Many patients suffering late-onset Alzheimer disease show a deficit in respiratory complex IV activity. The de novo pyrimidine biosynthesis pathway connects with the mitochondrial respiratory chain upstream from respiratory complex IV. We hypothesized that these patients would have decreased pyrimidine nucleotide levels. Then, different cell processes for which these compounds are essential, such as neuronal membrane generation and maintenance and synapses production, would be compromised. Using a cell model, we show that inhibiting oxidative phosphorylation function reduces neuronal different
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Little is known about the genetic and morphological characters of Taenia ovis. The purpose of the present study was to characterize sheep isolates of T. ovis using rostellar hook morphometry as well as mitochondrial genes sequence analysis. Ninety sheep specimens of Cysticercus ovis were collected from 18 slaughterhouses in Iran. The mean ± s.d. for total length of large and small hooks were 174.1 ± 6.4 and 116.7 ± 5.4 µm, respectively. CO1 and 12S rRNA sequence analysis showed 11 and nine haplotypes, respectively. The level of pairwise nucleotide variations between individual haplotypes of CO
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Cisplatin holds an illustrious position in the history of chemistry most notably for its role in the virtual cure of testicular cancer. Here we describe a role for this small molecule in cyanide detoxification in vivo. Cyanide kills organisms as diverse as insects, fish, and humans within seconds to hours. Current antidotes exhibit limited efficacy and are not amenable to mass distribution requiring the development of new classes of antidotes. The binding affinity of the cyanide anion for the positively charged metal platinum is known to create an extremely stable complex in vitro. We therefor
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Aedes albopictus is one of the most invasive species, which can carry Dengue virus, Yellow fever virus and more than twenty arboviruses. Based on mitochondrial gene cytochrome c oxidase I (COI) and samples collected from 17 populations, we investigated the molecular character and genetic diversity of Ae. albopictus from China. Altogether, 25 haplotypes were detected, including 10 shared haplotypes and 15 private haplotypes. H1 was the dominant haplotype, which is widely distributed in 13 populations. Tajima'D value of most populations was significantly negative, demonstrating that populations
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
We developed a combined conventional polymerase chain reaction (PCR) and real-time PCR (qPCR)-based assay for detecting and discriminating between Opisthorchis viverrini and Haplorchis taichui parasite infections. The first PCR amplifies the mitochondrial cytochrome c oxidase subunit I (COI) genes of parasites, and differential diagnosis is achieved by performing qPCR with specific primers and SYBR Green I. The detection limit of the assay was found to be 2.0 × 102 plasmid copies in a test in which a stool sample was spiked with a single egg, which is equivalent to 5 eggs per gram (EPG). The t
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Phosphatidylcholine (PC) is a major phospholipid of mitochondria, comprising 40-50% of both the outer and the inner membranes. However, PC must be imported from its production organelles because mitochondria lack the enzymes essential for PC biosynthesis. In a previous study, we found that StarD7 mediates the intracellular transfer of PC to mitochondria. Therefore, in this study, we analyzed the contribution of StarD7 to the maintenance of mitochondrial phospholipid content and function using siRNA-mediated knockdown and knock-out (KO) of the StarD7 gene in HEPA-1 cells. Real time analysis of
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Following the first report of Opisthorchis viverrini infection in a domestic duck in Phu My District of Binh Dinh Province, Central Vietnam, many other cases were observed in the province. We determined the infection rate and intensity of O. viverrini infection in ducks in 4 districts of the province. A total of 178 ducks were randomly selected from 34 farms for examination of flukes in the liver and gall bladder. An infection rate of 34.3% (range 20.7-40.4% among districts) was found; the intensity of infection was 13.8 worms per infected duck (range 1-100). These findings show the role of du
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Five individuals of the domestic Java sparrows, Lonchura oryzivora (Aves: Estrildidae), were examined for coccidian parasites. Sporulated oocysts had two sporocysts containing four sporozoites each. Sporulated oocysts (n=30) were spherical, with a two splinter-like polar granules. Oocyst size was 22.1×20.7 (20.0-25.0×20.0-22.5)μm. They had a thick wall that consisted of a pale yellow outer layer and a dark yellow inner layer, and lacked micropyle and residuum. Sporocysts (n=60) were elongated ovoid 14.1×9.8 (12.5-15.0×7.5-10.0)μm, smooth walled, and colorless, with crescent-shaped Stieda and i
СтатьяПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Fasciolosis is an important parasitic zoonosis considered the most important helminth infection of ruminants in tropical countries. The aim of this study was to develop a PCR assay for the sensitive and specific detection of F. hepatica in formalin preserved sheep faeces. A 405-bp fragment of the cytochrome c oxidase subunit 1 gene of F. hepatica was amplified from stool samples of infected sheep. The PCR assay showed a detection limit of 20 pg of F. hepatica DNA. No cross-reactions were observed with samples containing coccidian oocysts or gastrointestinal nematodes eggs. Our PCR technique sh
Оценочное исследованиеСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Horse gastrointestinal myiasis caused by larvae of Gasterophilus spp. has a worldwide distribution. However, little information is available on the genetic variation of Gasterophilus spp. at the molecular level. In the present study, sequence variation was examined in three mitochondrial (mt) genes, namely mt cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunits 5 (nad5) and large subunit ribosomal RNA (rrnL), among G. intestinalis isolates originating from Heilongjiang Provience and Xinjiang Uygur Autonomous Region, China. The complete cox1, nad5, and rrnL gene sequences were amp
СтатьяПоддержка исследования: вне правительства СШАПолный текст не найденПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
DNA barcoding is a practical tool for species identification, when morphological classification of an organism is difficult. Herein we describe the utilisation of this technique in a case of ophthalmomyiasis interna. A 12-year-old boy was infested during a summer holiday in northern Norway, while visiting an area populated with reindeer. Following medical examination, a Diptera larva was surgically removed from the boy's eye and tentatively identified from its morphological traits as Hypoderma tarandi (L.) (Diptera: Oestridae). Ultimately, DNA barcoding confirmed this impression. The larval cy
Клинический случайСтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Taenia multiceps is a widely distributed zoonotic tapeworm of canids. The larval stage of the parasite (Coenurus) occurs in sheep, goat and cattle and has been rarely reported from humans. This study investigated genetic variability of two mitochondrial genes in 102 isolates of T. multiceps. Metacestodes were collected from brains and hearts of sheep in Tehran and Qom provinces of Iran. DNA of each isolate was extracted and used for PCR amplification of cytochrome c oxidase subunit I (CO1) and 12S ribosomal DNA (12S rRNA) genes. All amplicons were sequenced and the sequence data were analyzed
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A male patient with neurocysticercosis was identified in Montai Village, Xay District, Oudomxay Province, Lao PDR in February 2004. He had a history of diagnosis for neurocysticercosis by a CT scan in Thailand after an onset of epileptic seizure in 1993. A pig in the same district was found to contain Taenia solium metacestodes (=cysticerci); the slaughtered pig body contained more than 2,000 cysticerci. In addition to morphological identification, molecular identification was also performed on the cysticerci by DNA sequencing analysis of the mitochondrial cox1 gene; they were confirmed as T.
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
This is the first study to assess the effects of mother-infant separation on regional metabolic capacity in the preweanling rat brain. Mother-infant separation is generally known to be stressful for rat pups. Holtzman adolescent rats show a depressive-like behavioral phenotype after maternal separation during the preweanling period. However, information is lacking on the effects of maternal separation on the brains of rat pups. We addressed this issue by mapping the brains of preweanling Holtzman rat pups using cytochrome oxidase histochemistry, which reflects long-term changes in brain metabo
СтатьяПоддержка NIH: внешняя программаПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
To assess the role of the mitochondrial metabolic competence (MMC) in the development of age-related changes, we measured the levels of immunohistochemically stained (IH) mitochondrial- and nuclear-encoded subunits of cytochrome oxidase (COX II and COX IV, respectively) and compared these data with mRNA in situ hybridization (ISH) of the same subunits and with cytochemically evidenced COX activity in the temporal (TC) and frontal (FC) cortex of adult and late-adult monkeys. Quantitative cytochemistry of COX activity was performed by calculating the ratio (R) of the area of the cytochemical pre
СтатьяПоиск полного текста в очередиПеревод пока не подготовлен
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degr
Аннотация на английскомСтатьяПоиск полного текста в очередиОригинал на русском
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Metabolic control analysis was applied to intact HepG2 cells. The effect on the control coefficient of cytochrome c oxidase (CcOX) over cell respiration of both the electrical (Delta psi) and chemical (Delta pH) component of the mitochondrial transmembrane proton electrochemical gradient (Delta mu(H(+))) was investigated. The overall O(2) consumption and specific CcOX activity of actively phosphorylating cells were titrated with cyanide under conditions in which Delta psi and Delta pH were selectively modulated by addition of ionophores. In the absence of ionophores, CcOX displayed a high cont
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
Baylisascaris procyonis is a helminth parasite commonly found in North American raccoons (Procyon lotor) that is a cause of clinical neural, ocular, and visceral larva migrans in humans when infective eggs are ingested. Rapid detection of B. procyonis eggs in contaminated soil and water would assist public health analysts in evaluating risks associated with public exposure to areas of known raccoon activity. In this study, a molecular beacon probe-based real-time polymerase chain reaction (PCR) assay was developed to enable rapid and specific detection of eggs of Baylisascaris spp. The molecul
Оценочное исследованиеСтатьяПоддержка службы здравоохранения СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
A new Coccidia species is reported from the natural population of Pied Flycatcher (Ficedula hypoleuca) in northern Germany. Sporulated oocysts were found in faeces from 6 of 8 sampled adults. The spherical oocysts of the new Isospora species have a brownish, smooth, bi-layered wall. Average size of sporulated oocysts was 19.4 x 19.3 microm (17.5-22.8 microm x 17.5-22.8 microm ) with a shape index (length/width) of 1.0. The sporulated oocysts have no micropyle or residuum, but enclose several small polar granules that often cluster into 2-3 dumbbell-shaped formations. Sporocysts are slightly el
СтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
The tapeworm Diphyllobothrium nihonkaiense (Cestoda: Diphyllobothriidea), originally described from Japan, is reported from a man in North America for the first time. Species identification was based on sequences of ribosomal (partial 18S rRNA) and mitochondrial (partial Cytochrome c Oxidase subunit I) genes of proglottids expelled from a Czech tourist who ate raw Pacific sockeye salmon (Oncorhynchus nerka) from British Columbia, Canada.
Клинический случайСтатьяПоддержка исследования: вне правительства СШАПоиск полного текста в очередиПеревод в очереди
Обработка статьи · этапы, ошибки и управление
Загрузка состояния…
Ошибки и ограничения
История · было → стало
Состояние обновляется каждые 5 секунд, пока блок открыт. Процент показывается только там, где известен объём работы. Пауза останавливает продолжение этапа; текущий запрос к источнику может завершиться.
MedElevator
Войти в исследования