BACKGROUND: Mesonephric adenocarcinoma (MA) is a rare tumor believed to arise from mesonephric remnants occurring mostly in the uterine cervix and, to a lesser extent, the corpus. Since the first case report of MA in the corpus in 1995, only 16 cases have been reported in the English literature. A recent report suggested that MA originates in Müllerian tissue and exhibits the mesonephric differentiation phenotype.
CASE PRESENTATION: An asymptomatic 61-year-old woman was referred to our hospital because of elevated levels of tumor markers. Imaging revealed an intramural lesion of the uterine c
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The small heat shock protein (HSP) B family of proteins are a group of molecular chaperones that enable tissues to adapt to changes in their local environments during differentiation, stress, or disease conditions. The objective of this research was to characterize the expression of HSPB8 and its cochaperone Bcl2-associated athanogene 3 (BAG3) in nonpregnant (NP) and pregnant rat myometrium during myometrial programming. Rat myometrium was collected from NP and pregnant rats as well as 1 day postpartum (PP) and samples prepared for immunoblot and immunofluorescence analysis. Immunoblot analysi…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIM: The aim of this study was to assess the participation of ligand-sensitive potassium large conductance calcium-activated ion channels (BK(Ca2+) ) and adenosine triphosphate (ATP)-sensitive potassium ion channels (K(ATP) ) using its openers (NS1619 and pinacidil) in the contractility of human term pregnant myometrium in in vitro conditions.
METHODS: Human myometrium tissue samples were collected from term pregnant laboring women who had to undergo cesarean section. The contractility of myometrium was induced by the application of oxytocin into the organ bath. Myometrial strips were incubat…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Although the published results regarding the function of the beta(3)-adrenergic receptors (beta(3)-ARs) in the regulation of smooth muscle activity are very promising, the question of the mechanism of beta(3)-ARs' action in the pregnant myometrium cannot be fully answered by human investigations. To assess whether it possesses an essential role in the regulation of uterine contractility in pregnant rats, as in humans, we performed functional, western blotting and molecular biology experiments on the late-pregnant rat myometrium. The influence of progesterone on the function of the beta(3)-ARs …
Сравнительное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We studied the effect of calix[4]arenes C-97, C-99 and C-107 (codes are shown) functionalized by: one fragment of methylene-bisphosphonic, two fragments of hydroxy-phosphonic and two fragments of amino(methyl)phosphonic acids, respectively, on the enzymatic activity of actomyosin ATPase and ATPase of subfragment-1 (head) of myosin from smooth muscle of the uterus. It has been shown that calixarene C-107 at a concentration of 100 microM activated enzymatic activity of actomyosin ATPase by 230 +/- 12% (the value of the apparent constant of activation A0.5 = 9.6 +/- 0.7 microM). At the same time,
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In this paper we postulate, that mitochondria isolated from the rat myometrium undergo swelling in isoosmotic medium, which contains K+ (125 mM). This swelling was blocked by ATP (200 microM), but only when MgCl2 (1 mM) was present and observed when oligomycin, the inhibitor of FoF1-ATPase, was added to the incubation medium. Diazoxide (50 microM), activator of the mitochondrial ATP-sensitive potassium channel, removed ATP-induced blockade of swelling. Our results may prompt the presence of K+ transporter on the inner mitochondrial membrane, which possesses the features of the mitochondrial AT…
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Abelson (Abl) interactor 2 (Abi-2) has been considered as a key regulator of cell/tissue structural organization and is differentially expressed in leiomyomas. The objective of this study was to evaluate the expression of Abi-2 in leiomyoma/myometrium during the menstrual cycle and following GnRH analogue (GnRHa) therapy, as well as regulation by transforming growth factor (TGF)-beta1 in leiomyoma and myometrial smooth muscle cells (LSMC and MSMC).
METHODS: We used real-time PCR, Western blotting and immunohistochemistry to determine the expression of Abi-2 in paired leiomyoma and…
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In humans, the factors that govern the switch from myometrial quiescence to coordinated contractions at the initiation of labor are not well … . TNFalpha is a potent activator of NF-kappaB, and levels of this cytokine are increased within the myometrium at term. In the current study, using primary cultures of myometrial cells, TNFalpha was observed to repress expression of Galphas while, at the same time, stimulating NF-kappaB activity. Furthermore, this effect could be replicated by exposure to ba …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Strips of longitudinal myometrium from cows were obtained on days 19-21 and 1-5 of the estrous cycle and incubated (aerated atmosphere; 4 degrees C; 24, 48 or 72 h) with a mixture of PCBs Aroclor (Ar) 1248 or with one of three PCBs (77, 126 or 153), all at doses of 10 or 100 ng/ml. The force and frequency of spontaneous and oxytocin (OT; 10(-7)M)-stimulated contractions of each strip was registered by means of HSE Schuler Organbath. Contractions of myometrial strips in the presence and absence of PCBs were observed after 24, 48 and 72 h of incubation. All PCBs significantly affected myometrial…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The pregnancy-induced rapid degeneration of the adrenergic nerves innervating the uterus is a well-known but poorly understood phenomenon. Since most of the published investigations were carried out by histological assay, our aim was to describe the loss of the adrenergic function during pregnancy and the re-innervational procedure in the postpartum period. Myometrial and cervical samples from rats were loaded with [3H]noradrenaline and then transferred into a chamber for superfusion. After a wash-out period, fractions were collected. The fifth and fifteenth fraction tissues were stimulated wi
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To assess whether pregnancy might influence the functionality and expression of human myometrial beta(2)- and beta(3)-adrenoceptors (beta(2)- and beta(3)-AR), we performed functional, binding, Western blot, and molecular biology experiments in human nonpregnant and near-term pregnant myometrium. Inhibition of spontaneous contractions induced by a beta(3)-AR agonist, SR 59119A, was significantly greater in pregnant, compared with nonpregnant, myometrial strips (E'(max) = 61 +/- 5% vs. 44 +/- 5% for pregnant and nonpregnant myometrium, respectively), whereas salbutamol, a beta(2)-AR agonist, was…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: To investigate the expression of cyclooxygenase-2 (COX-2) in human lower segments of myometrium obtained from women in labor and those not in labor and identify the splice variant of COX-2.
METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for investigating the expression of COX-2. According to the sequence of rat COX-2 splice variant, the primers were designed and synthesized, then the splice variant of COX-2 in human myometrium from woman in labor was identified, cloned into vector and sequenced.
RESULTS: The results showed that (1) The Expression of COX…
Аннотация на английскомСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Large-conductance calcium-activated potassium (BKCa) channels play an important role in the control of myometrial excitability. The aim of the present study was to determine the localization and protein expression of the alpha subunit of BKCa channels in the pregnant and parturient human uterus. An anti-alpha BKCa channel monoclonal antibody (anti-alpha(995-1113)) was used to localize and quantitate immunoreactive BKCa channel protein in myometrium of singleton term pregnant women undergoing either elective (n=26) or emergency Caesarean section following the onset of spontaneous labour (n=25).…
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The two estrogen receptors, ERalpha and ERbeta, are likely to have roles in the pathophysiology of fibroid development. They have been detec … uscle cells (SMC) and to determine if ERalpha/ERbeta are differentially expressed in MEC and SMC of myometrium and fibroids from nine paired samples. Using RT-PCR (for ERalpha and ERbeta) and Western blotting (for ERalpha only), we demonstrated that all cultures of early passage myometrial and fibroid SMC (>99% pure) expressed ERalpha but not ERbeta, while m …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
1. The mechanism of trypsin-induced contraction in the rat myometrium was investigated using front-surface fluorimetry on fura-PE3-loaded strips. The expression of protease-activated receptors (PARs) in the rat myometrium was determined by reverse transcription polymerase chain reaction (RT - PCR). 2. In non-pregnant rats, 10 microM trypsin developed a force of up to 30.5 +/- 5.1% of that obtained during the 40 mM K(+)-depolarization-induced contraction. In pregnant rats, the maximal level of the cytosolic Ca(2+) concentration and tension obtained with 3 microM trypsin was 143.2 +/- 6.0% and 6…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A polyclonal antibody was raised against amino acids 7-18 in the first extracellular loop of rat prostaglandin F (FP) receptor to monitor expression and localization in pregnant rat myometrium at Gestational Days 16, 18, 20, 21, 21.5, 22 (delivery), and 23 (1-day postpartum; n = 5 per group). The antibody recognized a protein of approximately 43 kDa on Western blot analysis in both membrane (soluble and nonsoluble) and cytosolic fractions of myometrium on each day of gestation. Expression of FP protein increased significantly (P < 0.05) during late gestation in both soluble membrane and cytoso…
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The effects of subacute, acute and chronic ethanol exposure on the activity of Ca(2+)-accumulating systems of mitochondria and endoplasmic reticulum in myometrial cells of nonpregnant estrogen-treated rats were studied. It has been shown that the activity of Ca(2+)-accumulating system of mitochondria was higher than the activity of Ca(2+)-accumulating system of endoplasmic reticulum in myometrial cells from control, acute and subacute treated with ethanol rats. Under ethanol chronical assumption both Ca(2+)-accumulation in mitochondria and Ca(2+)-transporting activity of endoplasmic reticulum
Аннотация на английскомСтатьяПолный текст не найденОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования