In humans, cytomegalovirus (CMV) is the most significant infectious cause of intrauterine infections that cause congenital anomalies of the central nervous system. Currently, it is not known how this process is affected by the timing of infection and the susceptibility of early-gestational-period cells. Embryonic stem (ES) cells are more resistant to CMV than most other cell types, although the mechanism responsible for this resistance is not well understood. Using a plaque assay and evaluation of immediate-early 1 mRNA and protein expression, we found that mouse ES cells were resistant to mur
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Kaposi's sarcoma-associated herpesvirus (KSHV) gene product virally encoded G protein-coupled receptor (vGPCR) is a homolog of cellular GPCRs and has been proposed to play important roles in KSHV-induced angiogenesis. The most abundant vGPCR-containing transcripts are K14/vGPCR bicistronic RNAs that are strongly induced during lytic reactivation. Here we show that the promoter governing this transcript is strongly responsive to activation by the viral lytic switch protein RTA. By deletion mapping and scanning mutation analyses, we have identified three putative RTA response elements (A, B,
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The consequences of a severe traumatic injury--deep pain and haemorrhage--usually evoke a passive emotional coping reaction characterised by: quiescence and immobility, decreased vigilance, hypotension and bradycardia. Results of studies utilising microinjections of excitatory amino acids suggest that passive coping reactions are mediated, at least in part, by activation of the midbrain, ventrolateral periaqueductal gray (vlPAG) region. Further, experiments in anaesthetised rats, using the expression of the immediate-early gene, c-fos, as a marker of neuronal activation, report that pain arisi
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We previously demonstrated that activation of the glucocorticoid receptor (GR) initiates an antiapoptotic signal in the immortalized human mammary epithelial cell line MCF10A that is dependent on the GR's transcriptional activity. In this study, we show that the survival role of GR activation extends to protecting human breast cancer cells undergoing apoptosis after growth factor deprivation. Serum and glucocorticoid-regulated kinase-1 (sgk), a gene previously identified as a direct transcriptional target of the activated GR in a rat mammary tumor cell line, was rapidly induced after GR activa
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During mating in rats, the male provides vaginocervical stimulation (VCS) to the female via intromissions. VCS, provided manually, mimics many aspects of mating, including facilitation of lordosis, induction of sexual receptivity, abbreviation of the period of sexual receptivity, and induction of twice-daily prolactin surges, which result in pseudopregnancy. VCS also induces the expression of Fos, the protein product of the immediate early gene c-fos, which has been used as a marker for neurons that are responsive to mating stimuli. Because VCS induces the release of dopamine in the forebrain,
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Currently there is no single answer on the question of the participation of nitric oxide and NO-synthase (NOS) in the cardioprotection in the early phase of ischemic preconditioning (IP). In the present review the results of experimental studies indicate the involvement of NOS in the protective effect of IP and the literature data refuting this assumption. In addition, it was presented data on the increase of nitrates and nitrites (the stable metabolite of NO) in myocardial tissue after the IP, an increase in the expression of genes encoding NOS immediately after the IP, the data on the elimin
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The effects of UV irradiation on herpes simplex virus type 1 (HSV-1) gene expression and DNA replication were examined in cell lines containing mutations inactivating the XPA gene product required for nucleotide-excision repair, the DNA polymerase eta responsible for translesion synthesis, or the Cockayne syndrome A and B (CSA and CSB) gene products required for transcription-coupled nucleotide excision repair. In the absence of XPA and CSA and CSB gene products, virus replication was reduced 10(6)-, 400-, and 100-fold, respectively. In DNA polymerase eta mutant cells HSV-1 plaque efficiency w
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURA syndrome is a rare genetic disease characterized by significant phenotypic variability. This case report presents a 4-day-old female neonate presenting with hypotonia, feeding difficulties, and other symptoms. Following comprehensive clinical examination, including laboratory tests, imaging studies, and genetic analysis, the patient was diagnosed with PURA syndrome. Whole-exome sequencing was performed on blood samples collected from the patient and her parents, revealing a novel PURA gene mutation [c.463C>G (p.Tyr155Ter), NM_005859.5], which had not been previously recorded in the litera
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Infections caused by Human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) are common in multiple transfused patients, such as patients with beta-thalassaemia. The ability of the Polymerase Chain Reaction (PCR) to amplify HCMV and EBV DNA from blood and other samples makes this technique a valuable diagnostic tool for the detection of both viruses in the early stages of the infection. PCR was used for the amplification of a 435 bp region of the immediate early-1 (IE-1) gene of HCMV and a 375 bp sequence from the EcoRI B fragment of EBV genome. Blood samples from 80 patients with beta-thala
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PURPOSE: Ovarian cancer has one of the highest deaths to incidence ratios across all cancers. Initial chemotherapy is effective, but most patients develop chemoresistant disease. Mechanisms driving clinical chemo-response or -resistance are not well-understood. However, achieving optimal surgical cytoreduction improves survival, and cytoreduction is improved by neoadjuvant chemotherapy (NACT). NACT offers a window to profile pre- versus post-NACT tumors, which we used to identify chemotherapy-induced changes to the tumor microenvironment.
EXPERIMENTAL DESIGN: We obtained matched pre- and post
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human Ag R (HuR) is an RNA binding protein in the ELAVL protein family. To study the neuron-specific function of HuR, we generated inducible, neuron-specific HuR-deficient mice of both sexes. After tamoxifen-induced deletion of HuR, these mice developed a phenotype consisting of poor balance, decreased movement, and decreased strength. They performed significantly worse on the rotarod test compared with littermate control mice, indicating coordination deficiency. Using the grip-strength test, it was also determined that the forelimbs of neuron-specific HuR-deficient mice were much weaker than
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
GnRH binds to its receptor on gonadotropes and activates multiple members of the MAPK signaling family that in turn regulates the expression of several immediate early genes (IEGs) including Jun, Fos, Atf3, and Egr1. These IEGs confer hormonal responsiveness to gonadotrope-specific genes including Gnrhr, Cga, Fshb, and Lhb. In this study we tested the hypothesis that GnRH specifically regulates the accumulation of Jun and Atf3 mRNA through a pathway that includes intracellular Ca²⁺, calcineurin, and nuclear factor of activated T cells (NFAT). Our results indicate that pretreatment of murine Lβ
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite extensive studies on GnRH regulation of the gonadotropin subunit genes, very little is known about mechanism of induction of intermediary immediate early genes, such as c-Fos, that are direct targets of GnRH signaling and that upon induction, activate transcription of gonadotropin genes. Although c-Fos is induced by a variety of stimuli in other cell types, in the gonadotropes, only GnRH induces c-Fos and through it FSHβ. Thus, understanding the specificity of c-Fos induction by GnRH will provide insight into GnRH regulation of FSHβ gene expression. GnRH induction of c-Fos in LβT2 cell
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Congenital infection by human cytomegalovirus (HCMV) is a major cause of birth defects and developmental abnormalities. Since guinea pig cytomegalovirus (GPCMV) crosses the placenta and causes infection in utero, GPCMV models are useful for studies of the mechanisms of transplacental transmission. During our characterization of a genomic locus required for GPCMV dissemination in animals, we found that the nucleotide sequence in and around the nearby immediate-early genes in our lineage of GPCMV strain 22122 [designated GPCMV (ATCC-P5)] showed clear differences from that reported previously for
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Postnatal overfeeding (OF) in rodents induces a permanent moderate increase in body weight in adulthood. However, the repercussions of postnatal OF on cardiac gene expression, cardiac metabolism and nitro-oxidative stress are less well known.
METHODOLOGY/PRINCIPAL FINDINGS: Immediately after birth, litters of C57BL/6 mice were either maintained at 10 (normal-fed group, NF), or reduced to 3 in order to induce OF. At weaning, mice of both groups received a standard diet. The cardiac gene expression profile was determined at weaning and cardiac metabolism and oxidative stress were as
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Brief alterations to the nature of the visual input during critical periods in the early life of cats and monkeys can result in rapid anatomical and physiological changes in the central visual pathways. The immediate early genes (IEGs) represent a possible way in which these changes could be mediated since the protein products of a number of these genes have been shown to be induced rapidly in neurons in response to a variety of transsynaptic stimuli. Immunohistochemical methods were employed to examine the tempo and pattern of expression of Fos, the protein product of the c-fos gene, induced
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The earliest responses of pathogenic bacteria to antibiotics can affect the outcome of an infection. While long-term adaptations have been extensively studied, the immediate transcriptional changes that unfold immediately following antibiotic exposure remain poorly understood. Here, we applied iModulon analysis to time-resolved transcriptomic data from Escherichia coli exposed to subinhibitory concentrations of two antibiotics (ampicillin and ciprofloxacin), capturing transcriptional regulatory changes occurring within the first 30 min of exposure. This analysis proposes an integrated, three-p
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: Macrophages conduct first-in-line defense against pathogens, including human adenovirus (AdV). AdVs cause respiratory disease, persist in immune cells, and, upon reactivation, are life-threatening to immunocompromised individuals. Here, our single-cell, single-virus experiments showed that AdV-type-C5 entry into human induced-pluripotent stem cell-derived macrophages is attenuated at cell binding and endosomal escape. A significant fraction (~30%) of the double-stranded viral DNA (vDNA) reaches the cell nucleus; however, it failed to efficiently express the immediate-early viral ep
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report a randomized prospective phase 3 study (CLL7), designed to evaluate the efficacy of fludarabine, cyclophosphamide, and rituximab (FCR) in patients with an early-stage high-risk chronic lymphocytic leukemia (CLL). Eight hundred patients with untreated-stage Binet A disease were enrolled as intent-to-treat population and assessed for four prognostic markers: lymphocyte doubling time <12 months, serum thymidine kinase >10 U/L, unmutated IGHV genes, and unfavorable cytogenetics (del(11q)/del(17p)/trisomy 12). Two hundred and one patients with ≥2 risk features were classified as high-risk
Клиническое исследование III фазыСравнительное исследованиеСтатьяРандомизированное исследованиеПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования