases of postoperative wounds of tibial plateau frac…

Induction and Regulation of the Immunoproteasome Subunit β5i (PSMB8) in Laryngeal and Hypopharyngeal Carcinoma Cells.

BACKGROUND The ubiquitin-proteasome pathway (UPP) is closely associated with the occurrence and progression of cancer, and the 5i immunoproteasome subunit is an important antitumor target in UPP. This study aimed to characterize the regulation of the immunoproteasome subunit ß5i (PSMB8) in JHU-011 laryngeal carcinoma cells and FaDu hypopharyngeal carcinoma cells to explore a new target for the treatment of laryngeal and hypopharyngeal carcinomas. MATERIAL AND METHODS JHU-011 and FaDu cells were used as effector cells in this study. By means of ⁶⁰Co γ-irradiation, the construction of stable cel

Совпадение в полном тексте источника
… MCF-7 human breast carcinoma cells and human embryonic kidney 293T (HEK293T) cells (Beijing Institute of Biotechnology, Beijing 100850, China) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO). Heat-inactivated fetal bovine serum (HyClone) was added into all media. … of Biotechnology, Beijing 100850, China); plasmid vectors pLKO.1-TRC (Addgene plasmid #10878; http://n2t.net/addgene : 10878; RRID: Addgene_10878), psPAX2, and pMD2. …

Independent factors associated with intracytoplasmic sperm injection outcomes in patients with complete azoospermia factor c microdeletions.

STUDY QUESTION: Which independent factors influence ICSI outcomes in patients with complete azoospermia factor c (AZFc) microdeletions? SUM … STS: This study was supported by Capital's Funds for Health Improvement and Research (2022-2-4094), Beijing Natural Science Foundation (7232203, 7242164), National Key Research and Development Program (2021YFC2700200, 2023YFC2705600), National Natural Science Foundation of China (82301889), Peking University Third Hospital Innovation Transformation Fund ( …

Probiotics for preventing acute upper respiratory tract infections.

BACKGROUND: Probiotics are live micro-organisms that may give a beneficial physiological effect when administered in adequate amounts. Some … lar Science Literature Database (from 2000 to 10 May 2022), and the Master's Degree Dissertation of Beijing Union Medical College Database (from 1981 to 10 May 2022). We searched the World Health Organization International Clinical Trials Registry Platform and ClinicalTrials.gov for completed and ongoing trials on 10 May 2022. SELECTION CRITERIA: We incl …

[Risk factors for death and the clinical features of different subtypes of patients with pulmonary arterial hypertension related to congenital heart disease].

Objective: To explore the risk factors for death in patients with pulmonary arterial hypertension related to congenital heart disease (PAH-CHD) and the clinical characteristics of different subtypes in patients with PAH-CHD. Methods: It was a retrospective study. A total of 507 PAH-CHD patients, who were hospitalized in the Department of Pediatric Cardiology of Beijing Anzhen Hospital between September 2005 and May 2019, were included. Patients were divided into 4 subgroups: (1) Eisenmenger syndrome(ES) group. (2) PAH associated with prevalent systemic-to-pulmonary shunts(SP) group. (3) PAH as…

Safety and immunogenicity of an inactivated SARS-CoV-2 vaccine, BBIBP-CorV: a randomised, double-blind, placebo-controlled, phase 1/2 trial.

BACKGROUND: The ongoing COVID-19 pandemic warrants accelerated efforts to test vaccine candidates. We aimed to assess the safety and immunog … of China for Major Infectious Diseases, National Mega Projects of China for New Drug Creation, and Beijing Science and Technology Plan.

Valve repair after infective endocarditis secondary to perforation caused by Streptococcus gordonii: A case report.

BackgroundWe report a case of infective endocarditis (IE) in a patient with congenital heart valve lesions accompanied by IE, which was diagnosed based on blood culture analysis that revealed the presence of a gram-negative bacterium, Streptococcus gordonii.Case summaryThe patient had a history of precordial valve disease diagnosed by cardiac ultrasound, as well as a 4-mo history of fever. He was subjected to comprehensive anti-infection and anti-heart failure treatment in the internal medicine department. Further examination revealed sudden dislodgement from and perforation through the aortic

Совпадение в полном тексте источника
… Bing Wei, Department of Emergency, Beijing Chaoyang Hospital Jingxi Branch, Beijing 100000, China. Xing-Hua Ye, Department of Emergency, Beijing Chaoyang Hospital Jingxi Branch, Beijing 100000, China. … Yi-Xuan Li, Department of Emergency, Beijing Chaoyang Hospital Jingxi Branch, Beijing 100000, China. Si-Lu Han, Department of Emergency, Beijing Chaoyang Hospital Jingxi Branch, Beijing 100000, China. References 1. …

Comparison of QCT and DXA: Osteoporosis Detection Rates in Postmenopausal Women.

Objective. To compare the osteoporosis detection rates in postmenopausal women when measuring bone mineral density (BMD) with quantitative computed tomography (QCT) in the spine versus dual X-ray absorptiometry (DXA) in the spine and hip and to investigate the reasons for the discrepancy between the two techniques. Methods. Spinal volumetric BMD was measured with QCT, and areal spinal and hip BMDs were measured with DXA in 140 postmenopausal women. We calculated the osteoporosis detection rate for the two methods. Lumbar CT images of patients who had a discrepancy between QCT and DXA findings

Совпадение в полном тексте источника
… Acknowledgments Part of this work was supported by Beijing Bureau of Health 215 program. … , China: the Beijing Osteoporosis Project Journal of Bone and Mineral Research 2000 15 10 2019 2025 2-s2.0-0033814763 11028456 10.1359/jbmr.2000.15.10.2019 …

Long non-coding RNA LINC00968 attenuates drug resistance of breast cancer cells through inhibiting the Wnt2/β-catenin signaling pathway by regulating WNT2.

BackgroundBreast cancer is one the most common cancers, making it the second leading cause of cancer-related death among women. Long non-coding RNAs (lncRNAs), with tightly regulated expression patterns, also serve as tumor suppressor during tumorigenesis. The present study aimed to elucidate the role of LINC00968 in breast cancer via WNT2-mediated Wnt2/β-catenin signaling pathway.MethodsBreast cancer chip GSE26910 was utilized to identify differential expression in LINC00968 and WNT2. The possible relationship among LINC00968, transcriptional repressor HEY and WNT2 was analyzed and then verif

Совпадение в полном тексте источника
… Next, 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, P1200, Beijing Solarbio Sciences Co., Ltd., Beijing, China) was prepared. Subsequently, sample was mixed with loading buffer solution, boiled at 100 °C for 5 min, ice-bathed and centrifuged. … Clonogenic assay Luria-Bertani (LB) culture plate (D0110, Beijing Nobleryder Science and Technology Co., Ltd., Beijing, China) was prepared, detached, centrifuged, counted and resuspended with 1640 culture medium (Gibco, Gaithersburg, MD, USA). …

Sclerostin induced tumor growth, bone metastasis and osteolysis in breast cancer.

Breast cancer is the second leading cause of cancer-related deaths among women worldwide. Many patients suffer from bone metastasis. Sclerostin, a key regulator of normal bone remodeling, is critically involved in osteolytic bone diseases. However, its role in breast cancer bone metastasis remains unknown. Here, we found that sclerostin was overexpressed in breast cancer tumor tissues and cell lines. Inhibition of sclerostin by antibody (Scl-Ab) significantly reduced migration and invasion of MDA-MB-231 and MCF-7 cells in a time- and dose-dependent manner. In xenograft model, sclerostin inhibi

Совпадение в полном тексте источника
… All patients were diagnosed and treated at Beijing Shijitan Hospital (Beijing, China). This study was approved by Institutional Review Boards at Beijing Shijitan Hospital. … Next, cDNA was transferred into a 20-μl PCR reaction mixture using 2× UltraSYBR Mixture (Beijing Cowin Biotech, Bejing, China). …

Mechanisms of IFNalpha-1a-Induced Apoptosis in a Laryngeal Cancer Cell Line.

BACKGROUND Interferon alpha (IFNalpha) exerts its anti-proliferative effect on many human cancers. Among the 13 subtypes of human IFNalpha, IFNalpha-1 subtype has 2 variants, named IFNalpha-1a and IFNalpha-1b, that differ from each other in only 1 amino acid, at residue 114. However, the mechanism by which IFNalpha-1a mediates growth inhibition is still unclear. MATERIAL AND METHODS Human laryngeal carcinoma HEp2 cells were treated with IFNalpha-1a by either transient transfection or exogenous delivery. Western blot and RT-PCR analysis were carried out to assess apoptotic pathways active in IF

Совпадение в полном тексте источника
… At about 80% confluency, Hep-2 cells were transiently transfected with increasing doses of plasmid pcDNA3.0-IFNalpha-1a-HA DNAs by NeoFect (Neofect biotech Co, Beijing, China) according to the instruction manual. … Apoptosis assay Cell apoptosis was detected using an Annexin V-FITC apoptosis detection kit (Biotool, Beijing, China). Briefly, the transiently transfected or IFNalpha-1a-treated HEp-2 cells were harvested after 48-h incubation. …

Is Proximal Tibial Hemiarthroplasty Reconstruction Effective in Minimizing Limb Length Discrepancy Among Skeletally Immature Patients With Primary Bone Sarcomas?

BACKGROUND: Proximal tibial resection and reconstruction with a hinged knee megaprostheses may result in severe limb length discrepancy (LLD … as a retrospective study performed by four consultant surgeons at a tertiary tumor referral center (Beijing Jishuitan Hospital, National Center for Orthopaedics, PR China) between 2005 and 2022. During that time, we generally recommended a tibial hemiarthroplasty to children with primary malignant tumors of the proximal tibia (Enneking stages IA, IB, and …

[Repair strategies and efficacy analysis of deep electrical burn wounds in children's fingers].

Objective: To explore the repair strategies for deep electrical burn wounds in children's fingers and analyze their efficacy. Methods: This study was a retrospective observational study. From January 2008 to January 2024, 80 children with deep electrical burn wounds in fingers meeting the inclusion criteria were admitted to Beijing Children's Hospital Affiliated to Capital Medical University, including 54 males and 26 females, aged 11 months to 12 years and 9 months with a total of 170 fingers affected. Repair strategies were formulated based on wound characteristics after debridement. For wou…

Identification and Verification of SLC27A1, PTBP1 and EIF5A With Significantly Altered Expression in Aggressive Pituitary Adenomas.

BackgroundAggressive pituitary adenoma encircling the internal carotid artery has a poor clinical prognosis because of a high surgical risk and a high recurrence rate. This seriously affects patients' quality of life and yet there is no effective medical treatment. The European Diagnostic Guidelines have recommended the use of temozolomide (TMZ) for these aggressive pituitary adenomas, but the treatment remission rate has been less than 50%.MethodsIn this study, transcriptome sequencing of pituitary tumour tissues and TMZ-treated pituitary tumour cell lines were employed to explore the signifi

Совпадение в полном тексте источника
… Total RNA was reverse transcribed using an RT-PCR kit (Tiangen, KR103-03, Beijing, China) The sequencing readings are generated using the BGISEQ-500 platform as recommended by the manufacturer. … Ethics Statement The studies involving human participants were reviewed and approved by Ethics Committee of Beijing Tiantan Hospital, Capital Medical University (Beijing, China). The patients/participants provided their written informed consent to participate in this study. …

Идентификация сигнатуры, связанной с микроглией, в экспериментальном аутоиммунном энцефаломиелите.

Множественный склероз (MS) — хроническое нервно-воспалительное расстройство, характеризующееся демиелинизацией и иммунной диагностикой, и микроглией играет центральную роль в прогрессии заболеваний. Несмотря на это, конкретные микроглиальные генные сигнатуры, способствующие НР, по-прежнему недостаточно характеризуются. МЕТОДЫ: Мы использовали экспериментальную аутоиммунную модель мышьяка-энцефаломиэлита (EAE) и провели последовательность RNA для выявления дифференциально выраженных RNA (DEmRNA), длинных некодирующих RNA (DElncRNA), циркулярных RNA (DEcirRNA) и микроRNA (DEmiRNA) в микроглии. П

Совпадение в полном тексте источника
… NGP (m) -R ATATTGGTAGCAGGATTC Hist1h2bj (m) -F NM_178198.3 GTCTACAAGGTGCTGAAG 80 Beijing Tsingke Biotech Co., Ltd. Hist1h2bj (m) -R TTCACGAACGAGTTCATG CD180 (m) -F NM_008533.2 ATGGATGACGAAGATATTAGT 75 Beijing Tsingke Biotech Co., Ltd. … CD180 (m) -R CTGTAGGTTGATGCTCTC PBLD1 (m) -F NM_001359529.1 TGAAGTTGAAGACTTGATA 77 Beijing Tsingke Biotech Co., Ltd. PBLD1 (m) -R TTCTGGTATCTGTAGAGTA F10 (m) -F NM_001242368.1 TTATGAAGAGGTCCGTGAA 75 Beijing Tsingke Biotech Co., Ltd. …