Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prot
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Polioviruses (PVs) are the causal agents of acute paralytic poliomyelitis. Since the 1960s, poliomyelitis has been effectively controlled by the use of two vaccines containing all three serotypes of PVs, the inactivated poliovirus vaccine and the live attenuated oral poliovirus vaccine (OPV). Despite the success of OPV in polio eradication programme, a significant disadvantage was revealed: the emergence of vaccine-associated paralytic poliomyelitis (VAPP). VAPP is the result of accumulated mutations and putative recombination events located at the genome of attenuated vaccine Sabin strains. I
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The alternative oxidase (AOX) is an integral monotopic membrane protein located on the inner surface of the inner mitochondrial membrane. Branching from the traditional respiratory chain at the quinone pool, AOX is responsible for cyanide-resistant respiration in plants and fungi, heat generation in thermogenic plants, and survival of parasites, such as Trypanosoma brucei, in the human host. A recently solved AOX structure provides insight into its active site, thereby facilitating rational phytopathogenic and antiparasitic drug design. Here, we describe expression of recombinant AOX using two
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Viruses within human adenovirus species D (HAdV-D) infect epithelia at essentially every mucosal site. Hypervariable loops 1 and 2 of the hexon capsid protein contain epitopes that together form the epsilon determinant for serum neutralization. We report our analyses comparing HAdV-D15, 29, 56, and the recently identified type 69, each with highly similar hexons and the same serum neutralization profile, but otherwise disparate genomes. Of these, only HAdV-D type 56 is associated with epidemic keratoconjunctivitis (EKC), a severe infection of ocular surface epithelium and underlying corneal st
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
It is widely accepted that the pathophysiological mechanism of severe acute pancreatitis (SAP) is characterized by the systemic inflammatory response, which eventually causes systemic inflammatory response syndrome (SIRS), multiple organ dysfunction syndrome (MODS), and even death. Heme oxygenase (HO)-1 has been proved to exert anti-inflammatory benefit in a variety of inflammatory diseases, and a variety of methods by which HO-1 overexpression can be induced have been reported. In this study, we hypothesized that transfer of HO-1 gene by adenoviral vector could inhibit the systemic inflammati
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human glial cell line-derived neurotrophic factor (hGDNF) is a very promising protein for the treatment of Parkinson's disease and other neurodegenerative disorders. The present work describes a quick and simple method to obtain a high amount of purified hGDNF using a mammalian cell-derived system. The method is based on the high expression level provided by a Semliki Forest virus vector and its ability to induce a strong shut-off of host-cell protein synthesis in mammalian cells. As a result, hGDNF is the only protein present in the supernatant and can be efficiently purified by a single chro
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To clone the virB12 gene in pET28a expression vector for production of recombinant protein to be used as antigenic component for future serological test development.
METHODS: Brucella melitensis (B. melitensis) 16M strain was cultured and bacterial DNA was extracted by Bioneer AccuPrep® Genomic DNA Extraction Kit. Oligonucleotide primer pair was designed based on Brucella virB12 gene sequence with BamHI and HindIII restriction site at 5' end of the forward and reverse primers, respectively. DNA amplification was performed using PrimSTAR® HS DNA polymerase and the PCR product was pu
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hydrogen sulfide (H(2)S) is a recently discovered gasotransmitter found in mammalian tissues and blood. Treatment with H(2)S donor molecules has shown promising results in preclinical models of inflammatory and cardiovascular diseases. Augmentation of H(2)S levels thus holds promise as a novel therapeutic approach for treatment of disease in man. Cystathionine β-synthase (CBS) has been shown to catalyze H(2)S production in vitro. CBS enzyme activity is allosterically regulated by the endogenous activator S-adenosyl methionine. This mode of regulation suggests the possibility for designing a sm
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Failures in Nucleotide Excision Repair (NER) are generally associated with extreme sun sensitivity, high cancer risks and neurodegeneration. This is explained by the inability to repair UV lesions and oxidative damage, and may be ascribed to a deficiency in the TFIIH complex, which has a dual role in NER and transcription initiation. We have recently uncovered the molecular basis for a specific TFIIH component deficiency, Rad3/XPD, whose consequences are drastically different from other NER failures. Yeast rad3-102 cells partially process NER damage beyond the incision step but do not refill t
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The extreme strength and elasticity of spider silks originate from the modular nature of their repetitive proteins. To exploit such materials and mimic spider silks, comprehensive strategies to produce and spin recombinant fibrous proteins are necessary. This protocol describes silk gene design and cloning, protein expression in bacteria, recombinant protein purification and fiber formation. With an improved gene construction and cloning scheme, this technique is adaptable for the production of any repetitive fibrous proteins, and ensures the exact reproduction of native repeat sequences, anal
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We investigated the antibacterial activities of 19 beta-lactams against three recombinant bacterial strains, in which three penicillin-binding protein genes, pbp2x, pbp1a, and pbp2b, from penicillin-resistant Streptococcus pneumoniae (PRSP), were transformed to a penicillin-susceptible strain. By the acquisition of the pbp2x gene from PRSP, the minimum inhibitory concentrations (MICs) of third-generation cephalosporins were increased more than eight fold. When the strain acquired the PRSP pbp1a gene in addition to pbp2x, the MICs of all tested beta-lactams increased 2- to 16-fold. When the str
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hypoxanthine phosphoribosyltransferases (HPRTs) are potential drug targets in the treatment of diseases caused by parasites. Also, defects in the human HPRT can result in gouty arthritis or Lesch-Nyhan syndrome. Active site loop I of HPRTs has been implicated in interactions between enzyme subunits that can influence the relative efficiencies of forward and reverse reactions, but the functional roles for invariant loop I residues (analogous with human Leu67 and Gly69) are poorly understood. Herein, saturation mutagenesis, complement selection, and steady-state kinetics were used to investigate
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To construct recombinant plasmids containing the truncated gene of the major surface antigen sta56 of Orientia tsutsugamushi (Ot.) Karp strain for expression antigen in E. coli so as to compare the expression efficiency in different systems.
METHODS: From the recombinant plasmid TOPO-sta56 containing sta56 of Orientia tsutsugamushi Karp strain, several truncated genes of sta56 with different length were amplified and subcloned into the expression vectors pPROEX HTb and pET30a. These genes were expressed in E. coli DH5alpha and BL21(DE3) respectively when induced by IPTG. The expres
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A DNA encoding the 27-kDa domain I of anthrax lethal factor protein (LF), was linked to the carboxyl terminus of the cholera toxin B-subunit (CTB-LF). The CTB-LF fusion gene was transferred into Solanum tuberosum cells by Agrobacterium tumefaciens-mediated in vivo transformation methods and antibiotic-resistant plants were regenerated. The CTB-LF fusion gene was detected in transformed potato leaf genomic DNA by polymerase chain reaction (PCR)-mediated DNA amplification. Immunoblot analysis with anti-CTB and anti-LF primary antibodies verified the synthesis and assembly of biologically active
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Pompe disease is a metabolic myopathy caused by deficiency of lysosomal acid alpha-glucosidase. In this report we review the first 36 weeks of a clinical study on the safety and efficacy of enzyme therapy aimed at correcting the deficiency. Four patients with infantile Pompe disease were enrolled. They received recombinant human alpha-glucosidase from transgenic rabbit milk. The product is generally well tolerated and reaches the primary target tissues. Normalization of alpha-glucosidase activity in skeletal muscle was obtained and degradation of PAS-positive material was seen in tissue sectio
Клиническое исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Transthyretin (formerly called prealbumin) plays important physiological roles as a transporter of thyroxine and retinol-binding protein. X-ray structural studies have provided information on the active conformation of the protein and the site of binding of both ligands. Transthyretin is also one of the precursor proteins commonly found in amyloid deposits. Both wild-type and single-amino-acid-substituted variants have been identified in amyloid deposits, the variants being more amyloidogenic. Sequencing of the gene and the resulting production of a transgenic mouse model have resulted in prog
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tropheryma whipplei is the causative agent of Whipple's disease (WD), a chronic, life-threatening infection. Laboratory diagnosis is mainly based on PCR and histopathological analysis in duodenal biopsies and other specimens requiring invasive procedures. We have examined the presence of antibodies to recombinant heat shock protein (Hsp65) of T. whipplei in patients with Whipple's disease as well as in control subjects by Western blot and enzyme-linked immunosorbent assay (ELISA). A recombinant plasmid carrying the entire T. whipplei hsp65 gene was constructed, and the expression yielded a 65-
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Four nutritionally impaired strains of Mycobacterium bovis produced by illegitimate recombination were tested for their ability to protect guinea pigs against intratracheal challenge with virulent M. bovis. All four strains and M. bovis BCG induced significant levels of protection as measured by the reduced spread of infection to the spleen and liver. In animals vaccinated with BCG or two of the other strains, the bacterial counts from the lungs were significantly lower than those of the nonvaccinated animals.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Paracoccidioidomycosis (PCM) is one of the most important endemic mycoses in Latin America; it is usually diagnosed by observation and/or isolation of the etiologic agent, Paracoccidioides brasiliensis, as well as by a variety of immunological methods. Although the latter are effective, two circumstances, cross-reactions with other mycotic agents and antigen preparation that is marked by extreme variability among lots, hinder proper standardization of the procedures. To circumvent this lack of reproducibility, molecular biology tools were used to produce a recombinant 27-kDa-molecular-mass ant
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования