BACKGROUND: Increases in the copy number of large genomic regions, termed amplifications, are an important adaptive strategy for many organisms. Numerous amplifications across the AT-rich Plasmodium falciparum genome contribute directly to drug resistance or impact the fitness of this protozoan parasite. During the characterization of malaria parasites selected with a dihydroorotate dehydrogenase (DHODH) inhibitor that targets pyrimidine biosynthesis, we detected increased copies of a genomic region that encompassed 3 genes (~ 5 kb) including GTP cyclohydrolase I (GCH1 amplicon). While amplifi
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The characterization of steroid sulfatase (STS) gene mutation from seven X-linked ichthyotic patients was performed by multiple polymerase chain reaction (MPCR) which amplified two specific regions at the 5' and 3' end of STS gene. The results indicated that five out seven patients were found to have entire STS gene deletion. Two other cases and five patients' mothers showed two amplification fragments. So did two cases of dominant ichthyosis vulgaris. It was further ascertained that entire gene deletion is the main mutation of STS locus in Chinese population. MPCR is a rapid and simple method
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
During the past decades there has been minimal improvement in prevention and treatment of hypertrophic scarring. Reasons include the lack of a validated animal model, imprecise techniques to dissect scar into the histologic components, and limited methodology for measurement of gene expression. These problems have been addressed with the Duroc/Yorkshire model of healing, laser capture microdissection, and the Affymetrix Porcine GeneChip. Here we compared collagen gene expression in fibroproliferative healing in the Duroc breed to nonfibroproliferative healing in the Yorkshires. We made shallow
Сравнительное исследованиеСтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Friedreich ataxia (FA) mutation has recently been identified as an unstable trinucleotide GAA repeat present 7-22 times in the normal population but amplified as many as > 1,000 times in FA. Since it is an autosomal recessive disease, FA does not show typical features observed in other dynamic mutation disorders, such as genetic anticipation. We have analyzed the GAA repeat in 104 FA patients and 163 carrier relatives previously defined by linkage analysis. The GAA expansion was detected in all patients, most (94%) of them being homozygous for the mutation. We have demonstrated that clinic
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The gene polymorphism of the DNAs extracted from reference strains of L. interrogans in China was characterized by LSSP-PCR primered by G1 or G2, which were a pair of specific primers for L. interrogans. The fingerprinting produced by LSSP-PCR showed that serovar lai, serovar canicola, serovar pyrogens, serovar autumnalis, serovar australis, serovar linhai, serovar wolffi and serovar haemolytic have similar patterns, but serovar hebdomadis, serovar javanica, serovar ballum, serovar pomona, serovar spaidjin, serovar tarassov and serovar manahao I have different profiles. This result agreed with
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aneuploidy produces myriad consequences in health and disease, yet models of the deleterious effects of chromosome amplification are still widely debated. To distinguish the molecular determinants of aneuploidy stress, we measured the effects of duplicating individual genes in cells with different chromosome duplications, in wild-type cells (SSD1+) and cells sensitized to aneuploidy by deletion of RNA-binding protein Ssd1 (ssd1Δ). We identified gene duplications that are nearly neutral in wild-type euploid cells but significantly deleterious in euploids lacking SSD1 or in SSD1+ aneuploid cells
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Objective: To explore the mutation characteristics of DMD gene in patients with Duchenne or Becker muscular dystrophy and female carriers, to provide effective prenatal diagnosis. Methods: Samples were collected from 94 male patients clinically diagnosed with Duchenne or Becker muscular dystrophy and 121 corresponding female relatives from Qingdao Women and Children's Hospital from June 2011 to October 2018. Multiplex ligation-dependent probe amplification (MLPA) was used to detect their DMD gene, and 23 high risk pregnants were performed prenatal diagnosis. Any candidate of DMD gene single-ex
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Mastocytosis is an uncommon disease resulting from proliferation of abnormal mast cells infiltrating skin, bone marrow, liver, and other tissues. The aim of this study was to find differences in gene expression in peripheral blood cells of patients with indolent systemic mastocytosis compared to healthy controls. The second aim was to define a specific gene expression profile in patients with mastocytosis.
METHODS: Twenty-two patients with indolent systemic mastocytosis and 43 healthy controls were studied. Whole genome gene expression analysis was performed on RNA samples isolate
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
PCR amplification, restriction fragment length polymorphism, and phylogenetic analysis of oxygenase genes were used for the characterization of in situ methane- and ammonia-oxidizing bacteria from free-living and attached communities in the Eastern Snake River Plain aquifer. The following three methane monooxygenase (MMO) PCR primer sets were used: A189-A682, which amplifies an internal region of both the pmoA gene of the MMO particulate form and the amoA gene of ammonia monooxygenase; A189-mb661, which specifically targets the pmoA gene; and mmoXA-mmoXB, which amplifies the mmoX gene of the M
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоддержка правительства СШАПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
AIMS: Pyothorax-associated lymphoma (PAL) develops in the pleural cavity of patients with a long history of pyothorax. Epstein-Barr virus (EBV) is also involved in PAL, similar to lymphomas in immunodeficient patients. Here we examined T-lymphocyte subsets as well as c-myc and REL gene amplification in PAL tissues.
METHODS AND RESULTS: We determined the number and distribution of CD4+ and CD8+ T-lymphocytes, to evaluate T-cells in the host immune reaction in seven cases of PAL. As controls, we also studied 10 cases of extranodal diffuse large B-cell lymphoma (DLBL) and 10 cases of nodal DLBL.…
Сравнительное исследованиеСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The GBA1 gene encodes the enzyme glucocerebrosidase, which is responsible for lysosomal degradation of the glycosphingolipid glucosylceramide. Biallelic mutations in GBA1 are causative for Gaucher disease, whereas either monoallelic or biallelic mutations are a risk factor for Parkinson's disease. GBA1 mutations, beside reducing enzymatic activity and leading to substrate accumulation, influence a number of molecular and cellular pathways, including lipid homeostasis, endosome-lysosome pathway, endoplasmic reticulum to Golgi protein trafficking, autophagy and mitophagy. Given the critical role
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Highly sensitive nucleic acid testing-assisted early disease detection is crucial for effective disease prevention and management, particularly when targeting low-abundance genetic materials in molecular diagnostics. This study describes CRATE (CRISPR/Cas controlled antisense oligonucleotide (ASO)-mediated translational signal enhancement), a novel ultrasensitive approach for nucleic acid detection by integrating Cas12a trans-cleavage, ASO-controlled gene expression, and cell-free signal protein amplification. This assay leverages the target-induced trans-cleavage of ASO-controlled gene expres
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A cultured stock of masculinized rainbow trout was diagnosed with Y-linked markers (sdY and OmyY1) aiming to detect neomales before their use at the production level. To achieve a reliable diagnosis, the following steps were considered: (1) PCR amplification of the housekeeping β-actin gene to determine the DNA quality of samples, (2) validation of the Y-linked markers by their PCR amplification in male and female samples with known sex, and (3) molecular sexing of the masculinized juveniles based on male-specific (XY genotype) and neomale-specific (XX genotype) PCR product band patterns visua
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Genetic heterogeneity (GH) is a rare but important event in the evaluation of HER2 amplification status. We investigated whether HER2 fluore … t matched to areas of HER2 overexpression or focally different morphology. Nine cases with areas of gene amplification overlapped with <10% of intense circumferential protein expression ("Mini 3+"), and 1 case with focal micropapillary features. Clinical information was available on 6 patients (40%), all were alive with no evidence of disease (mean follow-up 30.5 mo …
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Telomerase reverse transcriptase promoter (pTERT) mutation is a dominant altered telomere maintenance mechanism in primary glioblastomas (GBMs).
OBJECTIVE: The aim of this study was to correlate pTERT mutations with clinico-histological features and other molecular markers (p53 protein-expression, ATRX protein-expression, IDH mutations, EGFR gene amplification and MGMT methylation) in adult GBMs.
MATERIALS AND METHODS: Evaluated for histological patterns, p53 and ATRX protein expression by immunohistochemistry (IHC), IDH mutations by IHC followed by sequencing in IHC negative cas…
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Neuroblastoma is the most common cancer in infants younger than 12 months of age, occurring with an incidence of 1 in 100,000 children. The clinical outcome of neuroblastoma ranges from spontaneous regression to treatment-resistant progression and/or metastasis, and accounts for 8-10% of childhood cancer deaths. Segmental chromosomal aberrations, as well as MYCN and ALK amplification, are among factors contributing to an unfavorable genomic profile and high-risk disease classification. Here, we describe a 5-year-old male who presented with a large right renal neuroblastoma tumor having lung an
Клинический случайСтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
One-step nucleic acid amplification (OSNA) for CK19 mRNA is an intraoperative diagnostic procedure for detection of lymph node metastasis. Automated Gene Amplification Detector RD-200 and the LYNOAMP CK19 gene amplification reagent as components of a new OSNA system have been developed. As an improvement over a conventional system, the new system can analyze 14 samples per run, evaluate two lymph nodes in ~ 17 min, and reduce inhibition of reactions. This study was aimed at evaluating clinical performance of the new system by comparing it with performance of histopathological analysis and a co…
Сравнительное исследованиеОценочное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects we
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Epidermal growth factor (EGF) is an important growth factor for low-serum cultured meat production, yet efficient recombinant expression remains challenging. Here, an integrated engineering strategy combining signal peptide optimization, transcription factor overexpression, and gene dosage amplification was established to enhance recombinant EGF production in Komagataella phaffii. Truncation of amino acids 57-70 in the α-factor signal peptide increased EGF secretion efficiency from 69.8% to 95.3% and yield from 21.86 to 36.07 mg/L. Mit1 overexpression increased the yield to 42.44 mg/L, while s
СтатьяПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования