It has been 70 years since the concept of varied centromere strengths was introduced based on the behavior of dicentric chromosomes. One of the key conclusions from those early experiments was that some centromeres could pull with sufficient force to break a dicentric chromosome bridge, while others could not. In the ensuing decades there have been numerous studies to characterize strengths of the various components involved, such as the spindle, the kinetochore, and the chromosome itself. We review these various measurements to determine if the conclusions about centromere strength are suppor…
СтатьяОбзорПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Centromere defects in Systemic Sclerosis (SSc) have remained unexplored despite the fact that many centromere proteins were discovered in patients with SSc. Here we report that lesion skin fibroblasts from SSc patients show marked alterations in centromeric DNA. SSc fibroblasts also show DNA damage, abnormal chromosome segregation, aneuploidy (only in diffuse cutaneous (dcSSc)) and micronuclei (in all types of SSc), some of which lose centromere identity while retaining centromere DNA sequences. Strikingly, we find cytoplasmic "leaking" of centromere proteins in limited cutaneous SSc (lcSSc) f…
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Plasmodium vivax is the leading cause of malaria outside Africa and represents a significant health and economic burden on affected countrie … develop molecular tools that can be used for genetic manipulation of P. vivax. A putative P. vivax centromere sequence (PvCEN) was cloned and episomal centromere based plasmids expressing a GFP marker were constructed. Centromere activity was evaluated using a rodent malaria parasite Plasmodium yoelii. A plasmid carrying PvCEN was stably maintained in asexu …
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVES: The aim was to define clinical characteristics and long-term survival of patients with dcSSc and positive ACA.
METHODS: We identified all cases of ACA+ SSc in our cohort (n = 1313). Those with dcSSc (ACA+ diffuse) were compared with representative groups of consecutive ACA+ patients with limited subset (ACA+ limited) and ACA- dcSSc (non-ACA diffuse).
RESULTS: Thirty-five patients (2.7%) were ACA+ diffuse. The peak modified Rodnan skin score was not significantly different between the dcSSc subgroups, but it occurred later in the disease course in ACA+ diffuse (88.54 vs 30.65 mont
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Systemic sclerosis (SSc) is systemic, autoimmune, connective tissue disorder characterized by vascular abnormalities, collagen deposition (fibrosis), and the production of autoantibodies to nuclear proteins. About 20%-40% of patients have antibodies to centromere protein (CENP)-A or -B. Despite the known association of anti-CENP antibodies with certain clinical features of SSc, the role of these antibodies in SSc physiopathology is still poorly understood. To better understand the clinical significance and origin of these antibodies, we and others have been studying the epitopic motifs (amino …
СтатьяПоддержка исследования: вне правительства СШАОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The kinetochore is a multiprotein complex that forms on a chromosomal locus designated as the centromere, which links the chromosome to the spindle during mitosis and meiosis. Most eukaryotes, with the exception of holocentric species, have a single distinct centromere per chromosome, and the presence of multiple centromeres on a single chromosome is predicted to cause breakage and/or loss of that chromosome. However, some stably maintained non-Robertsonian translocated chromosomes have been reported, suggesting that the excessive centromeres are inactivated by an as yet undetermin…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Centromere protein B (CENP-B) binds constitutively to mammalian centromere repeat DNA and is highly conserved between humans and mouse. Cenpb null mice appear normal but have lower body and testis weights. We demonstrate here that testis-weight reduction is seen in male null mice generated on three different genetic backgrounds (denoted R1, W9.5, and C57), whereas body-weight reduction is dependent on the genetic background as well as the gender of the animals. In addition, Cenpb null females show 31%, 33%, and 44% reduced uterine weights on the R1, W9.5, and C57 backgrounds, respectively. Pro…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Anti-chromo antibodies (AChA) are autoantibodies accompanying anti-centromere antibodies (ACA). We determined the frequency and clinical significance of AChA in autoimmune rheumatic diseases. Serum samples from 252 patients with rheumatic diseases were examined by immuno-blotting with HeLa nuclear extract and with recombinant N-terminus of 25-kD chromo protein (p25). AChA were detected in 28 (36%) of 77 sera with ACA. AChA were found only in ACA-positive sera. Twenty-two (79%) of 28 recognized a recombinant N-terminal portion of p25, including the chromo domain which is conserved among species…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A 79-year-old woman was diagnosed with Sjögren's syndrome (SjS) at the age of 73 years by lip biopsy, gum test, and salivary gland scintigraphy with positive antinuclear (ANA), positive anti-centromere (ACA), and negative anti-Ro/SS-A antibodies. Seven days before admission, the patient developed gait disturbance, which progressed to difficulty in walking two days before admission. She was hospitalized because of subacute gait disturbance. Neurological examination showed gait disturbances characterized by small steps, wide-based gait, left upper limb clumsiness, and frontal lobe dysfunction. L…
СтатьяКлинический случайАннотация на английскомПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Having one and only one centromere per chromosome is essential for proper chromosome segregation during both mitosis and meiosis. Chromosomes containing two centromeres are known as dicentric and often mis-segregate during cell division, resulting in aneuploidy or chromosome breakage. Dicentric chromosome can be stabilized by centromere inactivation, a process which reestablishes monocentric chromosomes. However, little is known about this process in naturally occurring dicentric chromosomes. Using a combination of fluorescence in situ hybridization (FISH) and immunofluorescence combined with …
СтатьяПоддержка правительства СШАПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Anti-SS-A/Ro antibody (SS-A) and anti-SS-B/La antibody (SS-B) are important serologic markers in the diagnostic criteria for Primary Sjögren's syndrome (SS). Although anti-centromere antibody (ACA)-positive SS is frequently experienced, ACA is not included in these criteria. The purpose of this study was to identify the clinical features of ACA-positive SS and discuss the usefulness of ACA in diagnosing SS. Forty-five patients with SS were divided into the following three groups: SS-A only-positive group (n = 17), SS-A and SS-B both-positive group (n = 18), and ACA only-positive group (n = 10)…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We report here on a familial case of centromeric heteromorphism of chromosome 18 detected by prenatal interphase fluorescence in situ hybridization (FISH) analysis transmitted by the mother to her fetus, and resulting in complete loss of one 18 signal. The prenatal diagnosis was performed by interphase FISH (AneuVysion probe set, and LSI DiGeorge 22q11.2 kit) because of the presence of an isolated fetal cardiac abnormality, and was first difficult to interpret: only one centromeric 18 signal was detectable on prenatal interphase nuclei, along with one signal for the Y and one for the X chromos
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Digital gangrene due to arterial thrombosis can occur due to a variety of causes. There have been reports of patients who have presented with digital gangrene with no known predisposing factors, but with positive anti-centromere antibodies (ACA). Despite that they did not have features suggestive of disorders like Scleroderma or CREST syndrome. We report a patient with digital gangrene, who was asymptomatic before this episode and was found to have both ACA positivity and Polycythemia Vera.
Клинический случайСтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
OBJECTIVE: Autoantibodies directed against centromere proteins (CENPs) are a serologic feature in some patients with systemic sclerosis (SSc). Previous studies have focused on autoantibodies to CENPs A, B, and C. CENP-E is a recently described 312-kd protein that also localizes to the centromere. Therefore, we studied the presence of autoantibodies to recombinant CENP-E in patients with SSc.
METHODS: Sixty sera from patients with the SSc spectrum of diseases were screened for the presence of autoantibodies against CENP-E, by indirect immunofluorescence and immunoblotting using recombinant CEN…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Anti-centromere antibodies (ACA) in 41 sera from patients with primary biliary cirrhosis (PBC) were analyzed by an immunoblotting method and the correlation between the presence of ACA and the clinical features in these PBC patients was studied. In 10 of 16 ACA-positive PBC patients, one or more clinical features of CREST syndrome (PBC-CREST) were found. Statistical differences were observed in age at disease onset, serum levels of IgM and total bilirubin and titer of anti-M2 antibody, between PBC-CREST patients and the PBC patients without CREST symptoms (PBC-non CREST). By immunoblotting ana…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Multiple centromere misdivision derivatives of a translocation between the supernumerary B chromosome and the short arm of chromosome 9 (TB-9Sb) permit investigation of how centromeres of different sizes behave in meiosis in opposition or in competition with each other. In the first analysis, heterozygotes were produced between the normal TB-9Sb and derivatives of it that resulted from centromere misdivision that reduced the amounts of centromeric DNA. These heterozygotes could test whether these drastic differences would result in meiotic drive of the larger chromosome in female meiosis. Cyto…
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Histone phosphorylation is dynamically regulated during cell division, for example phosphorylation of histone H3 (H3)-Ser10, H3-Thr11 and H3-Ser28. Here we analyzed maize (Zea mays L) for Thr133-phosphorylated histone H2A, which is important for spindle checkpoint control and localization of the centromere cohesion protector Shugoshin in mammals and yeast. Immunostaining results indicate that phosphorylated H2A-Thr133 signals bridged those of the centromeric H3 histone variant CENH3 by using a plant displaying yellow fluorescent protein-CENH3 signals and H2A-Thr133 is phosphorylated in differe…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We have analyzed the frequency of premature centromeric division (PCD) in medical personnel professionally exposed to low doses of radiation. They had chromosome aberrations (CAs) involving dicentric chromosomes, ring chromosomes, acentric fragments, chromosome breaks, and chromatid breaks. The study included 30 exposed subjects and 23 controls who were each analyzed by a conventional cytogenetics procedure and subsequently by fluorescent in situ hybridization (FISH). The latter was applied particularly in order to verify PCD in a specific chromosome (chromosome 18) in both metaphases and inte
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Immunodeficiency, Centromeric region instability, Facial anomalies syndrome (ICF) is a rare autosomal recessive disease described in about 50 patients worldwide and characterized by immunodeficiency, although B cells are present, and by characteristic rearrangements in the vicinity of the centromeres (the juxtacentromeric heterochromatin) of chromosomes 1 and 16 and sometimes 9. Other variable symptoms of this probably under-diagnosed syndrome include mild facial dysmorphism, growth retardation, failure to thrive, and psychomotor retardation. Serum levels of IgG, IgM, IgE, and/or IgA are l…
СтатьяОбзорПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis o…
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования