BACKGROUND: We have previously shown that an integrated intervention package delivered during preconception, pregnancy and early childhood substantially reduces low birth weight and stunting at 24 months of age compared with routine care. Now we conduct a benefit-cost analysis to estimate the return on investment of this integrated approach in India. This increases the policy relevance of trial results, given the low investment in healthcare in India.
METHODS: We used data from 13 500 participants in the Women and Infant Integrated Interventions for Growth Study (WINGS). Integrated delivery o
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Recent listeriosis outbreaks and recalls related to high prevalence and counts of Listeria monocytogenes in enoki mushrooms imported from South Korea and China represent a current food safety concern. Unlike domestically produced mushrooms, imported products are often packaged without free air exchange and are associated with a longer shelf life. The present study used challenge tests to investigate the potential for harvested enoki mushrooms stored under refrigeration to support the growth of L. monocytogenes, to better inform food safety regulators of the risk associated with low levels of L
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Herbal products have been used for gas pains in children for many years. However, the quality of herbal products used in children and the presence of contamination in the products are controversial. This study was conducted to evaluate the frequency of use of herbal products for gas pain in pediatric patients, the attitudes of parents towards the use of herbal products, and the pyrrolizidine alkaloid content of herbal products used for gas pain.
METHODS: The survey part of the study was conducted between 15.06.2020-15.09.2020 at Gazi University Hospital Pediatrics Clinics. The sur
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The first Good Manufacturing Practices production of a purification-free rice-based oral cholera vaccine (MucoRice-CTB) from transgenic plants in a closed cultivation system yielded a product meeting regulatory requirements. Despite our knowledge of their advantages, plant-based vaccines remain unavailable for human use in both developing and industrialized countries. A leading, practical obstacle to their widespread use is producing plant-based vaccines that meet governmental regulatory requirements. Here, we report the first production according to current Good Manufacturing Practices of a r
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Helper-dependent adenovirus vectors (HDVs) are safe and efficient tools for gene transfer with high cloning capacity. However, the multiple amplification steps needed to produce HDVs hamper a robust production process and in turn the availability of high-quality vectors. To understand the factors behind the low productivity, we analyzed the progression of HDV life cycle. Canine adenovirus (Ad) type 2 vectors, holding attractive features to overcome immunogenic concerns and treat neurobiological disorders, were the focus of this work. When compared with E1-deleted (ΔE1) vectors, we found a fast
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Antimony (Sb) is a group 15 metalloid that is used as a catalyst in the production of polyethylene terephthalate (PET) plastic, a common food contact material (FCM). PET accounts for over 44% of single-use beverage packaging units and is also used in the production of food trays, storage containers, and other items. Due to its frequent co-occurrence with other metals, Sb is also a common contaminant in crystalware, ceramics, and metal FCMs. In light of the increasing use of Sb-containing FCMs in modern society, a thorough evaluation of Sb's potential effect on public health is warranted. Burge
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human embryonic kidney 293 (HEK 293) cells are the main producer cell line for recombinant adeno-associated virus (rAAV) production. However, AAV vector yields among 293 clones vary considerably. To elucidate the biological basis for these differences, whole genomes of an adherent and a suspension 293 cell clone with high-yield rAAV were sequenced using nanopore technology. All 293 cell derivative lines showed a twofold copy number gain at the adenoviral integration site across, suggesting a genome duplication event. To our surprise, the two high-producer clones, despite having been separately
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Boiled noodles are considered to be one of the most perishable foods due to their high moisture content and high water activity. Thus, the hygiene control measures based on HACCP manuals has been recommended in the noodle manufacturing industry. However, there were several cases in which post-packaged products manufactured at the Boiled noodles factory of small-to-medium size company detected a viable cell count higher than their voluntary standards. To identify the source of microbial contamination, an investigation based on the Plan-Do-Check-Act (PDCA) cycle was conducted. The results showed
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The disposable plastic beverage cup is not usually regarded as hazardous to young children. Certain varieties of these products however, are manufactured from a brittle, clear plastic that easily cracks and fragments. While most conscientious parents keep their children safe from peanuts, balloons, and other known choking hazards, a child can surreptitiously bite a cup edge and aspirate the fragment. We report two cases of foreign body aspiration involving clear plastic cups that went undetected one of which remained 21 months following a negative rigid bronchoscopy. Diagnostic difficulties ar
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Full-length unspliced human immunodeficiency virus type 1 (HIV-1) RNAs serve dual roles in the cytoplasm as mRNAs encoding the Gag and Gag-Pol capsid proteins as well as genomic RNAs (gRNAs) packaged by Gag into virions undergoing assembly at the plasma membrane (PM). Because Gag is sufficient to drive the assembly of virus-like particles even in the absence of gRNA binding, whether viral RNA trafficking plays an active role in the native assembly pathway is unknown. In this study, we tested the effects of modulating the cytoplasmic abundance or distribution of full-length viral RNAs on Gag tr
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control of a heterologous expression system to facilitate the analysis of the resulting phenotype. This approach can be used to express a gene that is not normally found in the organism, to express a mutant form of a gene product, or to over-express a dominant-negative form of the gene product. It is particularly useful in the study of the hematopoietic system, where transcriptional regulation is a major control mechanism in the development and differ
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Yogurt, as a globally prevalent fermented dairy product, is renowned for its substantial nutritional value and a myriad of health benefits, particularly pertaining to the digestive system. This narrative review elucidates the latest advancements in yogurt development from 2019 to 2024, addressing aspects of microbiological safety, quality, functionality, sensory evaluation, and consumer perceptions across diverse protein sources. The intrinsic quality of yogurt is notably influenced by its primary ingredient, milk, traditionally derived from animals such as cows, goats, and sheep. In recent ye
СтатьяОбзорПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: The use of novel tobacco products, such as heated tobacco products (HTPs) and electronic cigarettes (referred to as an electronic nicotine delivery systems (ENDS), and electronic non-nicotine delivery systems (ENNDS)), is increasing among the youth globally. Among the key factors contributing to increased use is tobacco marketing, including advertising emphasizing flavored products, which influences perceptions, especially among youth. In Georgia, recent efforts have strengthened tobacco control, with the "new generation" tobacco control legislation adopted in 2017. Consequently,
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investig
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The use of antibiotics in animal production are widely used for disease treatment, health protection, and as growth promoters. Common antibiotics used in veterinary medicine are excreted and eliminated through the sewage system, contaminating water and soil with negative effects on agricultural activities. This systematic review focuses on the trend of research works on antibiotic residues, evaluating antibiotics used in livestock production and their excretion in animal products and in environmental matrices such as water and soil. Our database was composed of 165 articles, reporting the conc
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bexsero is a multivalent vaccine containing outer membrane vesicles (OMV) derived from Neisseria meningitidis group B strain NZ98/254 and three recombinant meningococcal proteins, Neisserial adhesin A, Heparin binding antigen and factor H binding protein. OMV production relies on the growth of large-scale cultures of N. meningitidis under controlled conditions. Changes to environmental factors, such as temperature, pH, nutrient availability and trace elements, can impact the growth rate of the meningococcus. Furthermore outer membrane expression levels vary in response to the environmental mil
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The range of software available to radiologists has increased enormously with the advancement of AI. A good example of this is software to determine ASPECTS in the treatment of potential stroke patients.
OBJECTIVE: In this study, two software packages (eASPECTS from Brainomix and VIA_ASPECTS from Siemens) were tested and compared for their performance in the daily clinical routine of a maximum care provider with a 24/7 stroke unit.
METHODS: A total of 637 noncontrast CT images were obtained from consecutive patients with suspected stroke, of whom 73 were finally diagnosed with MC
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The aim of the present study was to describe the scientific production on sexuality and affectivity of autistic people. The inclusion criteria were articles published in all languages from the year 2000 to 2023, excluding reviews, proceedings, and other works not considered original. The search was performed in the Web of Science Core Collection and RStudio was utilized to analyze the records, with the "Bibliometrix 4.1.0" package and the VOSviewer software. A total of 314 articles were included, from the USA, Australia, and parts of Europe. The production peak was found in the year 2020, the
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During September 2019, public health authorities in El Paso County, Colorado, were notified of four patients who had presented to nearby hospitals with clinical features consistent with botulism, a paralytic illness caused by botulinum neurotoxin. One patient died soon after presentation; the other three patients required intensive care but recovered after receiving botulism antitoxin. Botulinum toxin type A was detected in serum from all patients. On further investigation, all four patients had shared a meal that included commercially prepared roasted potatoes from an individual package witho
СтатьяПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: In 2023, the UK government proposed a Bill introducing a generational ban on the sale of tobacco products and measures targeting youth nicotine product (NP) use. Industries' responses remain unexplored.
METHODS: We analysed 43 consultation and evidence submissions from tobacco and nicotine industry-linked actors, assessing their connections to transnational tobacco companies (TTCs) and using an evidence-based taxonomy to examine framing strategies.
RESULTS: TTCs and actors with known current TTC links accounted for 42% of submissions. Other actors-some with historic TTC ties-were
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования