Myeloid leukemia is a malignant hematologic disorder characterized by abnormal proliferation and differentiation arrest of myeloid progenitor cells, and its molecular mechanisms remain incompletely understood. Protein 4.1R (EPB41) is a cytoskeleton-associated protein that exhibits tumor-suppressive effects in various cancers; however, its function and underlying mechanism in myeloid leukemia remain unclear. Our results demonstrated that knockdown of Protein 4.1R significantly promoted cell proliferation, inhibited apoptosis, and increased the proportion of S-phase cells in K562 and HEL cells.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cashmere production declines with age in Inner Mongolian cashmere goats, but the molecular mechanisms are unknown. This study employed a transcriptome-wide RNA-seq analysis to compare age-associated and breed-related gene expression profiles in goat skin, with particular emphasis on age-dependent AKT1 expression and its associated signaling pathways. Skin tissues from cashmere goats at 12 and 15 months and age-matched non-cashmere controls were analyzed by RNA-seq (BGIDNBSEQ platform). Differential expression and functional enrichment analyses were performed on skin transcriptomes of cashmere
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Regulation of miRNAs in mammalian cells-including their expression, activity, transport, storage, and export-is vital for the control of gene expression and cellular function. This process is affected by external stimuli, such as stress or pathogen exposure, and regulated by interactions among miRNAs, target mRNAs, and RNA-binding proteins. Human ELAVL1 HuR, a stress-responsive nuclear protein that can shuttle to the cytoplasm, modulates miRNA activity, storage, and export in a contextual manner. As an AU-rich element (ARE)-containing RNA-binding protein, HuR plays multimodal roles in miRNA re
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Grain filling is a complex trait governed by multiple physiological processes. Although numerous transcription factors (TFs) have been shown to regulate storage substance synthesis, the central regulators that coordinate these diverse pathways remain largely unknown. OsNAC20 and OsNAC26 function as direct regulators of storage substance synthesis. Here, we detected that OsNAC20 and OsNAC26 regulate grain filling beyond this role. Combining DNA affinity purification sequencing analysis (DAP-seq) and RNA sequencing (RNA-seq), we found that OsNAC20/26 regulate storage substance biosynthesis by ac
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aquatic ecosystems in southeastern Mexico face increasing chemical pollution, yet non-lethal molecular tools to monitor native reptile populations remain limited. We performed RNA sequencing (RNA-seq) on non-lethal caudal scute biopsies of 43 Morelet's crocodiles (Crocodylus moreletii) across six wild populations and a captive reference group. After mapping to the Alligator mississippiensis genome, 18,107 expressed genes were analyzed using multivariate, differential-expression, co-expression network, and single-sample pathway scoring approaches. Wild crocodiles showed a consistent shift along
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Alternative feed ingredients may alter intestinal structure and function. We examined jejunal, ileal, and cecal responses in Large Diqing Tibetan pigs fed a control diet or one in which walnut cake replaced 50% of soybean meal. Two pigs were sampled from each of three pens per treatment. Intestinal morphology was assessed histologically, and RNA sequencing data from 8 jejunal, 12 ileal, and 10 cecal samples retained after screening were analyzed by voom-dream, differentially expressed gene (DEG) enrichment analysis, and gene set enrichment analysis (GSEA). The 50W group showed higher villus-re
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Tau interacts with multiple heterogeneous nuclear ribonucleoproteins (hnRNPs)-a family of RNA binding proteins that regulate multiple known cellular functions, including mRNA splicing, mRNA transport, and translation regulation. We have previously demonstrated particularly significant interactions between phosphorylated tau and three hnRNPs (hnRNP A1, hnRNP A2B1, and hnRNP K). Although multiple hnRNPs have been previously implicated in tauopathies, knowledge of whether these hnRNPs colocalize with tau aggregates or show cellular mislocalization in disease is limited. Here, we performed a neuro…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a member of the hnRNP family of conserved proteins that is involved in RNA transcription, pre-mRNA splicing, mRNA transport, protein translation, microRNA processing, telomere maintenance and the regulation of transcription factor activity. HnRNP A1 is ubiquitously, yet differentially, expressed in many cell types, and due to post-translational modifications, can vary in its molecular function. While a plethora of knowledge is known about the function and dysfunction of hnRNP A1 in diseases other than neurodegenerative disease (e.g., can…
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bordetella pertussis is a Gram-negative strictly human pathogen of the respiratory tract and the etiological agent of whooping cough (pertussis). Previously, we have shown that RNA chaperone Hfq is required for virulence of B. pertussis. Furthermore, microarray analysis revealed that a large number of genes are affected by the lack of Hfq. This study represents the first attempt to characterize the Hfq regulon in bacterial pathogen using an integrative omics approach. Gene expression profiles were analyzed by RNA-seq and protein amounts in cell-associated and cell-free fractions were determine
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report the bioinformatic prediction and structural validation of two lasso peptides, acinetodin and klebsidin, encoded by the genomes of several human-associated strains of Acinetobacter and Klebsiella. Computation of the three-dimensional structures of these peptides using NMR NOESY constraints verifies that they contain a lasso motif. Despite the lack of sequence similarity to each other or to microcin J25, a prototypical lasso peptide and transcription inhibitor from Escherichia coli, acinetodin and klebsidin also inhibit transcript elongation by the E. coli RNA polymerase by binding to
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
TSC2 is a gene on chromosome 16p13.3 associated with the autosomal dominant neurocutaneous disorder, tuberous sclerosis complex (TSC). By using a partial nucleotide sequence from the cloned TSC2 and polymerase chain reaction methodology, we constructed a digoxigenin-labeled complementary DNA probe to examine TSC2 gene expression in autopsy- or biopsy-derived human tissues by in situ hybridization. TSC2 messenger RNA was widely expressed in various cell types throughout the body, including epithelia, lymphocytes, and cells with endocrine functions, e.g., adrenal cortex and anterior pituitary. I
СтатьяПоддержка исследования: вне правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Coronaviruses have recently emerged as an important group of animal and human pathogens that share a distinctive replicative cycle. Some of the unique characteristics in the replication of coronaviruses include generation of a 3' coterminal-nested set of five or six subgenomic mRNAs, each of which appears to direct the synthesis of one protein. Two virus-specific RNA polymerase activities have been identified. Many of the distinctive features of coronavirus infection and coronavirus-induced diseases may result from the properties of the two coronavirus glycoproteins. The intracellular budding
Сравнительное исследованиеСтатьяПоддержка правительства СШАПоддержка службы здравоохранения СШАОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Uterine infections negatively impact cow health and productivity, increasing herd health costs, infertility, and culling. They also interfere with immune efficiency, sperm transport, embryonic development, and implantation, thus leading to pregnancy failure and infertility. Most previous studies have focused on transcriptomic changes induced by uterine infection in dairy cows. The present study aimed to investigate the changes in the endometrial transcript caused by uterine infections in beef cows.
METHODS: To achieve this, we examined the reproductive tract of over 200 Angus cows
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Host dependency factors (HDF) are essential for viral replication and are promising targets for broad-spectrum antivirals. However, most work has focused on individual viruses or individual data types, limiting our understanding of shared host mechanisms across viruses.
METHODS: We developed a pan-viral framework that integrates multi-omics data-including genome-wide perturbation screens, single-cell transcriptomes and viral interactomes-and combines graph-based learning with classical machine-learning models to prioritize HDF for four RNA viruses (SARS-CoV-2, influenza A virus, d
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The microRNA (miRNA) locus miR-144/451 is abundantly expressed in erythrocyte precursors, facilitating their terminal maturation and protecting against oxidant stress. However, the full repertoire of erythroid miR-144/451 target messenger RNAs (mRNAs) and associated cellular pathways is unknown. In general, the numbers of mRNAs predicted to be targeted by an miRNA vary greatly from hundreds to thousands, and are dependent on experimental approaches. To comprehensively and accurately identify erythroid miR-144/451 target mRNAs, we compared gene knockout and wild-type fetal liver erythroblasts b
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Hepatocellular carcinoma (HCC) is the predominant form of primary liver cancer, and remains a major contributor to the global cancer burden. Multi-kinase inhibitors are vital for treating advanced HCC, yet drug resistance remains a major challenge. The molecular basis of metabolic adaptation to drug resistance is poorly understood. Evidence indicates that metabolic reprogramming, particularly dysregulated cholesterol metabolism, plays a key part in drug resistance. Sterol regulatory element-binding protein 2 (SREBP2) regulates cholesterol synthesis, stabilizes receptor tyrosine kinases (RTKs),
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Histoplasma capsulatum (Hc) exists in the soil and is capable of adapting to the shift in environment during infection to ensure survival. Yeast encounter a restrictive host environment low in nutrients such as zinc. In this study we functionally analyzed a putative zinc regulated transporter, HcZrt2, in zinc limiting conditions by complementation of HcZrt2 and gene knockdown through RNA interference (RNAi). Complementation analysis demonstrated HcZrt2's ability to functionally replace the characterized Saccharomyces cerevisiae zinc plasma membrane transporters Zrt1 and Zrt2 in zinc deficient
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MicroRNAs (miRNAs) are small, non-coding RNAs that have the ability to post-transcriptionally regulate gene expression. Hundreds of miRNAs have been identified in humans and they are involved in the regulation of almost every process, including cholesterol transport, metabolism, and maintenance of cholesterol homeostasis. Because of their small size and their ability to very specifically regulate gene expression, miRNAs are attractive targets for the regulation of dyslipidemias and other lipid-related disorders. However, the complex interactions between miRNAs, transcription factors, and gene
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования