FIP1L1-PDGFRA-positive myeloid neoplasm with eosinophilia (F/P+ MN-eo) is a rare disease: robust epidemiological data are lacking and reported issues are scarce, of low sample-size and limited follow-up. Imatinib mesylate (IM) is highly efficient but no predictive factor of relapse after discontinuation has yet been identified. One hundred and fifty-one patients with F/P+ MN-eo (143 males; mean age at diagnosis 49 years; mean annual incidence: 0.18 case per million population) were included in this retrospective nationwide study involving all French laboratories who perform the search of F/P f
Клиническое исследованиеСтатьяМногоцентровое исследованиеПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Based on a case report an overview on the differential diagnostic considerations with respect to blood hypereosinophilia (HE) and hypereosinophilic syndromes (HES) in childhood is given. A 13-year-old boy was admitted for the clarification of an asthma. In the blood count an increased HE with 3 500/µl (30%) was found along with elevated total serum IgE and IL-5 level (2 000 IU/ml and 17 pg/ml). Lung function showed an obstruction (FEV1 38%). Radiologically the picture of bronchiectasis and mucus pluggine appeared. In the BAL a HE (76%) with raised IL-5 level was apparent. Histologically asthma
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: The fusion protein between the platelet-derived growth factor receptor alpha (PDGFRalpha, P) gene and the Fip1-like1 (FIP1L1, F) may be identified in 14 to 60% of HES and it indicates a clonal hypereosinophilic syndrome called F/P-positive CEL. We herein report a case of F/P-positive CEL with retro-orbital localization, who was successfully treated with imatinib.
CASE REPORT: A 53-year-old male presented an absolute eosinophil count of 25,000/mm(3), anemia (Hb 10.2 g/dl) and a moderate increase in the platelet count (571,000/mm(3)). A clinical examination revealed left exophthal
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Infectious bursal disease virus (IBDV) of the Birnaviridae family leads to immunosuppression of young chickens by destroying B cells in the bursa of Fabricius (BFs). Given the increasing number of variant IBDV strains, we urgently require a method to produce attenuated virus for vaccine development. To accomplish this goal, the dual-promoter plasmids in which the RNA polymerase II and RNA polymerase I (Pol I) promoters were placed upstream of the IBDV genomic sequence, which was followed by mouse Pol I terminator and a synthetic polyadenylation signal, were developed for rapid generation of IB…
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The HIV-1 capsid is involved in all infectious steps from reverse transcription to integration site selection, and is the target of multiple host cell and pharmacologic ligands. However, structural studies have been limited to capsid monomers (CA), and the mechanistic basis for how these ligands influence infection is not well understood. Here we show that a multi-subunit interface formed exclusively within CA hexamers mediates binding to linear epitopes within cellular cofactors NUP153 and CPSF6, and is competed for by the antiretroviral compounds PF74 and BI-2. Each ligand is anchored via a
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Retroviral vectors derived from gammaretroviruses or lentiviruses have now been used extensively in clinical gene therapy trials for several diseases including primary immunodeficiencies, beta thalassaemia and adrenoleukodystrophy. Their utility in this setting has been readily demonstrated by the largely favourable outcomes in recent clinical trials, however this success has been marred by the emergence of malignancies in some trials. These malignancies were a consequence of perturbation of cellular proto-oncogene expression by the integrated retroviral vectors, the process of which is referr
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To study the clinical characteristics of hypereosionophilic syndrome and chronic eosinophilic leukemia (HES/CEL) in Japan, the clinical data of 29 HES/CEL patients throughout the country were surveyed. Moreover, the involvement of the FIP1L1-alphaPDGFR fusion gene resulting from a cryptic del (4)(q12q12) was examined in 24 cases. The FIP1L1-alphaPDGFR messenger RNA (mRNA) was detected in three patients (13% of patients fulfilled WHO criteria and 17% of Chusid criteria). One had a novel fusion transcript, which skipped the exon 12 of alphaPDGFR. The transcript appears to be generated by a splic
СтатьяМногоцентровое исследованиеПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Huntington's disease (HD) is a fatal neurodegenerative disease caused by a trinucleotide repeat expansion in exon 1 of the huntingtin gene (HTT) that results in toxic gain of function and cell death. Despite its monogenic cause, the pathogenesis of HD is highly complex, and increasing evidence indicates that, in addition to the full-length (FL) mutant HTT protein, the expanded exon 1 HTT (HTTexon1) protein that is translated from the HTT1a transcript generated by aberrant splicing is prone to aggregate and might contribute to HD pathology. This finding suggests that reducing the expression of
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human parvovirus B19 (B19V) expresses a single precursor mRNA (pre-mRNA), which undergoes alternative splicing and alternative polyadenylation to generate 12 viral mRNA transcripts that encode two structural proteins (VP1 and VP2) and three nonstructural proteins (NS1, 7.5-kDa protein, and 11-kDa protein). Splicing at the second 5' donor site (D2 site) of the B19V pre-mRNA is essential for the expression of VP2 and the 11-kDa protein. We previously identified that cis-acting intronic splicing enhancer 2 (ISE2) that lies immediately after the D2 site facilitates the recognition of the D2 donor …
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: We describe the experimental design for a methodological approach to determine whether directed adaptive mutation occurs in mamm … mbryonic fibroblast cells is presented that links clonal cell growth to reversal of an inactivating polyadenylation site mutation. Thus, cells exhibit growth only in the presence of both the countermutation and an inducing agent (doxycycline). The type and frequency of mutation in the presence or absence of doxycycline will be evaluated. Additional experimental a …
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Glycogen storage disease type II (GSD II), Pompe's disease, is caused by the deficiency of acid alpha-D-glucosidase (GAA) in lysosome and is … -shortened BglII-NotI fragment human GAA cDNA, downstream of CMV promoter and bovine growth hormone polyadenylation signal, as well as AAV ITR region. When fibroblasts obtained from GSD II patients were cultured and infected with rAAV-GAA, the GAA activity of the fibroblasts increased four- to five-fold. Using acid maltase deficient (AMD) Japanese quail as the an …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cel
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Testin I and testin II are the two molecular variants of testin that are synthesized and secreted by Sertoli cells in vitro. N-Terminal and … tion codon from the 5' end and ends with a TGA termination codon located 245 nucleotides before the polyadenylation site. The deduced amino acid sequence indicates that testin contains a 16 amino acid signal peptide with two possible cleavage sites that yield 314 and 317 amino acids for testin I and testin II with calculated molecular weights of 36,029 and 36,299 …
Сравнительное исследованиеСтатьяПоддержка службы здравоохранения СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The isolation of the Koala retrovirus-like virus from Australian megabats and the identification of endogenous retroviruses in the bat genom … rotein 5α (TRIM5α), myxovirus resistance 2/B (Mx2/MxB), and carboxy terminus-truncated cleavage and polyadenylation factor 6 (CPSF6-358), demonstrated poor anti-HIV-1 activity in megabat cells, whereas megabat TRIM5α restricted MLV infection, suggesting that the major known CA-dependent restriction factors were not dominant in the observed lineage-specific suscep …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Adult height is inversely related to metabolic syndrome (MetS) risk, but its genetic impacts have not been revealed. The present study aimed to examine the hypothesis that adult height-related genetic variants interact with lifestyle to influence adult height and are associated with MetS risk in adults aged >40 in Korea during 2010-2014. Participants were divided into short stature (SS; control) and tall stature (TS; case) by the 85th percentile of adult height. The genetic variants linked to adult height were screened from a genome-wide association study in a city hospital-based cohort (n = 5
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During the immediate-early (IE) phase of reactivation from latency, the Kaposi's sarcoma-associated herpesvirus (KSHV) replication and transcription activator protein (RTA) (or ORF50) is thought to be the most critical trigger that upregulates expression of many downstream viral lytic cycle genes, including the delayed-early (DE) gene encoding the replication-associated protein (RAP) (or K8). RAP physically interacts with and stabilizes the cellular transcription factor CCAAT/enhancer-binding protein-alpha (C/EBPalpha), leading to upregulated expression of the cellular C/EBPalpha and p21(CIP-1
СтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DNA-based vaccines have been developed and tested against a range of infectious agents, including influenza A viruses (IAV). Bacterial plasm … tains only essential elements, including a promoter, the gene encoding the vaccine immunogen, and a polyadenylation signal, and can be produced in a cell-free system. Using a mouse model for influenza A virus, we demonstrate that an LNP-encapsulated linear DNA cassette induces humoral and cell-mediated immune responses and protects immunized mice against a lethal …
СтатьяПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
UNLABELLED: Type I interferons (IFNs), including IFN-α, upregulate an array of IFN-stimulated genes (ISGs) and potently suppress Human immun … A105T, both of which allow escape from inhibition by MX2 and the truncated version of cleavage and polyadenylation specific factor 6 (CPSF6), as well as the cyclophilin A (CypA)-binding loop mutation P90A, all increase sensitivity to IFN-α-mediated inhibition. Using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 technology, we demonstrate …
СтатьяПоддержка исследования: вне правительства СШАПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования