Trichinella spiralis is an intracellular parasitic nematode that infects skeletal muscle cells. Infection results in loss of tissue specific characteristics and conversion of the muscle cell to a Nurse cell. The characteristic changes leading to the formation of the Nurse cell appear complete by day 12 after intramuscular infection. Proteins synthesized in the stichocytes (secretory cells) of T. spiralis and secreted in the host cell are believed to be involved in the process of Nurse cell formation. One secreted glycoprotein of 43 kDa has been considered as a candidate factor involved in Nurs
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The Chinese alligator Alligator sinensis Fauvel (Reptilia: Crocodylia) is considered as one of the most critically endangered species of the 23 extant crocodiles. However, our knowledge of the helminth parasites of this rare animal is completely lacking. During a helminthological survey of reptiles in China, we found a new ascaridoid nematode, Dujardinascaris gigantea sp. n. from A. sinensis. The morphology of D. gigantea sp. n. was studied using light and scanning electron microscopy. The new species was also characterised using molecular methods by sequencing and analysing the small ribosoma
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Among the helminths infecting ruminants in China are three taxa belonging to the genus Fasciola: F. hepatica, F. gigantica and the so-called 'intermediate form' that appears to lie between these two species. Based on the sequences of the second internal-transcribed spacers (ITS-2) within the parasites' nuclear ribosomal DNA (rDNA), a pair of primers (DSJf/DSJ3) specific for F. hepatica and a pair (DSJf/DSJ4) specific for F. gigantica were designed and used to develop PCR-based assays. These assays allowed the identification and differentiation of F. hepatica, F. gigantica and the 'intermediate
Оценочное исследованиеСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The present study aims to describe a new genus and species of microphalloid digenean parasite of two species of bats of the genus Peropteryx from the Mexican Neotropics (in the states of Chiapas and Yucatán). Morphological and molecular data (28s rDNA ribosomal gene sequences) were used to study Digeneans. Sagittatrema zutzi gen. nov. sp., nov., is diagnosed morphologically by having a sagittiform body, a genital pore in the midline of the body, posterior to the ventral sucker, and a cirrus sac running through much of the diameter of the ventral sucker. The nine sequences generated from the 28
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Changes in blood leucocyte levels were investigated in Spraque-Dowley rats vaccinated with cDNA or protein of glutathione S-transferase (GST) of F. hepatica and subsequently challenged with metacercariae of the liver fluke. The analysis of the leucocyte responses measured in vaccinated rats suggests that the form of antigen used for vaccination influenced dynamics of white blood cell response to the fluke infection. The most clear differences were observed in neutrophil and eosinophil levels. The weakest reaction of these cells to the challenge infection was observed in rats vaccinated twice w
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Neurocysticercosis (NCC) is the most common helminthic infection of the central nervous system (CNS) caused by the larval stage of Taenia solium. Accurate and early diagnosis of NCC remains challenging due to its heterogeneous clinical manifestations, neuroimaging deficits, variable sensitivity, and specificity of serological tests. Next-generation sequencing (NGS)-based pathogen analysis in patient's cerebrospinal fluid (CSF) with NCC infection has recently been reported indicating its diagnostic efficacy. In this case study, we report the diagnosis of a NCC patient with a symptom
Клинический случайСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Strongyloidiasis is a major soil-transmitted helminth (STH) disease that affects people worldwide. We present updated data on prevalence in the Lao People's Democratic Republic (Lao PDR) in 2015, arising from a community cross-sectional helminthiasis survey. Fecal samples were collected from 327 individuals across three provinces in Lao PDR (Luang Prabang in the north, Khammouane in the center, and Champasack in the south). Agar plate culture and Kato-Katz methods were used to examine duplicate stool samples from each participant to detect Strongyloides stercoralis and co-infecting helminths.
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
In a cross-sectional study conducted between March 1993 and February 1995, 7103 indiscriminately collected foxes were examined for Trichinella larvae. A total of 3295 serum samples were serologically investigated with an ELISA based on excretory-secretory antigen. The proportion of serologically positive animals ranged between 3.3% and 17.6% in random samples from individual counties or towns and resulted in an estimated overall prevalence of 7.7% (95% CI: 6.9-8.7%). Trichinella larvae were detected in the muscles of five foxes, corresponding to an estimated prevalence of 0.07% in the total sa
СтатьяМногоцентровое исследованиеПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
INTRODUCTION: We recently reported the biochemical characterization of a novel Fasciola hepatica recombinant antigen termed FhSAP2, which has previously shown to elicit protection to F. hepatica infection in rabbits. Further we reported that intramuscular (IM) injections of BALB/c mice with a pFLAG-CMV(-2) vector carrying cDNA encoding for FhSAP2 (cDNA-FhSAP2) induce high levels of immune response. The aim of the present study is to ascertain whether the immune response induced by this DNA construct may induce protection in mice against subsequent infection with F. hepatica metacercariae (mc).
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Infections of humans with Echinococcus multilocularis, the causative agent of alveolar echinococcosis (AE), a zoonosis, have been described with increasing frequency in Poland since 1994. In the attempt to verify these reports, we analyzed specimens obtained from a representative group of Polish patients. Liver lesions in patients with AE that was diagnosed on the basis of results of histological and serological tests contained E. multilocularis DNA, as shown by the presence of specific microsatellite sequences and mitochondrial 12S rDNA. The same tests clearly distinguished between AE and cys
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Despite its extensive presence among grazing ruminants, dicrocoeliosis, also known as 'small liver fluke' disease, is poorly known and often underestimated by researchers and practitioners in many countries. The accurate identification and prepatent diagnosis of Dicrocoelium dendriticum infection is an essential prerequisite for its prevention and control. In the present study, the morphologically identified specimens isolated from the bile ducts of sheep (Ovis aries) were validated through molecular data. The sequence analysis of the second internal transcribed spacer (ITS-2) of our isolates
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The development of control strategies for loiasis is of crucial importance in endemic areas and depends heavily on the accurate identification of occult-infected individuals. A polymerase chain reaction (PCR) and nested polymerase chain reaction (nested PCR) were developed and based on sequences of the repeat 3 region (15r3) of the gene encoding a Loa loa 15-kD protein. The assays was performed on 20 blood samples from occult-infected subjects and 30 from field-collected amicrofilaremic individuals. The size of the initial PCR product was 396 basepairs (bp). When this initial amplification usi
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bacillus Calmette-Guérin (BCG), a live attenuated strain derived from an isolate of Mycobacterium bovis, is one of the childhood vaccinations widely used against tuberculosis (TB). In addition to its effects on mycobacterial diseases, the information has shown the protection effect of BCG in helminthic diseases. In the current review, the role of BCG vaccine in non-specific protection helminthic infection is reviewed. In human alveolar echinococcosis (AE), treatment with BCG enhances host's innate immune response against the parasite via the number and activation of monocytes. In cysticercosis
ОбзорСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Parasite-induced and parasite-regulated larval capsule formation and host immunosuppression are two major characteristics that are unique in Trichinella spp. infections, but the molecule(s) and mechanism(s) that mediate these processes remain largely unknown. Trichinella pseudospiralis and Trichinella spiralis, are obviously different with respect to these two characteristics. A comparative study of these two species, in particular their antigen expression profiles at different developmental stages (the main molecules involved in the cross-talk or interaction between each parasite and its host
СтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degr
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Protozoa, helminths and ectoparasites are the major groups of parasites distributed worldwide. Currently, these parasites are treated with chemotherapeutic antiprotozoal drugs, anti-helminthic and anti-ectoparasitic agents, but, with the passage of time, resistance to these drugs has developed due to overuse. In this scenario, nanoparticles are proving to be a major breakthrough in the treatment and control of parasitic diseases. In the last decade, there has been enormous development in the field of nanomedicine for parasitic control. Gold and silver nanoparticles have shown promising results
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Members of the Brachycladiidae are known to cause pathologies implicated in cetacean strandings and it is important to develop accurate diagnostic markers to differentiate these and other helminths found in cetaceans. Brachycladium goliath (van Beneden, 1858) is a large trematode found, as adults, usually in the hepatic (bile) and pancreatic ducts of various cetaceans. Complete sequences were determined for the entire mitochondrial genome, and phylogenetically informative nuclear genes contained within the ribosomal operon, from a small piece of an individual worm taken from a common minke wha
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Another approach for the identification of genes that code for antigenic products is described using an antigenic sequence tag (AST) strategy. A Schistosoma mansoni adult worm cDNA library was screened with affinity chromatography-purified immunoglobulins from infected human sera and a mild oxidation treatment with sodium periodate. From 1 or both ends of 30 cDNA clones, 30 ASTs were obtained. Of these, 22 were previously known Sm antigens. One clone had matches with entries for other organisms in the databases and 6 had homology with Sm-expressed sequence tags (EST) entries. These clones, tog
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Parasites cause numerous health issues in humans, eventually leading to significant social and economic damage; however, the mechanisms of parasite-mediated pathogenesis are not well understood. Nevertheless, it is clearly evidenced that cancerogenic fluke-induced chronic inflammations and cancer are closely associated with oxidative stress. (1) Methods: The Paragonimus heterotremus infection's genotoxic potential was assessed in a rat model of simultaneous pulmonary and hepatic paragonimiasis by the alkaline version of single-cell gel electrophoresis (comet assay). Statistical analysis of com
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования