Unlike other countries, the Korean chemical industry does not clearly distinguish between industrial sites and residential areas. The 2012 Gumi Hydrogen Fluoride Accident revealed that chemical accidents could cause damage to nearby residents. Accordingly, the Chemicals Control Act was enacted in 2015, which requested industrial sites using chemicals to perform a risk assessment for all chemical facilities and to distribute the results to the local residents and governments. Industrial businesses had the responsibility of warning the local residents. In this study, two programs (Areal Location
Сравнительное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The possible causative agent and shrimp species involved in a bait shrimp poisoning case that occurred in northern Taiwan was determined. Because the patient's symptoms were similar to those caused by boric acid and slightly similar to those caused by sulfite, the concentrations of boric acid and sulfite (as sulfur dioxide) in the patient's vomitus and in shrimp collected from bait stores and markets were analyzed. The concentration of boric acid was 36.8 to 37.1 mg/g in the patient's vomitus, 1.4 to 3.8 mg/g in shrimp meats obtained from bait stores, and not detectable (less than 0.001 mg/g)
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite the heterogeneous reaction of sulfur dioxide (SO2) on mineral dust particles significantly affects the atmospheric environment, the effect of acidic gases on the formation of sulfite and sulfate from this reaction is not particularly clear. In this work, using the in-situ diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) technique, we employed a mineral dust particle model (CaCO3) combined with NO2 and acetic acid to investigate their effects on the heterogeneous reaction of SO2 on CaCO3 particles. It was found that water vapor can promote the formation of sulfite an
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A central question in the formation of secondary aerosols is whether organic molecules participate in the formation of prenucleation clusters or are they only adsorbed after formation of larger aerosols? The difficulty in understanding the role of organic molecules in aerosol formation is that there are very few studies of prenucleation clusters produced from various organics and sulfuric acid, so it is uncertain whether organic compounds form prenucleation clusters. Isoprene is the most abundant volatile biogenic organic compound (VOC) emitted into the atmosphere, accounting for about 70% of
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Assessing novel electrocatalysts for the electrochemical ammonia synthesis (EAS) requires reliable quantitative trace analysis of electrochemically produced ammonia to infer activity and selectivity. This study concerns the development of an ion chromatography (IC) method for quantitative trace analysis of ammonium in 0.1 M sulfuric acid electrolyte, which is applied to EAS gas-diffusion electrode (GDE) experiments with commercial chromium nitride as electrocatalyst. The developed IC method is highly sensitive, versatile, and reliable, achieving a limit of quantification (LOQ) of 6 μg l-1 (6 p
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Biscyclometalated iridium(III) complexes with an ancillary acetylacetone ligand, Ir(L)(2)(acac), (L = 2-(benzo[b]thiophen-2-yl)pyridine (btp), 1-phenylisoquinoline (piq), 2-phenylbenzothiazole (bt), 2-phenylpyridine (ppy), acac = deprotonated acetylacetone), demonstrate spectroscopic changes in their UV-Vis absorption and luminescent emission under acidic conditions. Such changes were found to be the same as those observed when certain mercury salts exist in the systems. Because some iridium(III) complexes have sulfur-containing ligands (i.e., btp and bt), a question was then raised as for whe
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass i
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UV-induced degradation of odorous dimethyl sulfide (DMS) was carried out in a static White cell chamber with UV irradiation. The combination of in situ Fourier transform infrared (FT-IR) spectrometer, gas chromatograph-mass spectrometer (GC-MS), wide-range particle spectrometer (WPS) technique, filter sampling and ion chromatographic (IC) analysis was used to monitor the gaseous and potential particulate products. During 240 min of UV irradiation, the degradation efficiency of DMS attained 20.9%, and partially oxidized sulfur-containing gaseous products, such as sulfur dioxide (SO2), carbonyl
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The mechanism of arsine (AsH(3)) toxicity is not completely understood. The first cytotoxic effect of AsH(3) is disruption of ion homeostasis, with a subsequent hemolytic action. The only accepted treatment for AsH(3) toxicity is exchange transfusion of the blood. In this study the effect of sulfur, sulfur compounds, thiol-containing compounds, and thiol inhibitors on AsH(3)-induced disruption of membrane transport and hemolysis in human erythrocytes was investigated in vitro. Elemental sulfur, sodium thiosulfate, 5, 5'-dithio-bis(2-nitrobenzoic acid), and meso-2,3-dimercaptosuccinic acid were
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The focus of this paper is the search and characterization of novel catalysts for the gas phase oxidation of concentrated SO₂ for the production of sulfuric acid. Modern high-throughout (HT) methods such as emissivity corrected Infrared Thermography (ecIRT) and automated synthesis techniques were used for the synthesis and activity measurements of the samples. In addition a plug flow reactor that uses UV-vis online analytics for the quantification of the SO₂ conversion was designed, built and used for validation of the HT results. The study started with a highly diverse search space of element
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The functional effects of an RNA can arise from complex three-dimensional folds known as tertiary structures. However, predicting the tertiary structure of an RNA and whether an RNA adopts distinct tertiary conformations remains challenging. To address this, we developed BASH MaP, a single-molecule dimethyl sulfate (DMS) footprinting method and DAGGER, a computational pipeline, to identify alternative tertiary structures adopted by different molecules of RNA. BASH MaP utilizes potassium borohydride to reveal the chemical accessibility of the N7 position of guanosine, a key mediator of tertiary
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
l-Cysteine is a highly reactive amino acid that is modified into a variety of chemical structures, including cysteine sulfinic acid in human metabolic pathways, and sulfur-containing scaffolds of amino acids, alkaloids, and peptides in natural product biosynthesis. Among the modification enzymes responsible for these cysteine-derived compounds, metalloenzymes constitute an important family of enzymes that catalyze a wide variety of reactions. Therefore, understanding their reaction mechanisms is important for the biosynthetic production of cysteine-derived natural products. This review mainly
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The physicochemical property, volatile flavor compounds, and microbial community structure of Jinhua fatty ham (FH) and lean ham (LH) were investigated and compared by high-throughput sequencing and HS-GC-IMS. Results showed that FH had higher pH and slightly lighter and yellower color than LH. Meanwhile, 33 volatile flavor compounds were identified from FH and LH, among which LH showed higher abundance of total alcohols and acids, but FH had generally richer aldehydes, ketones, esters, heterocyclic, and sulfur-containing compounds. Moreover, FH and LH did not have significant difference in α-
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND/OBJECTIVES: Chronic gut dysbiosis due to a high-fat diet (HFD) instigates cardiac remodeling and heart failure with preserved ejection fraction (HFpEF), in particular, kidney/volume-dependent HFpEF. Studies report that although mitochondrial ATP citrate lyase (ACLY) supports cardiac function, it decreases more in human HFpEF than HFrEF. Interestingly, ACLY synthesizes lipids and creates hyperlipidemia. Epigenetically, ACLY acetylates histone. The mechanism(s) are largely unknown.
METHODS/RESULTS: One hypothesis is that an HFD induces epigenetic folate 1-carbon metabolism (FOCM) and
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A simple and rapid, yet sensitive technique was developed for concurrent measurement of trichloroethylene (TCE) and its major metabolites (i.e., trichloroacetic acid, trichloroethanol and dichloroacetic acid) in blood and in solid tissues. The method involves addition of an esterizer (water, sulfuric acid, methanol; 6:5:1; v/v/v) to blood or tissue homogenate in sealed vials, and subsequent gas chromatographic headspace analysis. The procedure should be useful in medical monitoring of TCE exposure as well as in experimental work, notably pharmacokinetic and pharmacodynamic studies pertaining t
СтатьяПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sulfur dioxide (SO2) and its derivatives have long been considered as hazardous environmental pollutants but commonly used as food additives in safe dose range. They also could be produced from biological metabolism process of sulfur-containing amino acids. However, their physiological roles remain extremely obscure mainly due to lack of efficient tools for monitoring and imaging strategy establishment. Furthermore, most of current studies of this aspect focus on novel probe design or just imaging them rather than on the ins and outs. Therefore, there is a high significance of establishing hig
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Known as a new member of the reactive sulphur species (RSS), endogenous sulfur dioxide (SO2) plays potentially reductive roles such as antioxidation, anti-aging, anti-inflammation, and cytoprotection; however, SO2 is also a metabolite of antioxidation. Hypochlorous acid (HClO) has powerful bio-effects on the innate immune system, and its uncontrolled production leads to adverse damage in cells. To illuminate the potential crosstalk between SO2 and HClO in redox homeostasis, we designed a two-photon ratiometric fluorescent probe for dual-response to mitochondrial SO2/HClO crosstalk in cells and
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A clear association between seasonal outbreaks of a paralytic disease called konzo and toxic effects from consumption of insufficiently processed bitter cassava roots has been demonstrated in Bandundu region, Zaire. A community-based survey of 6764 inhabitants identified 110 live and 24 dead konzo-affected persons with a history of isolated non-progressive spastic paraparesis of abrupt onset. The start of these annual outbreaks of konzo in 1974 coincided with the completion of a new tarmac road to the capital, which facilitated the transport of cassava and made it the main cash crop. The exten
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The antioxidant properties of sulfur-containing substances have been experimentally studied in vitro. Unithiol exhibits a wide spectrum us radicals. For this reason, unithiol can be considered, along with ascorbic acid, as a universal drug for the reduction of free radical reactions.
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования