Shiga toxin-producing Escherichia coli (STEC) presents a therapeutic dilemma because antibiotic treatment induces prophage-encoded Shiga toxin expression. Galtier et al. engineer phage-derived particles with programmable cell specificity, genetic cargo, and CRISPR guide RNAs that destroy stx while killing STEC in animal models.
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysoge
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Vibriosis causes substantial losses in marine and brackish-water aquaculture, while increasing antimicrobial resistance limits the effectiveness of conventional antibiotic treatment. Biofilm formation and quorum-sensing-controlled virulence further contribute to the persistence of pathogenic Vibrio species. Prophages integrated into Vibrio genomes encode proteins and regulatory elements that may provide alternative approaches for controlling these pathogens. This review evaluates endolysins, polysaccharide depolymerases, nucleases, holins, spanins, tailocins, regulatory proteins, and small RNA
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Nontyphoidal Salmonella spp. are a leading cause of human food poisoning and can be transmitted to humans via consuming contaminated pork. To reduce Salmonella spread to the human food chain, bacteriophage (phage) therapy could be used to reduce bacteria from animals' preslaughter. We aimed to determine if adding a two-phage cocktail to feed reduces Salmonella colonization in piglets. This first required spray drying phages to allow them to be added as a powder to feed, and phages were spray dried in different excipients to establish maximum recovery. Although laboratory phage yields were not
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Objective: To construct a sizeable naive human Fab phage display antibody library to screen high-affinity specific antibodies in vitro. Methods: Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) of 126 healthy individuals, subsequently reverse-transcribed into cDNA, and used as a template. PCR amplification was performed to obtain the VH from IgG, IgM and light chain κ, λ, separately, with the initial PCR products serving as templates for a second round of PCR. Overlap extension PCR was employed to generate fragments of the κ and λ light chains. These fragments were ligat
Аннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Sets of RNA ladders can be synthesized by transcription of a bacteriophage-encoded RNA polymerase using 3'-deoxynucleotides as chain terminators. These ladders can be used for sequencing of DNA. Using a nicked form of phage SP6 RNA polymerase in this study substantially enhanced yields of transcriptional sequencing ladders. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) of chain-terminated RNA ladders allowed DNA sequence determination of up to 56 nt. It is also demonstrated that A-->G and C-->T variations in heterozygous and homozygous samples can
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The nucleotide sequence (2617 nucleotides) of virus-like double-stranded (ds) RNA 3a in a diseased isolate, Log1/3-8d2 (Ld), of the ascomyce … ) RNA than dsRNA, consistent with an evolutionary relationship between RNA 3a and positive-stranded RNA phages.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human cells express thousands of different surface proteins that can be used for cell classification, or to distinguish healthy and disease conditions. A method capable of profiling a substantial fraction of the surface proteome simultaneously and inexpensively would enable more accurate and complete classification of cell states. We present a highly multiplexed and quantitative surface proteomic method using genetically barcoded antibodies called phage-antibody next-generation sequencing (PhaNGS). Using 144 preselected antibodies displayed on filamentous phage (Fab-phage) against 44 receptor
Оценочное исследованиеСтатьяПоддержка NIH: внешняя программаПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Prokaryotic Argonautes (pAgos) are widely distributed and provide immunity against invading DNA. Based on their domain architecture, pAgos are classified into three major groups: long-A, long-B, and short pAgos. Among them, long-B pAgos remain the least understood subgroup. Here, we show that a long-B pAgo-nuclease system (EcBPAN) from Escherichia coli (E. coli) provides the first clear evidence of anti-phage activity among long-B pAgo systems. By combining structural determination, biochemical analyses, and in vivo phage-resistance assays, we elucidated the activation mechanism of EcBPAN. We
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Human beta-galactosidase-deficient skin fibroblasts from a patient with generalized gangliosidosis (GMI-gangliosidosis type I) were treated with phage lambda plac DNA, coding for Escherichia coli beta-galactosidase (beta-D-galactoside galactohydrolase, EC.3.2.1.23). New beta-galactosidase activity detected in cell extracts of phage DNA-treated GMI-gangliosidosis fibroblasts continued to vary considerably from one experiment to another. It behaved like the E. coli z-gene product upon immunochemical and physicochemical investigation. In some experiments the antigenic behavior of resultant beta-g
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: This study aimed to characterise the RNA microbiome, including the virome of extended semen from Swedish breeding boars, with particular focus on Atypical porcine pestivirus (APPV). This neurotropic virus, associated with congenital tremor type A-II in piglets, was recently demonstrated to induce the disease through insemination with semen from infected boars.
RESULTS: From 124 Artificial Insemination (AI) doses from Swedish breeding boars, APPV was detected in one dose in addition to a sparse seminal RNA virome, characterised by retroviruses, phages, and some fecal-associated con
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Isolation of PinmIII cDNA homologues from white spruce tissues required a rigorous RNA extraction protocol developed following assessment of three previously reported conifer RNA extraction protocols. Total RNA was extracted via several purification steps designed to minimize binding of phenolics to nucleic acids and was then subjected to caesium chloride ultra-centrifugation. This procedure produced consistently high-quality, intact RNA from both needles and roots with spectrophotometric ratios of approximately 2.0 for both 260/280 nm and 260/230 nm. Total RNA was obtained from the roots of c
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Flaviviruses are positive RNA viruses that assemble the replication complex in the cytoplasm of the infected cells. In order to get a dynamic view of the formation and distribution of flavivirus genomes in living cells we engineered a tick-borne encephalitis virus (TBEV) replicon with an array of binding sites for the phage MS2 core protein. The modified TBEV replicons were competent for RNA replication and allowed the visualization of replicated genomic RNA that accumulated in cytoplasmic structures with a distinct subcellular localization. Sites of TBEV replicated RNA accumulation were enric
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: Hepatitis delta virus (HDV) is associated with the worst prognosis among viral hepatitis infections; however, it remains largely underdiagnosed, particularly in endemic developing regions, underscoring the need for new, accessible serological methods for large-scale screening.
OBJECTIVES: To develop HDV-mimetic molecules using phage display for application in immunodiagnostic platforms.
METHODS: HDV-mimetic peptides were selected via phage display biopanning, sequenced and screened by phage-enzyme-linked immunosorbent assay (ELISA). Based on the sequences of these peptides, a rec
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Brucellosis is an important zoonotic disease causing huge economic losses worldwide. Currently no effective immunotherapy for Brucellosis or any biomarker to monitor the efficacy of therapy is available. Treatment is ineffective and animals remain carrier lifelong. S19 and RB51 are live attenuated vaccine strains of Brucella abortus. However, S19 induces only antibody, ineffective for intracellular pathogen. RB51 induces cell mediated immunity (CMI) but it is Rifampicin resistant. Both organisms are secreted in milk and can infect humans and cause abortions in animals. Phage lysed bacteria (ly
СтатьяПоддержка исследования: вне правительства СШАОтозванная публикацияПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
N6-methyladenosine (m6 A) is the most abundant nucleotide modification observed in eukaryotic mRNA. Changes in m6 A levels in transcriptome are tightly correlated to expression levels of m6 A methyltransferases and demethylases. Abnormal expression levels of methyltransferases and demethylases are observed in various diseases and health conditions such as cancer, male infertility, and obesity. This research explores the efficacy of m6 A-modified RNA as an anticancer drug target. We discovered a 12-mer peptide that binds specifically to m6 A-modified RNA using phage display experiments. Our flu
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A comparative study of the antiviral effect of interferon inducers from the group of natural double-stranded RNAs (yeast plasmid dsRNA, phage phi 6 and phage f2 dsRNAs was carried out on the model of experimental tick-borne encephalitis. The possibility of inducing up to 60% protection against 10 LD50 of TBE virus by prophylactic inoculation of interferon inducers alone was demonstrated. The therapeutic effect was observed only with yeast dsRNA (30% protection when the inducer was administered 4 hours after virus infection of mice). The prophylactic effect of inoculation of interferon inducers
Сравнительное исследованиеАннотация на английскомСтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Most of the sequenced bacterial genomes contain a gene encoding a protein known as Hfq that resembles the eukaryotic RNA-binding proteins of the LSm family. It was originally identified in Escherichia coli as a host factor required for replication of the Qβ RNA phage. In this review, we present a comprehensive summary of 40 years of investigation to learn that Hfq is an influential, though not essential, global regulator of gene expression in bacteria and that this feature is undoubtedly linked to Hfq's RNA-binding properties. This protein intervenes in different RNA transactions, notably the
СтатьяОбзорПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Viruses that infect bacteria, termed bacteriophages or phages, typically encode their own DNA replication machinery that rapidly generates many copies of the phage genomic DNA in an infected cell. Nucleus-forming phages of the chimallivirus family possess a distinctive repertoire of predicted DNA replication proteins, with two proteins annotated as DNA polymerases plus a DnaB-like replicative helicase, but lacking an identified primase or sliding clamp protein. Here, we demonstrate that in the Pseudomonas aeruginosa -infecting chimallivirus PhiKZ, the core DNA polymerase comprises a stable 1:1
СтатьяПрепринтПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
BACKGROUND: The bovine ephemeral fever virus (BEFV) glycoprotein neutralization site 1 (also referred as G1 protein), is a critical protein responsible for virus infectivity and eliciting immune-protection, however, binding peptides of BEFV G1 protein are still unclear. Thus, the aim of the present study was to screen specific polypeptides, which bind BEFV G1 protein with high-affinity and inhibit BEFV replication.
METHODS: The purified BEFV G1 was coated and then reacted with the M13-based Ph.D.-7 phage random display library. The peptides for target binding were automated sequenced after fo
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования