Degradation and clearance of cellular waste in the autophagic and endo-lysosomal systems is important for normal physiology and prevention of common late-onset diseases such as Alzheimer's disease (AD). Phosphatidylinostol-binding clathrin assembly protein (PICALM) is a robust AD risk factor gene and encodes an endosomal protein clathrin-binding cytosolic protein, reduction of which is known to exacerbate tauopathy. Although PICALM is known to regulate initiation of autophagy, its role in maturation of lysosomal enzymes required for proteolysis has not been studied. We sought to determine the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Seipin, encoded by the BSCL2 gene, is a protein that in humans is expressed mainly in the central nervous system. Uniquely, certain variants in BSCL2 can cause both generalized congenital lipodystrophy type 2, upper and/or lower motor neuron diseases, or progressive encephalopathy, with a poor prognosis during childhood. The latter, Celia's encephalopathy, which may or may not be associated with generalized lipodystrophy, is caused by the c.985C >T variant. This cytosine to thymine transition creates a cryptic splicing zone that leads to intronization of exon 7, resulting in an aberrant form o
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
RTTN (Rotatin) (OMIM 614833) is a large centrosomal protein coding gene. RTTN mutations are responsible for syndromic forms of malformation of brain development, leading to polymicrogyria, microcephaly, primordial dwarfism, seizure along with many other malformations. In this study we have identified a compound heterozygous mutation in RTTN gene having NM_173630 c.5225A > G p.His1742Arg in exon 39 and NM_173630 c.6038G > T p.Cys2013Phe in exon 45 of a consanguineous Saudi family leading to brain malformation, seizure, developmental delay, dysmorphic feature and microcephaly. Whole exome sequen
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome.
METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.
RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: With the goal of labeling and manipulating the zebrafish hypothalamus, we sought to target a green fluorescent protein (gfp) transgene to the expression domains of nkx2.4b, a gene expressed during hypothalamic and thyroid development. We combined transcription activator-like effector nucleases (TALENs)-mediated mutagenesis with a targeting construct to enable insertion of a gfp transgene into the endogenous nkx2.4b genomic locus.
RESULTS: Injection of TALENs targeted to the first exon of nkx2.4b created a predicted null allele, and homozygous mutant embryos displayed loss of thyro
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In vitro fertilization (IVF) involves controlled ovarian hyperstimulation using hormones to produce large numbers of oocytes. The success of IVF is tightly linked to the availability of mature oocytes. In most cases, about 70% to 80% of the oocytes are mature at the time of retrieval, however, in rare instances, all of them may be immature, implying that they were not able to reach the metaphase II (MII) stage. The failure to obtain any mature oocytes, despite a well conducted ovarian stimulation in repeated cycles is a very rare cause of primary female infertility, for which the underlying su
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Phosphorylation of the N-terminal domain of the huntingtin (HTT) protein has emerged as an important regulator of its localization, structure, aggregation, clearance and toxicity. However, validation of the effect of bona fide phosphorylation in vivo and assessing the therapeutic potential of targeting phosphorylation for the treatment of Huntington's disease (HD) require the identification of the enzymes that regulate HTT phosphorylation. Herein, we report the discovery and validation of a kinase, TANK-binding kinase 1 (TBK1), that efficiently phosphorylates full-length and N-terminal HTT fra
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Male Breast Cancer (MBC) is a rare and aggressive disease that is associated with genetic factors. Mutations in BRCA1 and BRCA2 account for 10% of all MBC cases suggesting that other genetic factors are involved. The aim of the present study is to screen whole BRCA1 and BRCA2 exons using the Ampliseq BRCA panel in Tunisian MBC patients with family history. Furthermore, we performed exome sequencing using the TruSight One sequencing panel on an early onset BRCA negative patient. We showed that among the 6 MBC patients, only one (MBC-F1) harbored a novel frameshift mutation in exon 2 of the BRCA…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Classic Bartter syndrome is a rare condition caused by mutations in the CLCNKB gene and characterised by metabolic alkalosis, hypokalaemia, hyper-reninaemia and hyperaldosteronism. Early signs and symptoms usually occur before a child's sixth birthday and include polyuria and developmental delay. We treated a 13-year-old Vietnamese boy with this syndrome presenting with atypical presentations including syncope and hypertension, but normal growth and development. All common causes of hypertension were ruled out. Genetic testing found two novel mutations in the CLCNKB gene, that is, Ser12Ala (ex
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Hereditary intrinsic factor deficiency is a rare disease characterized by cobalamin deficiency with the lack of gastric intrinsic factor because of gastric intrinsic factor (GIF) mutations. Patients usually present with cobalamin deficiency without gastroscopy abnormality and intrinsic factor antibodies.
CASE PRESENTATION: A Chinese patient presented with recurrent severe anemia since age 2 with low cobalamin level and a mild elevation of indirect bilirubin. The hemoglobin level normalized each time after intramuscular vitamin B12 injection. Gene test verified a c.776delA frame sh
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genetic variants of high-temperature requirement A serine peptidase 1 (HTRA1) and age-related maculopathy susceptibility 2 (ARMS2) are associated with age-related macular degeneration (AMD). One HTRA1 single nucleotide polymorphism (SNP) is situated in the promotor region (rs11200638) resulting in increased expression, while two synonymous SNPs are located in exon 1 (rs1049331:C > T, rs2293870:G > T). HtrA1 is known to inhibit transforming growth factor-β (TGF-β) signaling, a pathway regulating quiescence of microglia, the resident immune cells of the brain and retina. Microglia-mediated immun
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Lysosomal acid lipase deficiency (LALD; MIM#278000) is a continuum of autosomal recessive diseases caused by defects in the gene LIPA and historically divided into two phenotypes: severe infantile-onset form called Wolman disease (WD) and childhood/adult-onset form known as cholesteryl ester storage disease (CESD). We report a novel synonymous homozygous variant c.600G > A in LIPA of a patient with LALD. Functional analysis of the patient cDNA and minigene assay revealed this variant as the cause of exonic cryptic splice site activation and 63 b.p. deletion in exon 6. To investigate the impact
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Split hand/foot malformation (SHFM) or ectrodactyly is a rare congenital disorder affecting limb development characterized by clinical and g … widespread freckles. Array-CGH identified a 450 kb de novo 20p12.1 microdeletion encompassing three exons (exon 6 to 8) of MACROD2. Although MACROD2 mutations have not been associated with limb malformation until now, it is located next to KIF16B, which is involved in fibroblast growth factor receptor (FGFR) signaling. Additionally, the deletion encompa …
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Li-Fraumeni syndrome is an autosomal dominant cancer syndrome characterized by pathogenic variants in the TP53 gene on chromosome 17. The most common cancers in Li-Fraumeni kindreds include sarcomas, breast cancer, brain tumors, and adrenocortical carcinoma. We report a 9-month-old male who was diagnosed with an adrenocortical tumor and later found to harbor a novel TP53 c.559 G > C germline variant, resulting in p.Gly187Arg. Family history included early-onset breast cancer in his paternal grandmother and paternal great-grandfather, as well as colon cancer at age 31 in a paternal cousin. The
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
3MC syndrome is a rare autosomal recessive disorder with characteristic craniofacial dysmorphism and multiple anomalies. It is caused by biallelic mutations in one of three genes, MASP1, COLEC11 and COLEC10, all encoding factors of the lectin complement pathway. In MASP1, either truncating mutations or missense variants in exon 12 encoding the C-terminal serine protease domain specific for isoform MASP-3 are causative. By trio exome sequencing we now identified a novel, homozygous 2kb deletion, partially affecting exon 12 in an adult female with the typical facial gestalt of 3MC syndrome and h
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Grange syndrome is an autosomal recessive condition characterized by arterial occlusions and hypertension. Syndactyly, brachydactyly, bone fragility, heart defects, and learning disabilities have also been reported. Loss-of-function variants in YY1AP1 have only recently been associated with Grange syndrome. YY1AP1 encodes for the transcription coactivator yin yang 1-associated protein 1 which regulates smooth muscle cell proliferation and differentiation. We here report on three siblings with steno-occlusive arterial disorder and syndactyly in two of them. Whole exome sequencing including near
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: DNA methyltransferase 1 (EC 2.1.1.37), encoded by DNMT1 gene, is one of key enzymes in maintaining DNA methylation patterns of the human genome. It plays a crucial role in embryonic development, imprinting and genome stability, cell differentiation. The dysfunction of this group of enzymes can lead to a variety of human genetic disorders. Until now, mutations in DNMT1 have been found to be associated with two distinct phenotypes. Mutations in exon 20 of this gene leads to hereditary sensory and autonomic neuropathy type IE, and mutations in exon 21 cause autosomal dominant cerebell
Клинический случайСтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Autosomal recessive cerebellar ataxias (ARCAs) represent a heterogeneous group of inherited disorders. The association of early-onset cerebellar ataxia with hypogonadotropic hypogonadism is related to two syndromes, known as Gordon Holmes syndrome (GHS-ataxia and pyramidal signs with hypogonadotropic hypogonadism) and Boucher-Neuhäuser syndrome (BNS-ataxia with chorioretinal dystrophy). Mutations in the PNPLA6 gene have been identified as the cause of hereditary spastic paraplegia and complex forms of ataxia associated with retinal and endocrine manifestations. We reported two Brazilian patien
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report a new transthyretin (ATTR) gene c.272C>G mutation and variant protein, p.Leu32Val, in a kindred of Bolivian origin with a rapid progressive peripheral neuropathy and cardiomyopathy. Three individuals from a kindred with peripheral nerve and cardiac amyloidosis were examined. Analysis of the TTR gene was performed by Sanger direct sequencing. Neuropathologic examination was obtained on the index patient with mass spectrometry study of the ATTR deposition. Direct DNA sequence analysis of exons 2, 3, and 4 of the TTR gene demonstrated a c.272 C>G mutation in exon 2 (p.L32V). Sural nerve…
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Alzheimer's disease affects tens of millions of people worldwide and its prevalence continues to rise. It is caused by a combination of a subject's heredity, environment, lifestyle, and medical condition. The most significant genetic risk factor for late onset Alzheimer's disease is a variant of the apolipoprotein E gene, APOE4. Here we show that the single nucleotide polymorphism rs429358 that defines APOE4 is located in a short sequence motif repeated several times within exon 4 of apolipoprotein E, reminiscent of the structure of transcriptional enhancers. A JASPAR database search predicts
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования