Результаты поиска

Examination of cutaneous T-cell lymphoma for human herpesviruses by using the polymerase chain reaction.

The etiology of cutaneous T-cell lymphoma remains unknown, although an association with viral infection, in particular certain retroviruses and human herpesviruses, has been suggested. The purpose of this study was to examine skin biopsies of cutaneous T-cell lymphoma for the presence of Epstein-Barr virus, herpes simplex virus type 1 and type 2, and human herpesvirus-6 by using the polymerase chain reaction. Lesional skin biopsies from 30 patients with cutaneous T-cell lymphoma were studied. Control specimens included biopsies from 9 patients with lymphomatoid papulosis and 10 patients with p…

Rapid detection of cytomegalovirus structures in cerebrospinal fluid and brain biopsies by polymerase chain reaction.

The joint application of stereotactic brain biopsy and DNA amplification methods, like the polymerase chain reaction (PCR) are diagnostic purposes that allows in approximately 24 h to clarify the viral etiology of central nervous system infections. We demonstrate PCR results from the brain biopsy of an HIV-1 patient with two cerebral lesions. Beside the neuropathological diagnosis of a B-cell non-Hodgkin lymphoma the experimental results are indicative of active transcription of cytomegalovirus (CMV) in cerebral tissue. The markedly higher amount of CMV-specific RNA found in the biopsy specime…

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were diff…

New method for plague surveillance using polymerase chain reaction to detect Yersinia pestis in fleas.

Yersinia pestis, the plague bacillus, infects a variety of mammals throughout the world and is transmitted by fleas. We developed a polymerase chain reaction (PCR) test using primers designed from the Y. pestis plasminogen activator gene to directly detect plague-infected fleas. As few as 10 Y. pestis cells were detected, even in the presence of flea tissue, by PCR and then agarose gel electrophoresis and ethidium bromide staining. The feasibility of the assay was demonstrated by using naturally infected Xenopsylla cheopis fleas. The detection of Y. pestis in fleas by PCR provides a rapid and …

Detection of immunoglobulin gene rearrangement in B-cell lymphomas by polymerase chain reaction gene amplification.

This is a report on our attempt to use polymerase chain reaction (PCR) to detect rearrangement of the immunoglobulin gene in the tissue specimens obtained from 30 patients with non-Hodgkin's lymphomas. There were 20 B-cell lymphomas and 10 T-cell. All 20 B-cell lymphomas but none of the 10 T-cell lymphomas had JH rearrangement by Southern analysis. Two pairs of primers (V670/OL-4 and VH26/OL-4) were designed to amplify the CDR3 region of the immunoglobulin gene heavy chain. The PCR analysis was positive using either one or both pairs of primers in 11 of the the 20 cases (55 per cent) of B-cell…

A general method for cloning recA genes of gram-positive bacteria by polymerase chain reaction.

An internal fragment of the recA gene from eight gram-positive organisms has been amplified by using degenerate primers in a polymerase chain reaction. The internal 348- or 360-bp recA DNA segments from Bacillus subtilis, Clostridium acetobutylicum, Lactobacillus bulgaricus, Lactobacillus helveticus, Leuconostoc mesanteroides, Listeria monocytogenes, Staphylococcus aureus, and Streptococcus salivarus subsp. thermophilus were amplified, cloned, and sequenced. The G + C contents of the DNA from these species range from 28 to 52%. The sequences of the bacterial recA genes show strong relatedness.…

Detection of chimeric BCR-ABL genes in acute lymphoblastic leukaemia by the polymerase chain reaction.

Philadelphia chromosome-positive acute lymphoblastic leukaemia (ALL) is most common in adults and is associated with poor prognosis. Since karyotypic identification of the Philadelphia translocation has been hampered by technical difficulties, we used the polymerase chain reaction (PCR) to look for the BCR-ABL rearrangement in stored samples from a selected group of 314 German ALL patients. BCR-ABL transcripts were found in 77 of 179 adults and were restricted to those with B-precursor leukaemias. 55% of adult common ALL patients had BCR-ABL and its presence correlated with poor overall surviv…

[Detection of deletions in platelet mitochondrial DNA in Kearns-Sayre syndrome using polymerase chain reaction].

Kearns-Sayre syndrome has been genetically diagnosed by detecting deleted mitochondrial DNA in muscle biopsy specimen using the Southern blot method. However, deleted mitochondrial DNA cannot be detected in the blood by this method. With the limited availability of muscle biopsy specimens in mind, we attempted to establish a noninvasive genetic diagnostic method for this syndrome. The polymerase chain reaction (PCR) was employed for detecting mitochondrial DNA deletions in platelets at levels below the sensitivity of Southern blotting. We selected several pairs of oligonucleotide primers, cons…

Human von Willebrand factor gene and pseudogene: structural analysis and differentiation by polymerase chain reaction.

Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseud … ces between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from hom …

Detection of enteroviral infection in paraffin-embedded tissue by the RNA polymerase chain reaction technique.

A method using the RNA polymerase chain reaction technique to diagnose infection retrospectively using single-stranded RNA enteroviruses in paraffin-embedded tissue blocks is reported. This method takes advantage of extreme sequence conservation in the 5' untranslated region of the enteroviral genome and uses two rounds of amplification with nested oligonucleotide primers, thus allowing rapid diagnosis without the use of radioactive reagents. The technique should prove useful in cases in which viral infection is suspected after histopathologic evaluation, when fresh or frozen tissues often are…

Rapid genotyping of the Chlamydia trachomatis major outer membrane protein by the polymerase chain reaction.

Twenty one Chlamydia trachomatis reference strains and 40 clinical isolates belonging to the lymphogranuloma venerum (LGV) and trachoma biovars were genotyped by differential restriction mapping of the major-outer-membrane-protein gene (MOMP) obtained by the polymerase-chain reaction (PCR). AluI digestion of the PCR product distinguishes eight MOMP-genotypes corresponding to 8 serovars. Six additional enzymes (NlaIII, CfoI, EcoRI, HinfI, DdeI and FokI) further permit the discrimination of 10 MOMP-genotypes corresponding to the 10 remaining serovars of the species. AluI alone allows direct typi

Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of t…

Diagnosis of HTLV-I infected seronegative neurological patients by polymerase chain reaction amplification in Martinique.

HTLV-I is a type C human retrovirus, endemic in Japan, central Africa, South America and the Caribbean, which causes adult T cell leukemia/lymphoma and chronic progressive paraparesis. Some neurological patients with chronic progressive myelopathies, but seronegative for HTLV-I have been reported in Martinique. We performed polymerase chain reaction (PCR), to look for the presence of HTLV-I genomic sequences in those patients. Two primers were chosen for gag and tax genes. Liquid hybridization was performed on the amplified products using an internal 32p labelled oligonucleotide as a probe. Th…

Mitochondrial DNA mutations associated with neuromuscular diseases: analysis and diagnosis using the polymerase chain reaction.

A number of neuromuscular diseases are associated with molecular defects in the mitochondrial DNA (mtDNA). These include: 1) a missense mutation at nucleotide 11778 in the mtDNA of Leber's hereditary optic neuropathy patients; 2) a heterogeneous array of deletions in the mtDNA of ocular myopathy patients; and 3) small deletions and point mutations in the mtDNA of myoclonic epilepsy and ragged red fiber disease patients. We can now diagnose these diseases at the molecular level from small patient samples by amplifying the affected mtDNA regions using the polymerase chain reaction. Leber's hered…

Differentiation of vaccine and wild mumps viruses using the polymerase chain reaction and dideoxynucleotide sequencing.

Parts of the F gene from 16 mumps viruses derived from vaccines and clinical isolates were amplified using the polymerase chain reaction and their nucleotide sequences were determined. Over a region of 111 nucleotides, eight regions of variability were detected with a maximum of six (5.4%) changes occurring between any two virus strains. The Jeryl Lynn and Urabe vaccine strains were clearly different from each other and from wild virus isolated from cases of non-vaccine-associated mumps. In contrast, viruses isolated from the cerebrospinal fluid and throat in cases of meningitis and parotitis …

Обнаружение геномных последовательности вируса кори в мозговой ткани SSPE по цепной реакции полимеразы.

В качестве предварительного шага была изменена цепная реакция полимеразы (PCR) для обнаружения геномных последовательностей RNA путем создания копий этих последовательностей CDNA. Были синтезированы пары олигонуклеотидов, дополняющие последовательности в каждом из пяти основных структурных генов белка вируса кори (белок нуклеокапсид, фосфопротеин, матрицовый протеин, белок синтеза и протеин гемагглютинина). Продукты ПЦР были в предварительном порядке идентифицированы путем визуализации полос соответствующего размера путем пятнаэтидиумного метила после геля электрофореза, и их идентичность была

Совпадение в аннотации оригинала
The polymerase chain reaction (PCR) was modified to detect RNA genomic sequences by generating cDNA copies of these sequences as a preliminary step. Oligonucleotide primer pairs complementary to sequences in each of the five major structural protein genes of the measles virus (nucleocapsid protein, phosphoprotein, matrix protein, fusion protein, and hemagglu…

Detection of subclinical systemic disease in primary CNS lymphoma by polymerase chain reaction of the rearranged immunoglobulin heavy-chain genes.

PURPOSE: To search for subclinical systemic disease in bone marrow and peripheral blood in patients with primary CNS lymphoma (PCNSL) to elucidate whether extracerebral relapse may represent a sequel of initial occult systemic disease rather than true extracerebral spread. PATIENTS AND METHODS: Bone marrow and peripheral-blood specimens of 24 PCNSL patients were examined using polymerase chain reaction (PCR) for analysis of clonally rearranged immunoglobulin heavy-chain (IgH) genes. RESULTS: Identical dominant PCR products were found in bone marrow aspirates, blood samples, and tumor biopsy …

Molecular diagnosis of cutaneous T-cell lymphoma: polymerase chain reaction amplification of T-cell antigen receptor beta-chain gene rearrangements.

The goal of our study was to molecularly diagnose CTCL, by cloning the T-cell antigen receptor beta chain (TCR-beta) gene rearrangement from the malignant T cells of a patient with Sézary syndrome, in order to generate a specific oligonucleotide probe capable of detecting CTCL cells through polymerase chain reaction (PCR) amplification. Total RNA isolated from peripheral blood lymphocytes was reverse transcribed and resultant first strand cDNA was PCR amplified utilizing a concensus primer to the TCR-beta variable region (V beta) and a 3' primer to the TCR-beta constant region (C beta). PCR re…

Diagnostic utility of anchored multiplex polymerase chain reaction-based fusion assay on sacrificed cytology slides.

BACKGROUND: Gene fusion testing, essential for the diagnosis and classification of many salivary gland and soft tissue neoplasms, is typically performed on formalin-fixed paraffin-embedded material, which may be limited or unavailable in cytology specimens. Although cytology smears have been validated for single-gene and DNA-based assays, evidence supporting routine diagnostic use of RNA-based next-generation sequencing fusion testing on smears remains limited. METHODS: The authors evaluated the clinical utility of a clinically validated anchored multiplex polymerase chain reaction (adenosine…